Antisense oligonucleotides targeting CFP-ELK1 intergene region

Abstract

The present invention relates to antisense oligonucleotides that are complementary to the ELK1-CFP precursor mRNA transcript and cause a reduction in the level of said transcript in the cell. The invention further relates to conjugates, salts and pharmaceutical compositions of said antisense oligonucleotides; and methods for treating diseases, including amyotrophic lateral sclerosis, associated with an increase in the level of ELK1-CFP precursor mRNA transcript.

Description

Technical Field

[0001] The present invention relates to antisense oligonucleotides complementary to the transcribed human CFP-ELK1 intergenic region. These antisense oligonucleotides can cause the level of ELK1-CFP pre-mRNA transcripts in cells to decrease. The present invention further relates to conjugates, salts and pharmaceutical compositions thereof; and methods for treating diseases associated with increased levels of ELK1-CFP pre-mRNA transcripts, including amyotrophic lateral sclerosis. Background Art

[0002] TAR DNA binding protein 43 (TDP-43) is encoded by TARDBP and plays a role in transcriptional repression, pre-mRNA splicing and translation regulation. This also includes polyadenylation of RNA transcripts. Therefore, removal or reduction of TDP-43 expression may cause the poly(A) tail to be detached from pre-mRNA transcripts.

[0003] TDP-43 depletion is manifested in a range of diseases, referred to as TDP-43 pathology, and includes diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular dystrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia 3, myopathies, and chronic traumatic encephalopathy.

[0004] ALS is also known as motor neuron disease or Lou Gehrig's disease. It is neurodegenerative and causes the gradual loss of motor neurons in the brain and spine. TARDBP mutations are associated with ALS, as are mutations in the C9orf72, SOD1, and FUS genes (Edgar et al. 2021, Neurobiol Aging, 108). Currently, there is no known cure for ALS, and it can affect people of any age. It may occur in families with a history of the disease, but it may also occur sporadically in subjects without familial cases. Typical treatment involves a form of assisted ventilation, which can prolong the subject's life, but cannot cure the disease. Currently available drugs, such as riluzole (US 5,527,81), can also only prolong life in the short term, but cannot provide a cure.

[0005] The present invention is aimed at designing new treatments for neurodegenerative diseases such as ALS.

[0006] The CFP gene encodes properdin, a plasma glycoprotein that plays a role in the complement system that activates the innate immune system. Expression of CFP triggers the complement cascade, and it is normally expressed only in the liver. Properdin allows the formation of stable C3 and C5 convertase attack complexes by binding to human cell membranes. The formation of the attack complex can then cause the lysis of dying cells. Overexpression of CFP in other parts of the body may be associated with neurodegenerative diseases. In particular, increased complement activation in the central nervous system has been associated with neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) ( et al. 2018, Mol. Immun. 102).

[0007] The present invention seeks to provide antisense oligonucleotides that ameliorate the effects of TDP-43 depletion by targeting CFP. Summary of the invention

[0008] The present invention relates to antisense oligonucleotides complementary to the transcribed intergenic region of human CFP-ELK1.

[0009] The ELK1 gene encodes an ETS-like-1 protein that acts as a transcriptional activator. It is adjacent to the complement factor properdin gene (CFP). The inventors have surprisingly determined that the lack of TDP-43 causes the poly (A) tail of the ELK1 pre-mRNA transcript to disengage. This in turn causes the transcription of ELK1 to continue to the adjacent CFP gene, thereby causing the transcription of a single combined pre-mRNA ELK1-CFP transcript. The transcript includes transcribed mRNAs from the two genes and the intergenic region between them.

[0010] Due to the presence of an exon-exon splice junction more than 50 bases downstream of the stop codon, the combined pre-mRNA ELK1-CFP transcript was expected to undergo nonsense-mediated (NMD) decay. However, the inventors have surprisingly determined that this may not always occur, but may result in increased CFP expression.

[0011] TDP-43 deficiency or reduced levels may cause increased CFP expression in the brain, as properdin protein may be translated from the combined ELK1-CFP transcript. In this way, TDP-43 deficiency or reduced levels have been associated with neurodegenerative diseases, including ALS. It is an object of the present invention to provide antisense oligonucleotides that ameliorate the effects of TDP-43 depletion by targeting the ELK1-CFP intergenic region.

[0012] The present invention provides antisense oligonucleotides complementary to the ELK1-CFP intergenic region. These antisense oligonucleotides may be able to reduce the level of ELK1-CFP pre-mRNA in cells

[0013] The antisense oligonucleotide of the present invention can reduce the level of ELK1-CFP pre-mRNA by binding to ELK1-CFP pre-mRNA.

[0014] It is believed that the antisense oligonucleotides of the present invention bind to the transcribed ELK1-CFP pre-mRNA, thereby causing the recruitment of RNase H1, which causes the cleavage of the ELK1-CFP pre-mRNA. It is believed that the cleaved ELK1-CFP pre-mRNA transcript is degraded. Therefore, the level of the ELK1-CFP pre-mRNA transcript in the cell is reduced.

[0015] Therefore, the antisense oligonucleotides of the present invention can be used to remove or reduce the level of ELK1-CFP pre-mRNA in cells.

[0016] In one aspect, the present invention provides an antisense oligonucleotide of 8 to 40 nucleotides in length, which comprises a contiguous nucleotide sequence of at least 8 nucleotides in length and which is complementary to the transcribed human CFP-ELK1 intergenic region.

[0017] In some embodiments, the antisense oligonucleotide complementary to the transcribed human CFP-ELK1 intergenic region may comprise a contiguous nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or completely complementary to the transcribed human ELK1-CFP intergenic region.

[0018] In some embodiments, the transcribed human ELK1-CFP intergenic region is within a human ELK1-CFP pre-mRNA transcript.

[0019] In some embodiments, the contiguous nucleotide sequence is 8 to 40 nucleotides in length.

[0020] In some embodiments, the antisense oligonucleotide is single stranded.

[0021] In some embodiments, the antisense oligonucleotide comprises one or more modified nucleosides.

[0022] In some embodiments, the antisense oligonucleotide is capable of recruiting RNase HI.

[0023] In some embodiments, the antisense oligonucleotide is a gapmer.

[0024] In some embodiments, antisense oligonucleotides may comprise at least one modified internucleoside linkage.

[0025] In some embodiments, one or more or all of the modified internucleoside linkages may comprise phosphorothioate linkages.

[0026] In some embodiments, all internucleoside linkages present in an antisense oligonucleotide may be phosphorothioate internucleoside linkages.

[0027] In some embodiments, the antisense oligonucleotide may be capable of reducing the level of ELK1-CFP pre-mRNA transcript in a cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a control.

[0028] In some embodiments, the control can be cells that have not been exposed to the antisense oligonucleotide.

[0029] In some embodiments, the antisense oligonucleotide may be covalently attached to at least one conjugate moiety.

[0030] In some embodiments, the antisense oligonucleotides may be in the form of a pharmaceutically acceptable salt.

[0031] In some embodiments, the salt can be a sodium salt or a potassium salt.

[0032] In some embodiments, the antisense oligonucleotides can be encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

[0033] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant.

[0034] In some embodiments, the pharmaceutical composition may comprise an aqueous diluent or solvent, such as phosphate-buffered saline.

[0035] The present invention provides an in vivo or in vitro method for reducing the level of ELK1-CFP pre-mRNA transcript in a cell transcribing ELK1-CFP pre-mRNA, the method comprising exposing the cell to an effective amount of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention.

[0036] In some embodiments, the cell can be a human cell or a mammalian cell.

[0037] In some embodiments, the level of human ELK1-CFP pre-mRNA transcript can be reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a control.

[0038] In some embodiments, the control is a cell that has not been exposed to an antisense oligonucleotide.

[0039] The present invention also provides a method for treating or preventing a disease, which comprises administering a therapeutically or preventively effective amount of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention to a subject suffering from or susceptible to the disease.

[0040] The present invention also provides an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention, which is used as a drug for treating or preventing a disease in a subject.

[0041] The present invention also provides use of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention for preparing a drug for treating or preventing a disease in a subject.

[0042] In some embodiments, the disease may be associated with increased levels of human ELK1-CFP pre-mRNA transcripts.

[0043] In some embodiments, the disease may be amyotrophic lateral sclerosis (ALS). BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1-Figure 1 Next generation sequence read mappings from ELK1 and CFP genes are shown, with mapped reads from two samples of untreated cells (PBS control) and two samples of cells treated with Compound A (SEQ ID 2) to deplete TDP-43 protein expression. Grey arrows indicate increased expression of mRNA reads mapped just downstream of ELK1 mRNA in cells treated with Compound A (SEQ ID 2). Black arrows indicate increased expression of downstream CFP genes (approximately 10-fold).

[0045] Figure 2-Figure 2 The expression level of the CFP gene relative to the localization of the tested gapmer ASOs (antisense oligonucleotides) is shown. The CFP mRNA levels in completely untreated cells and cells depleted of TDP-43 before the use of ASOs were superimposed as a benchmark.

[0046] Figure 3-Figure 3 The expression level of the ELK1 gene relative to the localization of the tested gapmer ASOs is shown. ELK1 mRNA levels in completely untreated cells and cells depleted of TDP-43 prior to ASO administration were superimposed as a benchmark. DETAILED DESCRIPTION

[0047] The present invention is based on the determination that in TDP-43-depleted cells, transcription of the ELK1 gene proceeds to the adjacent CFP gene, resulting in transcription of a single combined pre-mRNA ELK1-CFP transcript. This transcript includes transcribed mRNAs from both genes and the intergenic region between them.

[0048] The present inventors have identified that the level of ELK1-CFP pre-mRNA transcript can be reduced by targeting ELK1-CFP pre-mRNA with antisense oligonucleotides. This can reduce CFP expression in the brain and thus can be used to treat neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS).

[0049] Described herein are target sites present in the human ELK1-CFP pre-mRNA transcript that can be targeted by antisense oligonucleotides. In some embodiments, antisense oligonucleotides may be capable of reducing the level of ELK1-CFP pre-mRNA transcripts.

[0050] The present inventors have surprisingly determined that targeting the intergenic region of the human ELK1-CFP pre-mRNA transcript may be particularly effective, for example, in reducing CFP expression in the brain.

[0051] Without wishing to be bound by theory, it is believed that the antisense oligonucleotides of the present invention can reduce the level of ELK1-CFP pre-mRNA transcripts by binding to ELK1-CFP pre-mRNA transcripts. It is believed that the combination of the antisense oligonucleotides of the present invention with the intergenic region of the ELK1-CFP pre-mRNA transcripts causes RNase H1 to be recruited to the ELK1-CFP pre-mRNA transcripts, thereby causing the cracking of the ELK1-CFP pre-mRNA transcripts and the degradation of the pre-mRNA of the subsequent cracking. Therefore, there is a reduction in the level of ELK1-CFP pre-mRNA transcripts and a reduction in the expression of CFP produced thereby. The reduction in CFP expression can be in the brain or elsewhere.

[0052] Reduction of the levels of ELK1-CFP pre-mRNA transcript and CFP expression is desirable for treating a range of disorders characterized by or caused by increased CFP expression in the brain. These include amyotrophic lateral sclerosis (ALS).

[0053] Antisense Oligonucleotides

[0054] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the level of a target mRNA transcript by hybridizing to a target nucleic acid, particularly to a continuous sequence on the target nucleic acid. As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides complementary to the nucleotides of a target mRNA as generally understood by those skilled in the art. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0055] Antisense oligonucleotides are generally not double-stranded, and are therefore not siRNAs or shRNAs.

[0056] Antisense oligonucleotides are usually prepared in the laboratory by first solid phase chemical synthesis and then purified and separated. When referring to the sequence of antisense oligonucleotides, what is referred to is the covalently linked nucleotide or nucleoside core base portion or its modified sequence or order. The antisense oligonucleotides of the present invention are artificial, and are chemically synthesized, and are usually purified or separated. The antisense oligonucleotides of the present invention may include one or more modified nucleosides, such as 2' sugar-modified nucleosides. The antisense oligonucleotides of the present invention may include one or more modified internucleoside bonds, such as one or more thiophosphate internucleoside bonds.

[0057] In some embodiments, the antisense oligonucleotides of the present invention are single-stranded antisense oligonucleotides. It should be understood that the single-stranded antisense oligonucleotides of the present invention can form a hairpin or intermolecular duplex structure (a duplex between two molecules of the same antisense oligonucleotide) as long as the degree of self-complementarity within or between them is less than about 50% of the total length of the antisense oligonucleotide.

[0058] In some embodiments, the single-stranded antisense oligonucleotides of the invention may be free of RNA nucleosides.

[0059] Advantageously, the antisense oligonucleotides of the invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides. Furthermore, in some antisense oligonucleotides of the invention, it may be advantageous that the unmodified nucleosides are DNA nucleosides.

[0060] In some embodiments, the antisense oligonucleotides of the invention are 8 to 40 nucleotides in length.

[0061] In some embodiments, the antisense oligonucleotides of the invention are 8 to 40 nucleotides in length and comprise a contiguous nucleotide sequence of at least 40 nucleotides in length, such as 8 to 40 nucleotides in length.

[0062] In some embodiments, the antisense oligonucleotides of the invention are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0063] In some embodiments, antisense oligonucleotides of the invention are at least 12 nucleotides in length.

[0064] In some embodiments, antisense oligonucleotides of the invention are at least 14 nucleotides in length.

[0065] In some embodiments, antisense oligonucleotides of the invention are at least 16 nucleotides in length.

[0066] In some embodiments, antisense oligonucleotides of the invention are at least 18 nucleotides in length.

[0067] Preferably, the antisense oligonucleotides of the present invention are 16 to 20 nucleotides in length.

[0068] More preferably, the antisense oligonucleotide of the present invention is 18 to 20 nucleotides in length.

[0069] In some embodiments, the contiguous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0070] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence.

[0071] In some embodiments, the antisense oligonucleotide consists of a contiguous nucleotide sequence.

[0072] In some embodiments, the antisense oligonucleotide is a contiguous nucleotide sequence.

[0073] Modified antisense oligonucleotides

[0074] The antisense oligonucleotide according to the present invention may be a modified antisense oligonucleotide.

[0075] The term modified antisense oligonucleotide describes a kind of antisense oligonucleotide, and it comprises one or more sugar-modified nucleosides and / or the internucleoside bond of modification.Term " chimeric antisense oligonucleotide " is the term for the antisense oligonucleotide that has been used to describe the antisense oligonucleotide that comprises sugar-modified nucleosides and DNA nucleosides in the document.In certain embodiments, it may be advantageous that antisense oligonucleotide according to the present invention is a chimeric antisense oligonucleotide.

[0076] In some embodiments, the antisense oligonucleotides or contiguous nucleotide sequences thereof according to the present invention may include modified nucleobases that act as typical nucleobases in base pairing, for example, 5-methylcytosine may be used instead of methylcytosine. Inosine may be used as a universal base.

[0077] It will be appreciated that the contiguous nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to a target nucleic acid.

[0078] The pattern of incorporating modified nucleosides (eg, high affinity modified nucleosides) into an antisense oligonucleotide sequence is often referred to as antisense oligonucleotide design.

[0079] In an embodiment, the antisense oligonucleotide according to the present invention comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 or at least 19 modified nucleosides.

[0080] In some embodiments, all nucleosides of the antisense oligonucleotide may be modified nucleosides.

[0081] Suitable modifications are described herein under the headings "Modified Nucleosides", "High Affinity Modified Nucleosides", "Sugar Modifications", "2' Sugar Modifications" and "Locked Nucleic Acids (LNA)".

[0082] Gap polymer

[0083] Spacers are short DNA antisense oligonucleotides with segments that mimic RNA at either end of a central DNA region. Spacers will bind to pre-mRNA transcripts containing sequences complementary to the spacer DNA sequence, with the segments that mimic RNA ensuring high binding affinity. High binding affinity ensures reduced off-target effects, while hybridization between the spacer and pre-mRNA can prevent complete transcription of the pre-mRNA by RNA polymerase.

[0084] The spacer also induces cleavage of the pre-mRNA transcript by recruiting RNase H, thereby cleaving the RNA-DNA hybrid. Through modification, particularly by using locked nucleic acids, the spacer can be engineered to increase nuclease resistance and reduce immunogenicity and toxicity. The pre-mRNA that has been cleaved by RNase H is then degraded, thereby preventing the translation of the spacer-targeted transcript. In this way, the spacer can be used as a therapeutic agent to limit the level of pre-mRNA of genes whose overexpression may cause or lead to disease and negative patient outcomes. Therefore, the spacer can be engineered and synthesized to target specific pre-mRNA transcripts, thereby treating or preventing diseases caused by overexpression of identified genes.

[0085] In some embodiments, the antisense oligonucleotides of the invention are gapmers.

[0086] As used herein, the term "gapmer" refers to an antisense oligonucleotide comprising a region of the antisense oligonucleotide (the gap) that recruits RNase H flanked on the 5' and 3' sides by one or more affinity-enhancing modified nucleosides (the flanks). Various gapmer designs are described herein.

[0087] The headmer and tailmer are antisense oligonucleotides capable of recruiting RNase H, wherein one of the flanks is missing, i.e., only one of the two ends of the antisense oligonucleotide contains a nucleoside with an affinity-enhancing modification. The headmer lacks the 3' flank (i.e., the 5' flank contains a nucleoside with an affinity-enhancing modification), and the tailmer lacks the 5' flank (i.e., the 3' flank contains a nucleoside with an affinity-enhancing modification).

[0088] In the present invention, the antisense oligonucleotide may be a headmer or a tailmer.

[0089] The term "LNA gapmer" refers to a gapmer antisense oligonucleotide, wherein at least one of the affinity-enhancing modified nucleosides is an LNA nucleoside. In the present invention, the antisense oligonucleotide may be an LNA gapmer.

[0090] The term "mixed wing spacer" refers to an LNA spacer wherein the wing region comprises at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, one or more 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. In some embodiments, the mixed wing spacer has one wing comprising an LNA nucleoside (e.g., 5' or 3') and the other wing (3' or 5', respectively) comprising a 2' substituted modified nucleoside. In the present invention, the antisense oligonucleotide may be a mixed wing spacer.

[0091] Spacer design

[0092] In a preferred embodiment, the antisense oligonucleotides of the present invention have a gapmer design or structure, also referred to herein simply as a "gapmer".

[0093] In the gapmer structure, the antisense oligonucleotide comprises at least three different structural regions: 5'-flank in the '5->3' direction, gap and 3'-flank FG-F'. In this design, when the antisense oligonucleotide is in a duplex with the target nucleic acid, the flanking regions F and F' (also referred to as wing regions) comprise a continuous stretch of modified nucleosides that are complementary to the intergenic region of the ELK1-CFP pre-mRNA transcript target nucleic acid, while the gap region G comprises a continuous stretch of nucleotides that can recruit nucleases, preferably endonucleases, such as RNAses, for example, RNAse H. Nucleosides capable of recruiting nucleases, particularly RNAse H, can be selected from the group consisting of: DNA, α-L-oxy-LNA, 2'-fluoro-ANA and UNA.

[0094] Regions F and F' flanking the 5' and 3' ends of region G preferably contain non-nuclease recruiting nucleosides (nucleosides having a 3' endo structure), more preferably one or more affinity enhancing modified nucleosides.

[0095] In some embodiments, the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, the 5' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, both the 5' and 3' flank regions comprise LNA nucleosides, preferably at least 2 LNA nucleosides. In some embodiments, all nucleosides in the flank regions are LNA nucleosides.

[0096] In other embodiments, the flanking region may contain both LNA nucleosides and other nucleosides (mixed flanking), such as DNA nucleosides and / or non-LNA modified nucleosides, such as 2' substituted nucleosides. In this case, the gap is defined as a continuous sequence of at least 5 nucleosides that recruit RNase H (nucleosides with 2' endo structures, preferably DNA), which are flanked at the 5' and 3' ends by affinity-enhancing modified nucleosides, preferably LNA, such as β-D-oxy-LNA. Therefore, the nucleosides of the 5' flanking region and the 3' flanking region adjacent to the gap region are modified nucleosides, preferably nucleosides that recruit non-nucleases. In antisense oligonucleotides with mixed flanking wherein the flanking comprises DNA, the 5' and 3' nucleosides are modified nucleosides.

[0097] Nucleotides and nucleosides

[0098] Nucleotides and nucleosides are components of antisense oligonucleotides and polynucleotides, and for purposes of the present invention, include naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a core base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0099] Modified Nucleosides

[0100] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications to the sugar moiety or the (nucleo)base moiety.

[0101] Advantageously, the antisense oligonucleotides according to the invention may comprise one or more modified nucleosides.

[0102] In some embodiments, the contiguous nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to a target nucleic acid. Advantageously, high affinity modified nucleosides are used.

[0103] Advantageously, one or more modified nucleosides of antisense oligonucleotides according to the present invention may include modified sugar moieties. The term modified nucleosides may also be used interchangeably with the term "nucleoside analogs" or modified "units" or modified "monomers" herein. Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. If the nucleosides with modifications in the base regions of DNA or RNA nucleosides allow Watson Crick (Watson Crick) base pairing, they are still generally referred to as DNA or RNA. The exemplary modified nucleosides that can be used in the antisense oligonucleotides according to the present invention include LNA, 2'-O-MOE, 2'oMe and morpholino nucleoside analogs.

[0104] Locked Nucleoside Nucleosides (LNA Nucleosides)

[0105] "LNA nucleosides" are 2'-modified nucleosides that contain a double radical (also called a "2'-4' bridge") connecting the C2' and C4' ribose sugar rings of the nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into an antisense oligonucleotide of a complementary RNA or DNA molecule, the locking of the ribose conformation is associated with an enhanced affinity for hybridization (duplex stabilization). This can be routinely determined by measuring the melting temperature of the antisense oligonucleotide / complementary duplex.

[0106] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al., J. Org. Chem. 2010, Vol. 75(5), pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667, all of which are incorporated herein in their entirety.

[0107] Other non-limiting exemplary LNA nucleosides are disclosed in Scheme 1.

[0108] Scenario 1:

[0109]

[0110] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.

[0111] A particularly advantageous LNA is β-D-oxy-LNA.

[0112] Modified internucleoside linkages

[0113] Advantageously, the antisense oligonucleotides according to the invention comprise one or more modified internucleoside linkages.

[0114] As commonly understood by the skilled artisan, the term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently couples two nucleosides together. The antisense oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0115] In some embodiments, at least 50% of the internucleoside bonds in the antisense oligonucleotides or their continuous nucleotide sequences according to the present invention are phosphorothioates, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 90% or more of the internucleoside bonds in the antisense oligonucleotides or their continuous nucleotide sequences are phosphorothioates. In some embodiments, all the internucleoside bonds in the antisense oligonucleotides or their continuous nucleotide sequences of the present invention are phosphorothioates.

[0116] In another embodiment, the antisense oligonucleotide according to the invention comprises at least one modified internucleoside linkage. It is advantageous if at least 75%, such as all, of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages.

[0117] Advantageously, all internucleoside bonds of the contiguous nucleotide sequence of the antisense-oligonucleotide according to the present invention may be phosphorothioate bonds, or all internucleoside bonds of the antisense-oligonucleotide according to the present invention may be phosphorothioate bonds.

[0118] Nucleobase

[0119] The term nucleobase includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses modified nucleobases that are different from naturally occurring nucleobases but functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012), Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 37 1.4.1.

[0120] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0121] The nucleobase moiety may be represented by a letter code for each corresponding nucleobase, such as A, T, G, C or U, wherein each letter may optionally include a functionally equivalent modified nucleobase. For example, in an exemplary antisense oligonucleotide, the nucleobase moiety is selected from A, T, G, C and 5-methylcytosine. Optionally, a 5-methylcytosine LNA nucleoside may be used in the LNA spacer. 5-methylcytosine may be represented as "E".

[0122] High affinity modified nucleosides

[0123] A high affinity modified nucleoside is a modified nucleoside that, when incorporated into an antisense oligonucleotide, can enhance the affinity of the antisense oligonucleotide for its complementary target, as measured, for example, by melting temperature (Tm). The high affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by between +0.5°C and +12°C, more preferably between +1.5°C and +10°C, and most preferably between +3°C and +8°C. Many high affinity modified nucleosides are known in the art, and include, for example, many 2' substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 203-213).

[0124] Sugar modification

[0125] Antisense oligonucleotides according to the invention may comprise one or more nucleosides having a modified sugar moiety (ie, a modification of the sugar moiety) when compared to the ribose moiety found in DNA and RNA.

[0126] A number of nucleosides with modifications of the ribose sugar moiety have been prepared, primarily with the goal of improving certain properties of antisense oligonucleotides, such as affinity and / or nuclease resistance.

[0127] The present invention relates to the modification of the present invention. These modifications include such modifications, wherein the ribose ring structure is modified, such as substituted with a hexose ring (HNA) or a bicyclo, which usually has a bicyclo of a diradicle bridge (biradicle bridge) between the C2 and C4 carbon atoms on the ribose ring (LNA), or usually lacks the unconnected ribose ring (such as UNA) of a key between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which sugar moieties are substituted with non-sugar moieties, such as with regard to peptide nucleic acids (PNA) or morpholino nucleic acids.

[0128] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or the 2'-OH group naturally present in DNA and RNA nucleosides. For example, substituents can be introduced at the 2', 3', 4' or 5' positions.

[0129] 2' sugar modified nucleosides

[0130] A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or contains a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon atom in the ribose ring, such as an LNA (2'-4' diradical bridged) nucleoside.

[0131] In fact, people have spent a lot of effort to develop 2' sugar substituted nucleosides, and found that many 2' substituted nucleosides have beneficial properties after incorporation into antisense oligonucleotides. For example, 2' modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to antisense oligonucleotides. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'oMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 203-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic diagrams of some 2' substituted modified nucleosides.

[0132]

[0133] With respect to the present invention, 2' substituted sugar modified nucleosides do not include 2' bridged nucleosides like LNA.

[0134] In one embodiment, the antisense oligonucleotide according to the present invention comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the antisense oligonucleotide according to the present invention comprises one or more 2' sugar-modified nucleosides, which are independently selected from the group consisting of the following items: 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'oMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (2'MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinose nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. If one or more modified nucleosides are locked nucleic acids (LNA), it is preferred.

[0135] Morpholino oligonucleotides

[0136] In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers and as phosphodiamidate morpholino oligomers (PMOs)). Splicing-modulating morpholino antisense oligonucleotides have been approved for clinical use - see, for example, eteplirsen, a 30nt morpholino antisense oligonucleotide targeting a frameshift mutation in DMD, for the treatment of Duchenne muscular dystrophy. Morpholino antisense oligonucleotides have a nuclease attached to a six-membered morpholine ring instead of a ribose, such as a methylene morpholine ring connected by a phosphodiamidate group, for example, as illustrated by the following 4 consecutive morpholino nucleotides:

[0137]

[0138] In some embodiments, a morpholino antisense oligonucleotide according to the invention may be, for example, 8 to 40 morpholino nucleotides in length, such as 16 to 20 morpholino nucleotides in length, such as 18 to 20 morpholino nucleotides in length.

[0139] Connectors

[0140] A bond or linker is a connection between two atoms that connects one target chemical group or segment to another target chemical group or segment via one or more covalent bonds. The conjugate moiety can be attached to the antisense oligonucleotide directly or through a linker (e.g., a linker or tether). The linker is used to covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an antisense oligonucleotide or a continuous nucleotide sequence (region A) that is complementary to a target nucleic acid.

[0141] In some embodiments of the present invention, the conjugate or antisense oligonucleotide of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the antisense oligonucleotide or continuous nucleotide sequence (region A or first region) complementary to the target nucleic acid and the conjugate portion (region C or third region).

[0142] Region B refers to a biodegradable joint comprising or consisting of a physiologically unstable bond, which is cleavable under conditions commonly encountered in mammals or under conditions similar thereto. The conditions under which the physiologically unstable joint undergoes chemical transformation (e.g., cleavage) include chemical conditions, such as pH, temperature, oxidation or reduction conditions or agents, and salt concentrations found in mammalian cells or similar to those encountered in mammalian cells. Conditions within mammalian cells also include the presence of enzymatic activity (such as from proteolytic enzymes or hydrolytic enzymes or nucleases) that is commonly present in mammalian cells. In one embodiment, the biodegradable joint is susceptible to S1 nuclease cleavage. In certain embodiments, the nuclease-sensitive joint comprises 1 to 5 nucleosides, such as one or more DNA nucleosides comprising at least two continuous phosphodiester bonds. The biodegradable joint containing phosphodiester is described in more detail in WO 2014 / 076195.

[0143] Region Y refers to a linker that is not necessarily biodegradable but is primarily used to covalently link the conjugate moiety (region C or the third region) to the antisense oligonucleotide (region A or the first region). The region Y linker may comprise a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units or aminoalkyl groups. The antisense oligonucleotides of the present invention may be composed of the following regional elements AC, ABC, ABYC, AYBC or AYC. In some embodiments, the linker (region Y) is an aminoalkyl group (such as a C2-C36 aminoalkyl group), including, for example, a C6 to C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0144] Target

[0145] The antisense oligonucleotide of the present invention is an oligonucleotide that targets ELK1-CFP pre-mRNA transcript.

[0146] The antisense oligonucleotide of the present invention comprises a continuous nucleotide sequence complementary to the transcribed intergenic region of human CFP-ELK1.

[0147] In some embodiments, the target sequence is human ELK1-CFP pre-mRNA transcript.

[0148] The human ELK1-CFP pre-mRNA transcript may be referred to as a target sequence.

[0149] In some embodiments, the target sequence is human ELK1-CFP pre-mRNA transcript, which can be encoded by SEQ ID NO. 1 or a fragment thereof.

[0150] One aspect of the present invention relates to an antisense oligonucleotide comprising a contiguous nucleotide sequence of 8 to 40 nucleotides in length complementary to SEQ ID NO 1 or a fragment thereof.

[0151] In an embodiment, the fragments can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0152] In some embodiments, the antisense oligonucleotides of the present invention comprise a contiguous sequence that is at least about 75% complementary to SEQ ID NO 1, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary.

[0153] In some embodiments, the antisense oligonucleotides of the present invention comprise a contiguous sequence, which may comprise one or two mismatches between the contiguous nucleotide sequence and the target nucleic acid (ie, the human CFP-ELK1 intergenic region).

[0154] In a preferred embodiment, the antisense oligonucleotide of the present invention or its consecutive nucleotide sequence is completely complementary to SEQ ID NO 1 (ie, about 100% complementary).

[0155] 102, SEQ ID NO 103, SEQ ID NO 104, SEQ ID NO 105, SEQ ID NO 106, SEQ ID NO 107, SEQ ID NO 108, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 111, SEQ ID NO 112, SEQ ID NO 113, SEQ ID NO 114, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130 NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134. SEQ ID NO 135, SEQ ID NO 136, SEQ ID NO 137, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 166, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 175, SEQ ID NO 176, SEQ ID NO 177, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 184, SEQ ID NO 185, SEQ ID NO 186 and SEQ ID NO 187.

[0156] In an embodiment, the fragments can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0157] In some embodiments, the antisense oligonucleotides of the invention comprise a contiguous sequence that is at least about 75% complementary, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary to a sequence selected from the group consisting of SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 103, SEQ ID NO 104, or SEQ ID NO 105. 104. SEQ ID NO 105, SEQ ID NO 106, SEQ ID NO 107, SEQ ID NO 108, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 111, SEQ ID NO 112, SEQ ID NO 113, SEQ ID NO 114, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117. SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134, SEQ ID NO 135, SEQ ID NO 136, SEQ ID NO 137, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 166, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 175, SEQ ID NO 176, SEQ ID NO 177, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 184, SEQ ID NO 185, SEQ ID NO 186, and SEQ ID NO 187.

[0158] In a preferred embodiment, the antisense oligonucleotide of the present invention or a contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a sequence or a fragment thereof selected from the group consisting of SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 103, SEQ ID NO 104, SEQ ID NO 105, SEQ ID NO 106, SEQ ID NO 107, SEQ ID NO 108, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 111, SEQ ID NO 112, SEQ ID NO 113, SEQ ID NO 114, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO132, SEQ ID NO 133, SEQ ID NO 134, SEQ ID NO 135. SEQ ID NO 136, SEQ ID NO 137, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO162. SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 166, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 175, SEQ ID NO 176, SEQ ID NO 177, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 184, SEQ ID NO 185, SEQ ID NO 186 and SEQ ID NO 187.

[0159] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing the expression of CFP to at least the level of untreated cells (100%).

[0160] In some embodiments, the antisense oligonucleotides of the invention comprise a contiguous sequence that is at least about 75% complementary, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary to a sequence selected from the group consisting of SEQ ID NO 98, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 105, SEQ ID NO 107, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 113, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125 NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129. SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134, SEQ ID NO 135, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149. SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ IDNO 165, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 185, SEQ ID NO 186 and SEQ ID NO 187.

[0161] 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134, SEQ ID NO 135, SEQ ID NO 136, SEQ ID NO 137, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 133. SEQ ID NO 134, SEQ ID NO 135, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148. SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 167. SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO182, SEQ ID NO 183, SEQ ID NO 185, SEQ ID NO 186 and SEQ ID NO 187.

[0162] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing CFP expression to less than 10% of the level in untreated cells.

[0163] In some embodiments, the antisense oligonucleotides of the invention comprise a contiguous sequence that is at least about 75% complementary, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary to a sequence selected from the group consisting of SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 124, SEQ ID NO 126, SEQ ID NO 128, SEQ ID NO 132, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161 ID NO 154, SEQ ID NO 157, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 168, SEQ ID NO 169 and SEQ ID NO 172.

[0164] In a preferred embodiment, the antisense oligonucleotide of the present invention or its contiguous nucleotide sequence is fully complementary (100% complementary) to a sequence or a fragment thereof selected from the group consisting of SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 124, SEQ ID NO 126, SEQ ID NO 128, SEQ ID NO 132, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 145, SEQ ID NO 154, SEQ ID NO 157, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 168, SEQ ID NO 169 and SEQ ID NO 172.

[0165] Antisense oligonucleotide design

[0166] The antisense oligonucleotide of the present invention is an oligonucleotide comprising a contiguous nucleotide sequence of at least 8 nucleotides in length, which is complementary to the transcribed human CFP-ELK1 intergenic region. The antisense oligonucleotide may be able to reduce the level of ELK1-CFP pre-mRNA transcripts in cells.

[0167] In certain embodiments, antisense oligonucleotide comprises continuous nucleotide sequence, and can optionally comprise other one or more nucleotides, for example can be used for functional group (for example, conjugate group) is attached to the nucleotide joint region of continuous nucleotide sequence.Nucleotide joint region can be complementary or non-complementary with target nucleic acid.It should be understood that the continuous nucleotide sequence of antisense oligonucleotide can not be longer than antisense oligonucleotide itself, and antisense oligonucleotide can not be shorter than continuous nucleotide sequence.

[0168] Continuous nucleotide sequence

[0169] The term "contiguous nucleotide sequence" refers to a region of an antisense oligonucleotide that is complementary to a target nucleic acid, which may be or may include an antisense oligonucleotide motif sequence. In this article, the term is used interchangeably with "contiguous nucleobase sequence".

[0170] Antisense oligonucleotides comprise a contiguous nucleotide sequence and may optionally comprise one or more additional nucleotides, such as a nucleotide linker region that can be used to attach a functional group (e.g., a conjugate group) to the contiguous nucleotide sequence. The nucleotide linker region may be complementary or non-complementary to the target nucleic acid.

[0171] It is to be understood that the contiguous nucleotide sequence of an antisense oligonucleotide cannot be longer than the antisense oligonucleotide itself, and the antisense oligonucleotide cannot be shorter than the contiguous nucleotide sequence.

[0172] In some embodiments, the entire nucleotide sequence of the antisense oligonucleotide of the present invention is a contiguous nucleotide sequence.

[0173] A contiguous nucleotide sequence is a sequence of nucleotides in an antisense oligonucleotide of the invention that is complementary, and in some cases completely complementary, to a target nucleic acid, target sequence, or target site sequence.

[0174] In some embodiments, the contiguous nucleotide sequence is 8 to 40 nucleotides in length.

[0175] In some embodiments, the contiguous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0176] In some embodiments, the contiguous nucleotide sequence is at least 12 nucleotides in length.

[0177] In some embodiments, the contiguous nucleotide sequence is at least 14 nucleotides in length.

[0178] In some embodiments, the contiguous nucleotide sequence is at least 16 nucleotides in length.

[0179] In some embodiments, the contiguous nucleotide sequence is at least 18 nucleotides in length.

[0180] In a preferred embodiment, the length of the contiguous nucleotide sequence is 16 to 20 nucleotides.

[0181] More preferably, the length of the contiguous nucleotide sequence is 18 to 20 nucleotides.

[0182] In some embodiments, the antisense oligonucleotides of the invention consist of contiguous nucleotide sequences.

[0183] In some embodiments, the antisense oligonucleotides of the invention are contiguous nucleotide sequences.

[0184] 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65 36. SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50. SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71. SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO78. SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93 and SEQ ID NO 94.

[0185] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing the expression of CFP to at least the level in untreated cells (100%).

[0186] 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 49. SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64. SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 92, SEQ ID NO 93 and SEQ ID NO 94.

[0187] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing CFP expression to less than 10% of the level in untreated cells.

[0188] In a preferred embodiment, the contiguous nucleotide sequence comprises a sequence or a fragment thereof selected from the group consisting of SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 31, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 39, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 52, SEQ ID NO 61, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 75, SEQ ID NO 76 and SEQ ID NO 79.

[0189] In some embodiments, the fragment can be at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 or at least 19 consecutive nucleotides of a continuous nucleotide sequence, preferably at least 10 consecutive nucleotides thereof.

[0190] The antisense oligonucleotides of the present invention may be able to reduce the level of ELK1-CFP pre-mRNA transcript.

[0191] As used herein, the term "reduced levels" should be understood as a general term describing the ability of an antisense oligonucleotide to reduce the level of ELK1-CFP pre-mRNA transcript in a cell when compared to a control in which the cell is not exposed to the antisense oligonucleotide of the invention.

[0192] Without wishing to be bound by theory, it is believed that the reduction achieved by the antisense oligonucleotide is related to its ability to reduce, remove, prevent, decrease, diminish or terminate ELK1-CFP pre-mRNA transcripts, e.g., by degrading or removing ELK1-CFP pre-mRNA transcripts or by blocking or preventing polymerase activity associated with ELK1-CFP pre-mRNA transcripts.

[0193] In certain embodiments, the antisense oligonucleotides of the invention can reduce the level of ELK1-CFP pre-mRNA transcripts by at least about 10% compared to a control. More preferably, the antisense oligonucleotides of the invention can reduce the level of ELK1-CFP pre-mRNA transcripts by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or about 100% compared to a control.

[0194] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing the expression of CFP to at least the level of untreated cells (100%).

[0195] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing CFP expression to less than 90% of the levels of untreated cells, less than 80% of the levels of untreated cells, less than 70% of the levels of untreated cells, less than 60% of the levels of untreated cells, less than 50% of the levels of untreated cells, less than 40% of the levels of untreated cells, less than 30% of the levels of untreated cells, less than 20% of the levels of untreated cells, or less than 10% of the levels of untreated cells.

[0196] In some embodiments, the antisense oligonucleotides of the invention or contiguous nucleotide sequences thereof are capable of reducing CFP expression to less than 10% of the level in untreated cells.

[0197] Preferably, the antisense oligonucleotides of the present invention reduce the level of ELK1-CFP pre-mRNA transcripts in cells by degrading or removing the ELK1-CFP pre-mRNA transcripts.

[0198] Comparison

[0199] When the term "control" is used in connection with measuring the effect of an antisense oligonucleotide, it is generally understood that the control is a cell that has not been exposed to the antisense oligonucleotide.

[0200] Alternatively, the reduction in the level of ELK1-CFP pre-mRNA transcript can be determined by reference to the level of ELK1-CFP pre-mRNA transcript present in the cell prior to exposure to the antisense oligonucleotide.

[0201] In other embodiments, the control can be cells treated with a non-targeting oligonucleotide.

[0202] In some embodiments, the control can be a mock transfection, for example, where the cells are treated with PBS.

[0203] Conjugate

[0204] The present invention encompasses an antisense oligonucleotide of the present invention covalently attached to at least one conjugate moiety. In some embodiments, this may be referred to as a conjugate of the present invention.

[0205] As used herein, the term "conjugate" refers to an antisense oligonucleotide of the invention covalently linked to a non-nucleotide portion (a conjugate portion or region C or a third region). The conjugate portion can be covalently linked to the antisense oligonucleotide of the invention, optionally via a linker group (such as region D' or D ").

[0206] Antisense oligonucleotide conjugates and their synthesis have also been reported in the reviews: Manoharan, Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Chapter 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, which references are incorporated herein by reference in their entirety.

[0207] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0208] RNase H activity and recruitment

[0209] The RNase H activity of an antisense oligonucleotide refers to the ability of the antisense oligonucleotide to recruit RNase H when in a duplex with a complementary RNA molecule. WO01 / 23613 (incorporated herein in its entirety) provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H.

[0210] An antisense oligonucleotide is generally considered to be able to recruit RNase H if it has an initial rate when provided with a complementary target nucleic acid sequence that is at least 5%, such as at least 10%, at least 20% or more than 20% of the initial rate (measured in pmol / l / min) determined using the methods provided in Examples 91 to 95 of WO 01 / 23613 (hereby incorporated by reference) of an oligonucleotide having the same base sequence as the modified antisense oligonucleotide being tested but containing only DNA monomers having phosphorothioate bonds between all monomers in the antisense oligonucleotide. For use in determining RNase H activity, recombinant RNase H1 from Lubio Science GmbH, Lucerne, Switzerland is available.

[0211] DNA antisense oligonucleotides are known to efficiently recruit RNase H, as are gapmer antisense oligonucleotides, which comprise a region of DNA nucleosides (typically at least 5 or 6 consecutive DNA nucleosides) flanked 5' and 3' by regions comprising 2' sugar-modified nucleosides (typically high affinity 2' sugar-modified nucleosides such as 2-O-MOE and / or LNA).

[0212] Nuclease-mediated degradation

[0213] In some embodiments, antisense oligonucleotides can function via nuclease-mediated degradation of a target nucleic acid, wherein the antisense oligonucleotides of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases) such as RNase H. Examples of antisense oligonucleotide designs that function via a nuclease-mediated mechanism are antisense oligonucleotides that typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one or both sides by affinity-enhancing nucleosides, such as spacers, headmers, and tailmers.

[0214] Complementarity

[0215] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U).

[0216] It will be understood that oligonucleotides may contain nucleosides with modified nucleobases, for example 5-methylcytosine is often used in place of cytosine, and thus the term complementarity encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research Vol. 45, p. 2055, and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 371.4.1).

[0217] As used herein, the term "complementarity percentage" refers to the ratio of nucleotides complementary to a reference sequence (such as a target sequence or sequence motif) in a continuous nucleotide sequence in a nucleic acid molecule (such as an antisense oligonucleotide) (expressed as a percentage), and the nucleic acid molecule spans a continuous nucleotide sequence. Therefore, by counting the number of aligned nucleobases complementary (forming Watson Crick base pairs) between the two sequences (when the antisense oligonucleotide sequences of 5'-3' and 3'-5' of the target sequence are aligned), dividing it by the total number of nucleotides in the antisense oligonucleotide, and then multiplying it by 100, the percentage of complementarity is calculated. In such comparisons, the nucleobase / nucleotide that is not aligned (forming base pairs) is called a mismatch. Insertions and deletions are not allowed in the calculation of the % complementarity of continuous nucleotide sequences. It should be understood that when determining complementarity, as long as the functional ability of the nucleobase forming Watson Crick base pairing is retained, the chemical modification of the nucleobase is not considered (for example, when calculating the complementarity percentage, 5'-methylcytosine is considered to be the same as cytosine).

[0218] In the present invention, the term "complementary" requires that the contiguous nucleotide sequence is at least about 75% complementary to the human ELK1-CFP pre-mRNA transcript, or at least about 80% complementary, or at least about 85% complementary, or at least about 90% complementary, or at least about 95% complementary. In some embodiments, the contiguous nucleotide sequence may be at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to the human ELK1-CFP pre-mRNA transcript.

[0219] In other words, in some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide according to the present invention may include one, two, three, four, five or more mismatches, wherein a mismatch is a nucleotide within the contiguous nucleotide sequence that does not base pair with its target.

[0220] The term "fully complementary" refers to 100% complementarity.

[0221] In some embodiments, the contiguous nucleotide sequence is completely complementary to a human ELK1-CFP pre-mRNA transcript. In some embodiments, the human ELK1-CFP pre-mRNA transcript may have a sequence of SEQ ID NO 1 or a fragment thereof.

[0222] It is understood that the target ELK1-CFP pre-mRNA transcript nucleic acid may be an allelic variant of SEQ ID NO 1, such as an allelic variant comprising one or more polymorphisms in the human ELK1-CFP pre-mRNA transcript nucleic acid sequence.

[0223] Identity

[0224] As used herein, the term "identity" refers to the proportion (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (eg, an antisense oligonucleotide) that are identical to a reference sequence (eg, a sequence motif) across the contiguous nucleotide sequence.

[0225] Therefore, by counting the number of aligned nucleobases that are identical (matched) in the two sequences (in the continuous nucleotide sequence of the compound of the present invention and in the reference sequence), dividing the number by the total number of nucleotides of the antisense oligonucleotide and multiplying by 100, the identity percentage is calculated. Therefore, the percentage of identity = (number of matches x 100) / length of the alignment region (e.g., continuous nucleotide sequence). Insertions and deletions are not allowed in the calculation of the percentage of identity of continuous nucleotide sequences. It should be understood that when determining identity, as long as the functional ability of the nucleobases forming Watson Crick base pairing is retained, chemical modifications of the nucleobases are not considered (e.g., when calculating the percentage of identity, 5-methylcytosine is considered to be the same as cytosine).

[0226] Thus, it will be appreciated that a relationship exists between identity and complementarity such that a contiguous sequence of nucleotides within an antisense oligonucleotide of the invention that is complementary to a target sequence also shares a certain percentage of identity with the complementary sequence.

[0227] Hybridization

[0228] As used herein, the term "hybridization" (hybridising / hybridises) should be understood as the formation of hydrogen bonds between base pairs on opposite strands of two nucleic acid chains (e.g., antisense oligonucleotides and target nucleic acids) to form a duplex. The binding affinity between the two nucleic acid chains is the strength of the hybridization. It is usually described by the melting temperature (Tm), which is defined as the temperature at which half of the antisense oligonucleotides form a duplex with the target nucleic acid. Under physiological conditions, Tm is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13: 515–537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG°=-RTln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between the antisense oligonucleotide and the target nucleic acid reflects a strong hybridization between the antisense oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in which the aqueous concentration is 1 M, the pH is 7, and the temperature is 37°C. The hybridization of the antisense oligonucleotide to the target nucleic acid is a spontaneous reaction, and the ΔG° of a spontaneous reaction is less than zero. ΔG° can be measured experimentally, for example, by utilizing an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment can be used for ΔG° measurement. ΔG° can also be estimated numerically by using the nearest neighbor model as described by Santa Lucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465, using as appropriate the derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 11211-11216 and McTigue et al., 2004, Biochemistry 43: 5388-5405.

[0229] In some embodiments, antisense oligonucleotides of the invention hybridize to target nucleic acids with estimated ΔG° values ​​of less than -10 kcal for antisense oligonucleotides of 10 to 30 nucleotides in length.

[0230] In some embodiments, the degree or intensity of the hybridization is measured by standard state Gibbs free energy ΔG °. The antisense oligonucleotides of the present invention can be hybridized with target nucleic acid with a ΔG ° valuation lower than -10kcal range, such as lower than -15kcal, such as lower than -20kcal and such as lower than -25kcal. In certain embodiments, the antisense oligonucleotides of the present invention and the target nucleic acid subsequence of SEQ ID NO: 1 are hybridized with a ΔG ° lower than -10kcal, such as between -10kcal to -60kcal, such as between -12kcal to -40kcal, such as between -15kcal to -30kcal or between -16kcal to -27kcal, such as between -18kcal to -25kcal.

[0231] In some embodiments, the degree or intensity of the hybridization is measured by standard state Gibbs free energy ΔG °. The antisense oligonucleotides of the present invention can be hybridized with target nucleic acid with a ΔG ° valuation lower than -10kcal range, such as lower than -15kcal, such as lower than -20kcal and such as lower than -25kcal. In certain embodiments, the antisense oligonucleotides of the present invention and the target nucleic acid subsequence of SEQ ID NO: 1 are hybridized with a ΔG ° lower than -10kcal, such as between -10kcal to -60kcal, such as between -12kcal to -40kcal, such as between -15kcal to -30kcal or between -16kcal to -27kcal, such as between -18kcal to -25kcal.

[0232] Delivery of antisense oligonucleotides

[0233] The present invention provides an antisense oligonucleotide according to the present invention, wherein the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

[0234] This may be to deliver the antisense oligonucleotides of the invention to target cells and / or to improve the pharmacokinetics of the antisense oligonucleotides of the invention.

[0235] Examples of lipid-based delivery vehicles include oil-in-water emulsions, micelles, liposomes, and lipid nanoparticles.

[0236] Salt

[0237] The term "salt" as used herein conforms to its commonly known meaning, ie, an ionic assembly of an anion and a cation.

[0238] The present invention provides a pharmaceutically acceptable salt of an antisense oligonucleotide according to the invention or a conjugate according to the invention.

[0239] The present invention provides an antisense oligonucleotide according to the present invention, wherein the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt. In some embodiments, the pharmaceutically acceptable salt may be a sodium salt or a potassium salt.

[0240] The present invention provides a pharmaceutically acceptable sodium salt of the antisense oligonucleotide according to the present invention.

[0241] The present invention provides a pharmaceutically acceptable potassium salt of the antisense oligonucleotide according to the present invention.

[0242] Pharmaceutical composition

[0243] In a further aspect, the present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0244] The present invention provides a pharmaceutical composition according to the present invention, wherein the pharmaceutical composition comprises the antisense oligonucleotide of the present invention and an aqueous diluent or solvent.

[0245] The present invention provides a solution of the antisense oligonucleotide of the present invention, such as a phosphate buffered saline solution. Suitably, the solution of the present invention, such as a phosphate buffered saline solution, is a sterile solution.

[0246] WO 2007 / 031091 (incorporated herein by reference) provides suitable and preferred examples of pharmaceutical diluents, carriers and adjuvants. Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, prodrug formulations are also provided in WO2007 / 031091.

[0247] The oligonucleotides of the present invention can be mixed with pharmaceutically active or inert substances to prepare pharmaceutical compositions or formulations. The composition and formulation of the pharmaceutical composition depends on many criteria, including but not limited to the route of administration, the extent of the disease or the dosage of administration.

[0248] In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention is a prodrug. In particular, for antisense oligonucleotide conjugates, once the prodrug is delivered to the site of action, such as a target cell, the conjugate portion of the antisense oligonucleotide is cleaved off.

[0249] Target cells

[0250] As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.

[0251] application

[0252] The antisense oligonucleotides of the present invention can be used, for example, as therapeutic and preventive agents and research reagents.

[0253] Research Reagents

[0254] The antisense oligonucleotides of the present invention can be used as research reagents. In research, such antisense oligonucleotides can be used to specifically reduce the level of ELK1-CFP pre-mRNA transcripts in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or assessing its availability as a target for therapeutic intervention.

[0255] Methods for modulating the levels of ELK1-CFP pre-mRNA transcripts

[0256] The present invention provides a method for reducing, downregulating or eliminating ELK1-CFP pre-mRNA transcripts in cells, such as cells that are transcribing ELK1-CFP pre-mRNA transcripts or cells that are TDP-43 deficient or TDP-43 depleted, the method comprising exposing an effective amount of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention to the cells.

[0257] In some embodiments, the method is an in vitro method.

[0258] In some embodiments, the method is an in vivo method.

[0259] In some embodiments, the cell is a human cell or a mammalian cell.

[0260] In some embodiments, the cell is part of or derived from a subject suffering from or susceptible to a disease associated with increased levels of ELK1-CFP pre-mRNA transcripts. Such diseases include, but are not limited to, amyotrophic lateral sclerosis (ALS).

[0261] treat

[0262] As used herein, the term 'treatment' refers to the treatment of an existing condition (eg, a disease or disorder referred to herein) or the prevention (ie, prevention) of a disease. It will therefore be appreciated that in some embodiments, the treatment referred to herein may be prophylactic.

[0263] The present invention provides a method for treating or preventing a disease, which comprises administering a therapeutically or preventively effective amount of the antisense oligonucleotide or pharmaceutical composition of the present invention to a subject suffering from or susceptible to the disease.

[0264] The present invention provides a method for treating or preventing a disease associated with an increased level of ELK1-CFP pre-mRNA transcript, the method comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention to a subject suffering from or susceptible to a disease associated with an increased level of ELK1-CFP pre-mRNA transcript.

[0265] In some embodiments, the disease may be a disease associated with decreased levels of TDP-43.

[0266] In one embodiment, the disease is amyotrophic lateral sclerosis (ALS).

[0267] In some embodiments, the subject is an animal, preferably a mammal such as a mouse, rat, hamster, or monkey, or preferably a human.

[0268] The present invention provides an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention, which is used as a medicine.

[0269] In the present invention, the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention is usually administered in an effective amount.

[0270] The present invention provides an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention, which is used for preparing a drug.

[0271] The invention provides an antisense oligonucleotide according to the invention or a pharmaceutical composition according to the invention for use in therapy.

[0272] The method of the present invention is preferably used to treat or prevent a disease caused by abnormal levels of ELK1-CFP pre-mRNA transcripts. The disease may be caused in particular by increased levels of ELK1-CFP pre-mRNA transcripts.

[0273] In some embodiments, the disease may be a disease associated with decreased levels of TDP-43.

[0274] The present invention further relates to the use of an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention as defined herein for the preparation of a medicament for treating abnormal levels of ELK1-CFP pre-mRNA transcripts, in particular high levels of ELK1-CFP pre-mRNA transcripts.

[0275] The present invention provides use of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention for preparing a medicament for treating or preventing amyotrophic lateral sclerosis (ALS).

[0276] Application

[0277] The antisense oligonucleotides or pharmaceutical compositions of the invention can be administered topically (such as to the skin, by inhalation, to the eye or to the ear) or enterally (such as orally or through the gastrointestinal tract) or parenterally (such as intravenously, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly or intrathecally).

[0278] In a preferred embodiment, the antisense oligonucleotide or pharmaceutical composition of the present invention is administered by a parenteral route, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, for example, intracerebral or intraventricular administration. In one embodiment, the antisense oligonucleotide is administered intracerebrally or intraventricularly. In another embodiment, the antisense oligonucleotide of the present invention is administered intrathecally.

[0279] Combination therapy

[0280] In some embodiments, the antisense oligonucleotides or pharmaceutical compositions of the invention are used in combination therapy with another therapeutic agent.

[0281] Manufacturing method

[0282] In a further aspect, the invention provides a method for making the antisense oligonucleotide of the present invention, the method comprising reacting nucleotide units and thereby forming covalently linked continuous nucleotide units contained in the antisense oligonucleotide. Preferably, the method uses phosphoramidite WO 2017 / 081223PCT / EP2016 / 077383 chemistry (see, e.g., Caruthers et al., 1987, Methods in Enzymology Vol. 154, pp. 287 to 313), which is incorporated by reference in its entirety.

[0283] In a further embodiment, the method further comprises reacting the contiguous nucleotide sequence with a conjugate moiety (ligand). In a further aspect, a method for making a composition of the invention is provided, the method comprising mixing the antisense oligonucleotide of the invention or the conjugated antisense oligonucleotide with a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0284] Examples

[0285] Example 1

[0286] TDP-43 has been shown to affect mRNA splicing. To identify new genes whose mRNA is regulated by the presence of TDP-43, TDP-43 knockdown was performed in a neuronal cell model. The cells were RNA sequenced and de novo transcript analysis was performed to identify affected genes with new splicing patterns.

[0287] Human glutamatergic neurons (Fujifilms) were plated at 60,000 live cells together with 10,000 live astrocytes (Fujifilms) in 96-well plates coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium (day -1).

[0288] In order to knock down TDP-43, 5 μM of compound A (SEQ ID 2) was added to the culture medium at day 0, and PBS was added as a control in other wells. During the entire experiment (days 2, 5, 7, 10, 12, 14 and 17), half of the cell culture medium (100 μl) was changed three times a week. Cells were harvested using Magnapure lysis buffer (Roche) at day 20, and RNA was isolated using MagNA pure 96 system (Roche) according to the manufacturer's instructions (including DNA enzyme treatment steps). NGS libraries were prepared from 100 ng of total RNA using KAPA mRNA HyperPrep kit Illumina platform (Roche). The library was subjected to paired end sequencing with 150-bp read length on NovaSeq6000 sequencer (Illumina). Data analysis was performed using CLC Genomics Workbench 21. Data were first analyzed by running large gap mapping analysis using hg38 genome assembly, and transcript discovery was then performed. Predicted novel transcript changes were checked by visual inspection to identify true changes.

[0289] In the analysis, one of the predicted novel transcript changes due to TDP-43 depletion was a novel transcript just downstream of the ELK1 gene on chromosome X ( Figure 1 , grey arrows). However, closer manual inspection revealed that the increased expression of RNA from this region of the chromosome was due to a lack of proper polyadenylation of the ELK1 mRNA transcript, allowing RNA polymerase to continue DNA transcription. It is interesting to note that a lack of proper polyadenylation of ELK1 due to TDP-43 depletion has been previously described in a conditional mouse TARDBP knockout model (Wu et al. 2019). The conservation of this cross-species mechanism is noteworthy, as it is generally believed that the mRNA targets of TDP-43 are not highly conserved between species.

[0290] In addition, a significant 10-fold upregulation of the CFP gene was observed in response to TDP-43 depletion in neuronal cells. The CFP gene is located downstream of ELK1 in the same direction ( Figure 1). It is speculated that the increase in CFP mRNA expression may be caused by the read-through of RNA polymerase II starting from the ELK1 promoter, thereby generating a long fusion transcript with two open reading frames. Generally, due to the presence of exon-exon splicing junctions more than 50 bases downstream of the stop codon, such mRNAs are expected to undergo nonsense-mediated (NMD) decay. However, since the expression of spliced ​​CFP mRNA was observed to increase, and even ELK1 mRNA was upregulated by 2 times, it is speculated that the long fusion transcript is translated in both open reading frames, so that the expression of CFP in neurons lacking TDP-43 expression in their nuclei may increase.

[0291] Example 2

[0292] To demonstrate that a single mRNA containing both the ELK1 and CFP reading frames is the result of TDP43 depletion in neuronal cells, we designed a library of imbricate spacer ASOs (antisense oligonucleotides) complementary to a region containing the ELK1 gene through the intergenic region and into the first exon of CFP. If this region is expressed as a single mRNA, any functional ASO in this region will result in downregulation of both the genes ELK1 and CFP.

[0293] Here, we demonstrate that ASOs are able to downregulate the combined pre-mRNA ELK1-CFP transcript, which is suggested to be a consequence of loss of ELK1 polyadenylation in TDP-43-depleted cells.

[0294] Human glutamatergic neurons (Fujifilms) were plated at 60,000 live cells together with 10,000 live astrocytes (Fujifilms) in 96-well plates coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium (day -1).

[0295] To knock down TDP-43, 5 μM of compound A (SEQ ID NO 2) was added to the culture medium on day 0 (except for four PBS-containing control wells per plate). Half of the cell culture medium (100 μl) was replaced three times a week throughout the experiment (days 2, 5, 7, 9, 12, 14, 16, and 19). On day 5, 1 μM of each ASO targeting the ELK1-CFP fusion transcript was added to the culture medium.

[0296] In total, 92 different ASOs were added (SEQ ID NO 3-94). 88 wells received only compound A (SEQ ID NO 2) to serve as a baseline reference. The compound table provides the ASOs used, their HELM sequences and natural analog sequences, and their target sequences.

[0297] Cells were harvested on day 20 using Magnapure lysis buffer (Roche), and RNA was isolated using the MagNA pure 96 system (Roche) according to the manufacturer's instructions (including the DNase treatment step). Purified RNA was denatured at 90°C for 30 seconds prior to cDNA synthesis. cDNA was generated using the iScript Advanced cDNA Synthesis Kit for RT-qPCR (Biorad) according to the manufacturer's instructions.

[0298] The expression level of the target gene was measured by droplet digital PCR using the QX1 system (Bio-Rad) and QX1 software standard version. PCR probe assay was used to measure the expression of two genes, ELK1 and CFP. It was normalized to the expression of HPRT1 mRNA, and finally the expression of TSRBP was measured to verify the effect of knockdown.

[0299] The following PCR probes were used for the assay (obtained from Integrated DNA technologies): TARDBP:

[0300] Primer 1: CAGCTCATCCTCAGTCATGTC (SEQ ID NO. 188), Primer 2: GATGGTGTGACTGCAAACTTC (SEQ ID NO. 189), Probe: / 5Cy5 / CAGCGCCCCACAAACACTTTTCT / 3IAbRQSp / (SEQ ID NO. 190)

[0301] ELK1 (exons 3-4):

[0302] Primer 1: TCAGGGTAGGACACAAACTTG (SEQ ID NO. 191),

[0303] Primer 2: GACCAACATGAATTACGACAAGC (SEQ ID NO. 192),

[0304] Probe: / 5HEX / CAAGAACAT / ZEN / CATCCGCAAGGTGAGC / 3IABkFQ / (SEQ ID NO.193)

[0305] CFP (exons 9-10):

[0306] Primer 1: CCTTGTAGCTCCTCACACC (SEQ ID NO. 194),

[0307] Primer 2: GCCTCTGCACACCCTTG (SEQ ID NO. 195),

[0308] Probe: / 56-FAM / CTTCTCGCC / ZEN / CTGACCTTCGACC / 3IABkFQ / (SEQ ID NO.196)

[0309] The following CY5.5-labeled HPRT1 probe (obtained from BioRad) was used: dHsaCPE13136107

[0310] The data shown in Table 1 were normalized to the expression of the housekeeping gene HPRT1 and finally to the average expression value of four control (PBS) wells per plate that did not receive any TDP-43 knockdown or CA repeat ASOs.

[0311] Table 1 - ASO-induced reduction of CFP and ELK1 expression.

[0312]

[0313]

[0314]

[0315]

[0316]

[0317] The data confirmed the observations described in Example 1, as a 13-fold increase in CFP expression and a 3-fold increase in ELK1 expression were measured in wells with only TDP-43 knockdown.

[0318] All tested gapmer ASOs were able to downregulate both ELK1 and CFP transcripts from an average starting point of 305% for ELK1 and 1332% for CFP observed in TDP-43 depleted cells. Of the 88 tested ASOs, 72 were able to reduce CFP expression to at least the level of untreated cells (100%), and 21 ASOs were able to reduce CFP expression to less than 10% of the level observed in untreated cells.

[0319] The data confirm that the increase in CFP mRNA expression is caused by transcription from the ELK1 promoter, as even an ASO spacer targeting ELK1 intron 1 was able to significantly reduce CFP expression ( Figure 2 Similarly, ASOs targeting a region within the CFP mRNA were able to reduce ELK1 mRNA expression by 305% from that observed in TDP-43-depleted cells ( Figure 3 ).

[0320] Taken together these data suggest that ASOs targeting the intergenic gap between ELK1 and CFP may enable selective knockdown of CFP and ELK1 only in diseased cells (where TDP-43 is depleted due to protein aggregation) but not in the remaining 'healthy' cells of the body (where ELK1 and CFP are required for normal expression).

[0321] References

[0322] Wu et al (2019) Transcriptomopathies of pre- and postsymptomaticfrontotemporal dementia-like mice with TDP-43depletion in forebrain neurons, Acta Neuropathologica Communications 7(50) https: / / doi.org / 10.1186 / s40478-019-0674-x

[0323] SEQ ID NO 1 is the sequence of the ELK1->CFP fusion transcript. The sequence is shown below and is based on the Ensamble Havana v 17 gene annotation:

[0324] HG 38Chr X: 47.650.604->47.623.172, minus strand direction.

[0325] CTCGGGCCCACGTGAGCTGTAGGGAAACGCAGGGGCGGCTTCTAGGT

[0326] GCTGCCGCCGCCACCGCCACCACCACCTCCACCGCCGCCTCGGAACCC

[0327] AGGCCTGGGGGGCGGTGGGGCCGCGTATGGAGCCCCCGCCCCCCGGA

[0328] GCTGCCAACATTGCCAACGCCACCGCCACGCTACACACAGGTGAGCT

[0329] CTGGGCCTGGAGGGTGGAGGGCCCAGTCCGTGACCCCACGTATCCTTC

[0330] CCGCCCCCGCGCAGAGGATGTGGCTTGGCCGGTGGCCTGCTGGTGTTC

[0331] GACTCCCCGCCGCCACCACCACGGCTGGTGGACCTGCGTGTGGCATTG

[0332] CTCAAGCCCTTCGTCCCTTATAGTGGATCTGACCGTGGCCTAACCTCC

[0333] CCCTCCCGTTGTATAATGGATCGGTCTGCGTGCTTATGTTTTTCCCCAC

[0334] GCCAACTTAGGGTGGACTCGTCCATAGGCTTTCCCCCTACCCCTACCC

[0335] CCACCCGCCCCCCACCCACCCCCACTTATAGGGAGCTAGCCTGTGACA

[0336] GTGTTCAGCCCCCTTAATAGTAGGTGTATCTGAGTGTTTGGATTTCTCC

[0337] TAGCCTCAACTTTCAGGAGACCCGTCCGTGGCCTTATTTATTCCACCCT

[0338] TCCTGTACATCGTAGCGAATCAATCCGTGGCGCCGCACTCCTCCGCAT

[0339] CCCTCTTTAACAGTGAGTCTACCTGAGTTTGTATTCCTGCCTCCTCCAG

[0340] TCCCCCAATGCATCAGTCCATGGCTTTTTTCAAAACCACCCCCCCCCC

[0341] CCACCACCACCACCACCATTTTATAGTGGATCAGTCTTCATGTTTGGA

[0342] TTCACGTCCCTTTAGCTATCAGTCCATTGCCCTGTCTCCTCTTTTTCGTA

[0343] GACTGTCGCTCTAGCGCTTGGGGTTCTCTCCTTTTTAATAGTGGGTTAG

[0344] TTTAGTGCTTTACATCTCCCTATTTTCAGTAGCTCAGTCCATAGCCTTT

[0345] TCCCTCTCTGCTTTGAATCAGTCTGTGTGATGGCTTTTCTCTCCTCTCA

[0346] CTGTGGTGCAGGAGTCTGTAAGGTTTTCTGCTCCCCTTCCCCTCAGAC

[0347] GATGAGCCTCATCACCCCTCCCTTTGCAGTGGATCTGTTCATTGGCCTT

[0348] CCTCCCCCACACCCCTGTATGCTTGCACAGTCCCCCGCATACCCTCCC

[0349] GTGAGTCCAGTGCTTTGTAATTGGGGGAAGATCGGCCGTGTACTTTCA

[0350] ATTTCCTTCTCTTTTTTTTTCCCTTCCCAGAAGAGAACGTGCTGATCCT

[0351] CTTTTCCTTGTGATGGAGCACTGTACGGCCTTCCCTGTCCTCCACCTCT

[0352] TAATAGTGGGTCAGCCTGGTCACACTCGTAACCACAAAGACGTTCTGC

[0353] CTCACTACAATAAGTGAATACATTAGCGCCAGTGATGATAGTAATGCC

[0354] AATAGGAGCTAGCGTTTATTGAGCACCTGCCGTATATCAGGCAGAGTG

[0355] TTTCATATGAATGAGTTCCTTTAATCCTCACCACAACCCCATGAGATA

[0356] GGTAGTGAGGGAATTGGGCCATAGGGAGGTTAAATTCCTTACTCAAA

[0357] GGTGGCCCAGGAAGTACTCAGGACACAGGATAATTTTTGAGGCTCCC

[0358] CTCTTAGATCTCATCCCACCCCACGTGAGGCCTCAGTCCTTAAAAACC

[0359] AAATTAGTTCTCACCTCCAAGCTTTTGTTCTTGCTGTTCCCTCTGCCTG

[0360] CAGAGCAGTCTTCATTCCTCACCTTCTCTCAGCACCCACCCACCCCCC

[0361] AATCCCAGCAGCTGTGTGACCTTAGATGAGTGATTTAACCACTTCCTC

[0362] TCTGTGCCTTTTTCTTCATTTGTGAAATGGGGGATCAGAACTAGAATCC

[0363] CTTCCAGTGTAAATAAATATTAACTGTGAATTAATGGTAAAACAAGTA

[0364] ACCTTTCTAGCATTACCGCCTATACCTTCCCACCCCCTTACTGTGCTCC

[0365] AACCACACTGGTTCCACCACACAGCTCCTCAAACATAGCAGGCATGG

[0366] GCCAGCCTCAGGGCCTTTGCATTGGCTGTTCTTTGTGCCTTGAACACC

[0367] ACCCCCAGATCTCTGCATGGTTCCTTTCAGCACTCTGTTCAAATACCA

[0368] ACCCCCAAAGGATGTTTACCACACTGTGGTGTGTGGAATGCAGTATAA

[0369] AAAGATACATGTATGAAAGATGTTTCTAAGAATGCCAGTTTATATATG

[0370] AGTAAGGGTTTTCCTCCTTTTTCAAAAGGATGTGTTCACAAGACTGAGG

[0371] TACGTAATATGCTCTGTAAAGGCATAGGTATAAAAGCTGTTTCTAAGA

[0372] GTGCTAGTTGTATATGTGAATAGGACTGTGTTGTTGCATTGAAAGAA

[0373] TGTGTTCACAAAACTGTGGTGTGTAGCTGGGCACAGGGGTGTGCACTT

[0374] ATAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGGATAGCTTGAGCC

[0375] CAGGAGTTCCAGGCCAGCCTGGGCAATATAGCGAGATCCCTTTTTCTG

[0376] AAAAAAAAAACCCAAAAACAACCACTGTGGTGTGTGTAATACACT

[0377] CTCTTAAAGGCACAGGCGTAAAAGATGTTTCTAAGAGTGATTTGATTT

[0378] TGTTGTACCTGGGTAGTGTTATTTCATTAAAGGTTGATTGTCACACCAT

[0379] GGTACTTAGATATACTATACAAAGGCACATGTATAAAAAAAGAAGTT

[0380] CCTAACAATGCTACTTGTAAAAACAAAAAAAGTCAACCCCTCCCTGAC

[0381] CATCTGAAGCTGCACACCCAGCAGGGCTCAAGCCAGGTCCCTGATTTG

[0382] TCCCGTTGCCCTTTATCACTGTCTGACACACTGTGTGGGTTACTTGTTT

[0383] GTTGTCTGTCTCTCCTCATTAGAATGTGAGTCCCATGAGGACTCAGTTT

[0384] TTGTCTGCTCATTCACCGCTATGTCTCCAGCAACTGAAAATGTACCAG

[0385] GTAAACAGCAGATGCTCAATAAGAATTTATCCCATGAATAAATGGGA

[0386] AAAAGATAATTTGAGACACCAGTGTAGGGGTCACATGAGGAAGAAGA

[0387] AGGGATATGAGAGCTAATTAGTTGGGACTGTTCCTGCAACCAACCTTT

[0388] ACTGAGCCCCTTGTGAGTACCAGGCACTCTTCTAGGTGCTGGAATATG

[0389] GCAAGGAACGAAACAGGGCGAAATATTTGTGCTTGTGGAGCTGACAT

[0390] TTATTAAAAGTTGGGGAGGCTGGGCACGGTGGCTAACACCAGTAATC

[0391] CTAGCACTTTGGGAGGCTGAGGTGGGTGGATTGCCTGAGCTCAGGAGT

[0392] TCAAGACCAGCCTGGGCATCACGGTGAAACCCCATCTCTACTAAAATA

[0393] CAAAAAAATTAGCTGGGTGTGGCGGCGTGCGCCTGTAATCCCAGTTAC

[0394] TTGGGAGGCTGAGGCAGGAGAATTGCTTGAACCCAGGAGGCGGAGGT

[0395] TGCAGTGAGCCAAGATTGCACCATGCACTCCAGCATGGGTGACAGAG

[0396] CGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAACCCAAGCTGGGGA

[0397] GACAGACTATGTGAACAAAATAAATAAGTAAAATTAGCATAATAGAC

[0398] AAATGCTGAGAAGAAATAATGAAATAGGGCAGGTAGGAATCGAGTAT

[0399] TGGGGGTGGTTGAAATCTTAGGCATAGGGAAGGTGACTCTTGAATTAG

[0400] GGCCTCACGGTAGAGACGGAGAGAGCCTTAATGTCTACGGGAAGAGC

[0401] ATACCAGGCAGAAGGAAGTGCCAGTTCAGAGGCCCTGAGGTGGGATG

[0402] GTGCCTGCCATGTTCAAGGAACATCAAGGCGGCCAGTGTGGCTGGAG

[0403] CAGAGTGCGGGGAAGGGTAGAAGGTGAGGTCACACAGGTGATGGGA

[0404] GCCAGATAGTGCAGGTGATACATAGGATAGGATTGCAGGGGCAGGGG

[0405] GAGAAGGATGACACACTAGCTAATAGCTAATATCTGTGGAGTATCTGC

[0406] CACACATCAGAGGCACTTTTCTGTTCAAATACCAACCCCCAAAGGATG

[0407] TTTACCACACGGTGGTGCCTGGAATGCACTACAAAAAGATACATGTGT

[0408] CAAAGATATTTCTAAGAATGCCAGTTTATATATGAATAAGGATTTTCC

[0409] TCCTTTTCAAAAGGATATGTTCACAAAACTGAGGTATGTAATATGCTC

[0410] TATGGAGGCACAGGTATAAGCTGTTTCTAAGAGTGCTAGTTGTATA

[0411] TGTGAATAAGGACTGTGTTGTTGCATTGAAAGAATGTGTTCACAAAAC

[0412] TGTGGTGTATAGCTGGGCACAGAGGCTGAGGTGGGAGGATCACTTGA

[0413] GCCCAGGAGTTCCAGGCCAGCCTGTGCAACATAGTGAGATCCCCGTCT

[0414] CCGAAAAAAAACCCAAAATATAACCACTGTGGTGTGCATAATACACT

[0415] CTCCTAAAGGCACAGGCATAAGATTGTTTCTAAGAGTGATTTGATTT

[0416] TCTGGCACCTGGGTAGTGTTATTTCAGTAAATATTCATTGTTAAACACT

[0417] ATGGTGCTTGGAATATACTATACAAAGGCACATGTATAAAAAAGAAG

[0418] TTCCTAACAATGCTACTTGTAAAACAAAAAAGTCAACCCCTC

[0419] AAGTCTTTTACAGAAGTATTTTACAGAATTGACACAGTTAATCCTCAC

[0420] AGAAGCCTTGGAGGGTAGGTGTACTTTTGAGAATATTTGACTTTGAGA

[0421] GTAAAATATCCCCATTTTACAGATGAGGAAACAAGCAAAGAGAGGCT

[0422] GAGTAACTTGCTCAGGGTAACCTTGAGCCAGAATAGCCAGAACAGGG

[0423] GCAGAGGAACATAAGGCTGAAGACTCAGAAAGAAGAACAGATTTGCA

[0424] AGGGCAGGCAGGTTATTTGGCACCTTTGATCACGCAGAGGAAGAATG

[0425] AATTCTTCCTGGAATGCGATGATTGTGTAATTGAGTCCATGAAGTGAG

[0426] GGAAGAGCTCTCCCTGCGGGGAGAGCAGCCCGTGCTTACCCTCAGAG

[0427] GTTGGAACTGTCTCGGGAACGGTAGATAGTTCAGGGTGGCTGCCTCAG

[0428] AGCCTTTGTACACGCCGTTCGCTCCGCCTGAAGGCCCTCCCCCACAGA

[0429] GGGCAGCCTGGCTTGCTACCTCCCCTCCTTCAGGCCAGGTGTCACTTC

[0430] CTTGGGGAAGAACTCCTTGTACACCCTGTGTAAAAACAGCATTCCTGT

[0431] CACTCTCTAGGATCTTACCCTTCTCTGTTTCTCTTCATGGAGAACTGGT

[0432] GGTGTAAGGCGATTGCTCACTAGAGCCAAACCACTTAGGTTTTGAATT

[0433] CCGGCTCTGCCAACTTCCAGCTGTGTGACTTGGGGCAGGTTACTTCTC

[0434] TGTACCTCCATTGCCTCATGTGGAAAATGGGGGAAATGATAATCCCCA

[0435] CCCTTTAACGGTGGTTTGAGGATTCAATGAGTTAAATGATTCAAAGAG

[0436] TGTGCAGCCCACGGTAAGGATCGTATGCCTGGCTTGCATTTTTAAATT

[0437] ATTAAAATGTATTCATAGCATACCCGTAGATGTCTGACAGGCCTCTGA

[0438] AACTGACCATCTCCAAAACTGGTGTGACCCCCCTCAAAACTTACTCTC

[0439] CTGCAAGGCTCCCACCTCAGCTGACCACAATGCTGTCTTTGTGGGTGA

[0440] TTAGGCCACAAACCTAGACTCACCCTGGACCCTTCTCTCACCTCCCCC

[0441] GGGCATGCTATCTGTCAGCAAGTCCTATTCTGTGTTCAGGCTTTCTCCA

[0442] GACCCCAGCTACTTCTCGCCAGCCCCACTGCTACCACCATCATCTACC

[0443] GCAGTGGCTTCTTCAGCCCCAACAGTCTGTTCTTCTCACAACCGCCAG

[0444] GGGGATCCTGTTGAAATCTCAGTCACAGCCTGTCATCCCTCTGTTCAC

[0445] AACCCTCTTGTGGCTCCTGTCTCACTCAACATCCTGACAGCACCCGAA

[0446] AAAGCCTGGCTCAGTCTGGCCCCCGTCACTCTGTTCTCCTCTCCCGCTG

[0447] CCTCCCTCCTCTCCCCCGAACCCATGTCAGCCTCCTCTCCCCATGTCAC

[0448] CTGCCAGGCACTCTCCAGCCTTGGGCCCTTCACACCGGCTGCCGCTTC

[0449] CACCTGGCTTGCTGCTCTCAGATACTCACGAGCTCAGTTCCTTCACCTC

[0450] CTTTTGGTCTCTGCCCAGTTGTCCCCTCCTTGGCGACTACTCTCCCCTG

[0451] ACTCTCCATGTAAAAGTAACAGCTCTCCCCTGCTTGATTTTTTTCCCAT

[0452] AACCCTTACCACCATCTGACGCACTCTTGTACATGTTTGCCTTTTTTCT

[0453] CATCTGCCTTTCCTGCTAAGATGTGAGCTCCTCTGGAGCAGGGATTGT

[0454] TGTCTGTTGCGTTCTCGACTGTATCCGCAGCACCTGGCCCACAGTATG

[0455] CACTCACCAAATGCTTGCTAAGTGAAGGAGATGGAAAGAAGTAAACA

[0456] TATCTAAGCAAGGCAGATTACTAGAACTCTTATGAGGGGTCAAGTGG

[0457] GAGAAATAACAAAATACAAAGCCCTGTGTGCTGTTGAAGCTGGAAGC

[0458] CCACCGTCACCTTTCACTCAGCTGATAGGTTCTGTTGCAGCTGAAAGA

[0459] AGAACTGGTAAAATTGCCTGTCTTTGCCACCAGGAGTCACTCTGAACT

[0460] CTTTGGACTTCTGAAACAAGCCTGCCTGCAAAACAAATTCAGTGAGGT

[0461] CTCTGGTGACAGGACTCTCTAATCGGACACTTCATGGCTTTGTGACTT

[0462] GTATAATTGAACAGGAAGCTCATGTTTATTTCCAGTTTGCTCTCAGGA

[0463] AAGAAAGCAGTAATGGGGTGACAGGGAGGATCCTGTTCTTGAAGGA

[0464] CATGCTGAGAGGGAATAGTCGGTGTGAGGGGCCGTTTAGCCTAATGG

[0465] TGAAATGCTTAGTCAACTGGAACCTGACTGCCTGGCTCCAAATGCTGG

[0466] CTTTGCCACATGTGGCCTGTGGAAGGTACGTAGACATTTGTGCCTCCG

[0467] CTGCCTCATTTATAAGTTAATGACAGGAAGACTACCTACTTCTCAGAG

[0468] GCATGATCAGGGATAAATAAGTCAATGCCCATTAAAAAAAAATAA

[0469] CAGTACAGGTGTACATGCCCTTACCCAAAACCCCTGGGGCCAGATGTG

[0470] TTTCAGAATTTCCATTTCTTCACATTTCAGAAAGGTAACATGATGCATA

[0471] TACGATGTTACATAACACCCCTTAGTAAGCTCTGTAATCGGCTGTGTT

[0472] CATATTTCTGCAGCAAAATGTATGAACACTCGCAATAAGTGAGATTCA

[0473] ATAAAGACCAGAAAGGGCCTTGTTTCATTTCAAATCAGGTTTTGCCAC

[0474] CAAAAGAGTTAAGAAGCTTTCTGCCCTTAGAGCATTTTGGATGTTG

[0475] GAATGGCAGATAAGGGACTATGAACAAATCAGAAACTAATATTTAGA

[0476] GCTTATCATACACCTCAGGCATATAATATTTAATCTGTACAATATCTCT

[0477] GTGAACTAGGTATTGTTATCCCCATTTTACTAATGGGCATATCATTATC

[0478] CCTGTTTTACACATGAGAAAATTGAGGTACAAAGAGGTTAAAGAATA

[0479] TCAGCCAAGCGTGGTGCCTCATGCCTGTAATCCTAGCACTTTAGGAGG

[0480] CCAGGGAGAGAGGATTGCTTGAGCCCAGGAGTTCAAGAACAGCCTGG

[0481] GCAACATAGTGAGACCCCATTTCTTAAAAAAAGAAAAAGAATATGCC

[0482] CAGGGTCACACAGCTAATAAGTGGCAGAACCAGGATTCAAACACTGG

[0483] CAATCTGGCCCTAGTGCCTGGGCAGTTGTCCAGCAGGCCATATTGCCT

[0484] CTCTGCTTAGAAGAGTGCCTGATGTGTATTAAGCTCTCAATAGATGTT

[0485] AATTATTGCTGTCATCAAGAAAGAGAATATTCAGGGCCGAGCACGGT

[0486] ATCTCACACCTGTAATCCTAGCACTTTGGGAAGCCAAGGTGGGAGGTG

[0487] GGTGGATCACTTGAGGTCAGGAGTTCAAGACCAGTCTGGCCAACATG

[0488] GTGAAACCATGTCTCTACTAAAAATACAAAAATTAGCCGGGCGTGGT

[0489] CGTGGGTACCTGTAATCCCAGCTATGCGGGAGGCTGAGGCATGAGAA

[0490] TCGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGTCAAGATTGTGCC

[0491] ACTATACTGCGCTCCAGCCTGGGCAACAGAGAGAGACTCCATCTCAA

[0492] AAAAAAAGAAAAAAAAAAAAAGAACGAGAACATTCAGGGACAGTAA

[0493] CAGGACAGAGAGATCAGGCATTCATTCAGTTTTAGGACGGCTTCATAA

[0494] AGGAAAGGACCTTTGGGCTGGGACTTGAAAGATAAGAAAGACTGCTA

[0495] GGCGAAAGAAGGAAGCCCCACGTGGAGTGAGCAGCCTTTGCAAGGGT

[0496] CTGGCAAAAAAAAAACCTCCTGAAAAACTTGACATTGATATGGTAGA

[0497] AGATACAGATAATATTCAAATGAGGAGGATGGAACTAGTTTTCTATTC

[0498] TTGCTGTAACAAATAATCACAAATTTAGCTGCTTAAAACAACACATTT

[0499] GTTATCTTACAGTTCTGTAGGTCAGAAGTCCCACACTGGTCTCAGCTG

[0500] AAATCAAGGTATTGGCAGGGTTGCGTTCCTTCTGGAGGCTCTAGGGGA

[0501] AAATCCATTTCCTGCTCATTCAAGTTGTTGGCAGAATCCAATTCCTTGA

[0502] GATTGTAGGACTGAAGTCCCTGTTTCCTTACTGTCTGTCAGCTGACAG

[0503] CCATTCCCAGCTTTAAGAGGCTGCCCACAGTCCTTGATTCTGAGCCTC

[0504] CTTCCTCCATCTTCAAAGCCAACAATGGCAGGTTGAGTCCCTCTCACA

[0505] TTTTGAATCTCCCCTGCCTCTTCTGTCATCACATCTCTGAGCTACCTTT

[0506] CTTTCTCCATCATCTGCTTTTCAGAGCTCATATGATTAGATTGAATTTC

[0507] ATCAAATAATCCAGAAATAATCTCCCTGTCTTAGGGTTTGTAACCTTA

[0508] ATTTCATCTGCAAAGTTCCTTTCTGCTATGTAGTGTAAATAACATACAG

[0509] GTTCCGAGGATTAGGATGCGGAGCAGGGTTGGCATCATTTGGCCTACC

[0510] ACAGTCTGCCCTCTGACCCCCACAGATTCACATTTGTTTCACATTCAA

[0511] AATACATTCACACCATCCTAAGATACCCATGAGTTGTATCCCATCACA

[0512] GGGAGCATCCCAAGCAAGACTGGGGAGCTAGAAGTTAGTCTGGGAAG

[0513] GTTTAGGGAATGATGGTAGGGTTTGAAGACAGAGATGGAGAAAAGAT

[0514] GACAAAAAAAGGAATCCTCCTCCCGCTGACCTCTGCCCCTCCTATGTC

[0515] CACAGCCTCTCAACTCAGCTGTTTGCTCTCCAGGTACCCCTGGGATGG

[0516] CGTGAGCACTCCCCCAGCGATGGACCCATCTGTGACGCTGTGGCAGTT

[0517] TCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATCATCTCCTG

[0518] GACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGG

[0519] TGGCCCGGCTGTGGGGGCTACGCAAGAACAAGACCAACATGAATTAC

[0520] GACAAGCTCAGCCGGGCCTTGCGGTACTACTATGACAAGGTACAGTCT

[0521] CTCAGACCAGGGCTGGAACCCCCCCCTGACATTTATATCAGAGATTTT

[0522] ATTTTGTTTTAATTGCCATAGCTATGACTTTGAAAGCAATGTTAAAATT

[0523] TATCAGTTTTTAACCCATCCATTGGTACCCTAAGACCAGTATTGGGCC

[0524] CCTAAACACTATCTCACCTACTTTCTTGTCTTACTGCTTTGGCGAAAAC

[0525] CACCACTGCATTATTAATACTGACTCTTTCTACTCCCACTCTGAGATCC

[0526] CCAAAGTGATGCTGCCCTGCCATGCACAACGTTTCATTTTCCTGCCGT

[0527] ATTCCTATAGCCAACATCTTGAAAACACGGTTAATAATGGCTGGTCCT

[0528] CATTCTGTCCTCTGAAACCCCTGGACCAGTGCTGGGCTTCCCTAGTTAT

[0529] TTCATAGTCTTCTCTTATTCCAGAATATTTCATATTCCTAGAATCAAAA

[0530] CCTCCCTGACAGTATTATACCAACTTTTGCTTACTTCGTCCTCTGGGAC

[0531] TCCCAACATTTTTAACTAATTATTTTCTTCTCTTATTCCTTAAGCTAAA

[0532] ACCTCTGAAACAACATGTTTAATGCCAACTTCCACACACTGTCTTCTT

[0533] AAATTCCCAGAGGAGCACTGGTCTACCCCAATATTTATATCAATTGTT

[0534] TTCATTATCTTATTCCTACAGCTAAAATTTAAAATTTCCCCCATCCTGC

[0535] CCTCTCAGACCCCCAGGCCACTGCTGGGTTTCTCCTCCCCCCAATATTT

[0536] ATACCAGTTATTTCATTTTCTTAATCCTTCTACTGAAATTTCCCAAACA

[0537] ATATTCATGAATATCCCTTTTTATTCCTCTTCCGAGAAACACAGGCCCA

[0538] CCCTGTGACATATCTGACCAGCACTAAGACTTCCACAGAATGCCCTAG

[0539] TGCCTCCACACTCCCAGAACTGCCCTGGTCATATGCTGCACACCCTTC

[0540] ATAGTTTATGGCATTTATTCCATTTTCATATTTTATTCCTTGAGCTCAA

[0541] CCCTCCAGAACAATATTAGTAATGAGGCTATCTCACTCTGCCCTCTGG

[0542] GAACACTAGGTCATCTCTGAGACCCACCAGACCTGAAAAACCCCAAA

[0543] CATGCTCTGTGACCCAGCAAAGCCAGCCTTGATATAGGCCCCCTCCCA

[0544] ATATTTATACCAGTATTTTTAATATTCTTGTCTAATTGCTGTTAGTTACT

[0545] TCATTTTCTTACCATTTTAGCTTCAACCTCCACAGTGGTATTAATAATG

[0546] AGGCCTCCTCACCCTCTCCTCTGCAGTGACCTTGCCCTGTTCCACTTCT

[0547] GTATCATTAGCTTCAAATAATCCTCTGTATTAATAATTCATCACCCCAT

[0548] CCATCTACATTAATTTACTTTCTTCCAACATTTATATCAGTTACTTCAT

[0549] TTTCTTGTCTTATTGCATTTGCTAGTCTCCAAAACTGTGTCCTGACAGT

[0550] CACCCACAAGGCCTGGCCCTGTGAACCTCTGGTTCTTGGAGCCAGGAA

[0551] GAAGACCTGCTCCCACACCTACTGCCCTTCATGGGCCCCATTGTGAAG

[0552] AGGAGCTACAGTGTGGAGGGAGTGGGAAAATCAGATAGACGGACCTG

[0553] GAGAGTGACAAAGGGAGGCTTGGAAAGGGGTGGATGGGAAGGGGCT

[0554] TAAAGAAAAAATTATTGTGGAGAGAAGAGAGAAAGGGGAGGAACTG

[0555] GGGAGGGATATAGATAAGGGGAATCTGGCGGGAGAGGAAAGAGGTA

[0556] GAAACCAATGGGAGAGGAAATGGGCTGAGAGAGAAACTTACAGAGG

[0557] AGGGACGGGAAAGCCGGAGAGGAGCAAGTGGGAAGAAAGCCACTAG

[0558] GAGAAGAGAAATGCCACTCCACCCCCCTCCTCCCCCCTGACACCCTGC

[0559] CTCCAGCCTGCCCCTTTCCTCTAAGGCCCTCTGTTCCTCTCCTCCCTTC

[0560] CTAGAACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGT

[0561] TTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCGC

[0562] CCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTG

[0563] CTGCTATACATGCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGC

[0564] ACACCCAAGGGTGCAGGAATGGCAGGCCCAGGCGGTTTGGCACGCAG

[0565] CAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCCACCTTCACCAT

[0566] CCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGT

[0567] GCTCCCCAGTGCAGCTCCTGCAGGGGCAGCAGCGCCCCCCTCGGGGA

[0568] GCAGGAGCACCAGTCCAAGCCCCTTGGAGGCCTGTCTGGAGGCTGAA

[0569] GAGGCCGGCTTGCCTCTGCAGGTAAGGACTGGAATATAGAAATTCAG

[0570] TAAGAGGAGGCAGTAAAGAGGAGGGATGTGTAATCCCCGGATGACGA

[0571] GGGAGGCTGGTAGAAGAGACATAGCTGTCCCGTTAAAGGAGATAATG

[0572] GTGGAAGGAAGACATCCTCTTAGAAGGAGGGGTGGGGCAGAGAGCTA

[0573] CACAAATCCTGAGACAGAAAGGGGAGAATACTGTGCTACAGTTAGTA

[0574] GCTGCCGAACATGTAGGTGCCTGGAATATGTTTAATGCACTGGTTCTC

[0575] GCACTCTAGTGCTCATCAGAATCACCTGTAGGTCTTGTTAAACCACAG

[0576] ATTGCCAGGCACACCCCCAGAGTTTCTGAATTTGTGGGGCTGGGGAGG

[0577] GGCCCAATAATTTGCATTTTTAACTTGTTACCAAATGAGGCAGATATT

[0578] GCTGGTCCAGAGGAAGGTAAATTTTTGAGAACCACTGTTTTAATGAAT

[0579] GAGGATGGTATCCCTCAGATTCCTACCCGCTTCAGGTTGTCTCACCCC

[0580] AAGTCCCCTGTCCCATAGGAGGACCTGCCCCAGAGGAAGCCCTACTTC

[0581] CTTGACGAAGTCCTATGTCCTGTTGGAGGACTTGCTCTGATGTGCAGT

[0582] CATGCCCTGAGTACCAAGTGCCACCTTCCCGGGGAAATCACTGGGTGG

[0583] CCCACAGGAGAATCCTGTGGTCCCAACAATCCTTACACACCCTCTTTG

[0584] TGCCTGCTCCTCTACCAGGTCATCCTGACCCCGCCCGAGGCCCCAAAC

[0585] CTGAAATCGGAAGAGCTTAATGTGGAGCCGGGTTTGGGCCGGGCTTTG

[0586] CCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTTGGAAGTTGC

[0587] GGGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAA

[0588] GTCCCTCCACAGGAGGGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATG

[0589] GACACCGCAGGGCAGGCGGGCGGCCATGCGGCTTCCAGCCCTGAGAT

[0590] CTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAGCTTCCAC

[0591] TCAGCCCGAGCCTGCTAGGTGGGCCGGGACCCGAACGGACCCCAGGA

[0592] TCGGGAAGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCC

[0593] ATCCCTGCTTCCTACGCATACATTGGTGAGTGCCTGCGGAGGGGTGGG

[0594] GTGTGTGGGCGCCAGCACCAATGGGATTGGCATGTGGCGGGTGACTG

[0595] ACAGGAATCAGAGGAGGGTGAGTGTGGTTGTTCCTGAAGAGGGTGGA

[0596] GCCTTTGAGTGTGATTGACTGGGCTGATGCTGGCTGGAGGGATGGGGT

[0597] TTGATTAGTGAAGGGCAGGGCTGGGGACTTTTGTGGGTGGGACCGAG

[0598] GGTCTTTCTGTGGGACTGTTTCTAGGTTGGGGTGTGGCTTAAGGAACC

[0599] TGAGCAGGGCTTTTTGGTCTGGGATGTGCATATGGGGTTTCATGGGTG

[0600] GGACATGAGTTGGAAGTTGACCCTGAGCTGTTGGGATGGTGACTTGAG

[0601] AGGTTTGAGAGCAGCATTTGGATAGGGTCTTGTGGGTGGTCTTGACCA

[0602] ATGAGGTCTCAGCAACTGAGGGTGGGCTCTCGGGAGTGGGGAGTGGG

[0603] GGGTGTCTGCAGAGTTTGAGAGATCATAGGCATGGCCTCCATGGTTAC

[0604] CATCTAGGTGTGTGCACTTTGGGGAGTGACCCTGGGAGTGTGAGTGGG

[0605] AAATCTGTGGTGGGGCCGGGACCAAGTCCCTTCCAGCATCCCACATCT

[0606] ACTTTCTACTCACTTGAGCTCCGACCACCCTCTCCCCACAGACCCCGG

[0607] TGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGCA

[0608] CCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGG

[0609] TAGGATCCTCTTTCCCCGTTTTGGACAGGGTGAGAGACCCAAGAATGG

[0610] CCCCCATCTGTGACCTCTCCCTCTTTTTGCCCCCAGTTTCCATCCAGTG

[0611] GCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGA

[0612] CCCCCGTGGTGCTCTCCCCAGGGCCCCAGAAGCCATGACTACTACCAC

[0613] CACCACCACCACCCCTTCTGGGGTCACTCCATCCATGCTCTCTCCAGC

[0614] CAGCCATCTCAAGGAGAAACATAGTTCAACTGAAAGACTCATGCTCT

[0615] GATTGTGGTGGGGTGGGGATCCTTGGGAAGAATTACTCCCAAGAGTA

[0616] ACTCTCATTATCTCCTCCACAGAAAACACACAGCTTCCACAACTTCTC

[0617] TGTTTTCTGTCAGTCCCCCAGTGGCCGCCCTTACACGTCTCCTACTTCA

[0618] ATGGTAGGGGCGGTTTATTTATTTATTTTTTGAAGGCCACTGGGAGGA

[0619] GCCTGACCTAACCTTTTAGGGTGGTTAGGACATCTCCCCCACCTCCCC

[0620] ACTTTTTTCCCCAAGACAAGACAATCGAGGTCTGGCTTGAGAACGACC

[0621] TTTCTTTCTTTATTTCTCAGCCTGCCCTTGGGGAGATGAGGGAGCCCTG

[0622] TCTGCGTTTTTGGATGTGAGTAGAAGAGTTAGTTTGTTTTGTTTTATTA

[0623] TTCCTGGCCATACTCAGGGGTCCAGGAAGAATTTGTACCATTTAATGG

[0624] GTTGGGAGTCTTGGCCAAGGAAGAATCACACCCTTGGAATAGAAATTT

[0625] CCACCTCCCCAACCTTTCTCTCAGACAGCTTATCCTTTTCAACCAACTT

[0626] TTTGGCCAGGGAGGAATGTCCCTTTTGTTCTTCCCCCTGAGAAGCCAT

[0627] TCCTTTGTCTGCCAACCTCCCTGGGGTCCTGCCTGTTTCCTCCCAATGG

[0628] AGGGTTTTTTTGGGGGGTGGTCCCCGTCTGGGGGGCCCCTCCAGCCAG

[0629] TACTCCAGGTCTCCCTGTCTCTCCCCCGCTGCCATTTTGATAGTATAAT

[0630] CTATTTTTAAATGGGGCTTTTCAATAGGGGAGAGGGAGTCATCTCTTC

[0631] CTATATTTGGTGGGGTGGGTGGGAAGGAAGGGATTTGGGGGGGAATC

[0632] TTCCTGCCGCCTCCCCCACTCCAAGTGTTTATTTTTGATACCAAACATG

[0633] AATTTTCAGTTCCCTCCCTCCCAGCCCCCAATTTCCTGCGGGCGGTA

[0634] CAAAGGACCCTTTCAAGTCCCTGGAGTTGGGAGGGAGGAATGGGGG

[0635] ACATAAAGCCTGTCCTGTCTCTATTCTAGGCAAGAGAGAGTGGGTTCA

[0636] AAAGACTCCTGGGCTCACCTGTTAGCGCTGGCCCAGCCAGGCCTTGG

[0637] GACCTGGGGGTTGGTGATTTGGGGGACAGTGCTACACTCGTCTCCACT

[0638] GTTTGTTTTACTTCCCCAAAAATGGACCTTTTTTTTTCTAAAGAGTCCC

[0639] AGAGAATGGGGAATTGTTCCTGTAAATATATTTTTCAAAGTGATGC

[0640] TGGAGGCTGCTGGCACTTTTTCTCTGATGTTGTCAGGACTAGCTGAGC

[0641] GTGACACGCATGACTGTGTGTGGAGGGTGTGAGGCAGAGGTCGATTG

[0642] TGAGAGAAACGGTGTGATGGCGTGTGTGGAGAAACAATAGTAGGGACT

[0643] GCATATCGGTAACCATGTGTGTGTCAGAGAGCGTGGAAAGCTGTGATTG

[0644] TGTGTGAGAGTGTGCAGAAGTTGTGACCACAGACTTTTGATGGTGTGT

[0645] CTATGTGGGAAATTGTGGCTGTGTTTCAGAAAATAACTGAGCCTGGAT

[0646] GAATAGTCAAGGTACTGTACAAGAACCTGTGATGGTATGCACAAAAT

[0647] AATTCTACGAGAAGGGAACGGGGACTGCAGCCCTGTCACTGTTTGA

[0648] TGGCGAGCAAGACAGACTGGGTGACCAAAACCACATGTGAGAGACTA

[0649] CGTGGGCATGAAACTACAGTAGAGGTTGTCAGGGATTGTGGCAAAGA

[0650] TTGTGTAGGTGACAAACCTCACTGTAGGCGACTCAACGTTTGAGAAAT

[0651] AGATGATGTGCAAAACTGTTTACTTGAGGCTGTAGTTCAGCTAAAGC

[0652] TGTAAGACTGTATGGGTGCGAACTTGATTGTACGGGAGAGAATGGCT

[0653] GGGAGACCAAACCAGTGACCGAGACCAAAGATACAAGAAGGTGCAA

[0654] TTGTGTGTACGAAAGCAGGCGTGAGAGACTGCAGCAAAGACTGAGAA

[0655] AAACGAATGGCTGTGACTGGGAGAGTGTGACAGGCTGTGTGTGTGTG

[0656] TGTGTACACCTGAAACTAGTTGCAAATCGATTTACCATTACTACCACA

[0657] GTCTATCCCAGAGGTCAGGGACTGTGAGAAAGTAGGAGAGAAAATG

[0658] ACGGTGAGCCGGACGGAGCCACTGACATGGTGTGAGAGACCACATCA

[0659] CTGGGCATGCAAGGGAGAGGGACAAGGAACTGTTTATGAGAGACTTG

[0660] GCAGTAGCAGTAACTGGAAGTCAGAAACTGTGGGAGAGGAACTTGAC

[0661] AACTGAGTGATGTCAGAGCACCAGGGGGTCTGTGAAACAGTCATAA

[0662] GAAACCATAAATCAGGGGCCATACAAGAGGCTGAGCAAATGAGAC

[0663] ATGCCAAGTGACCACGTGACAGTGTGTGAGAAACTTGTAAAAGCTGTG

[0664] CACGTGTGTCCGTGATGAGCTGACCATATGAAGAAAATGACGGTGTG

[0665] CACGACTGAGAGGGCATGGGTGACTGTGGGTGACTTATCGAGGGCCT

[0666] AGTGGTGATTGTGAAATACTGACCGAGTATATCAGAAGCTGACTGAG

[0667] GGACAGTGATGACTGAGACAGTGGCTGAGAAACGGATTGTGTGTCCA

[0668] TGGGTAAACCCTTTGCAAGAGACTTTATGAAAGGCTGTAAATCAAGG

[0669] ACTGAGGGTACTGGAAGCTGATTGAGAAGAAACGTGAGACTAGGTGA

[0670] CGACAGTGTCTGAGATACTGTGTGATTGTGTATGCGTGTGAATGTCTT

[0671] TGTGGGAGAGGCTGTAATCAGGGATCGTGGGTGTGTGAAAAAGTGGC

[0672] TTGAGTGAGAAAGGGGTAGGAGAGGTGATTTTTGTGCATGGTGGGGA

[0673] AACTTCATGAGAGACTAGTTTAGTGGTGACTATAAATCAGTGACTATTTT

[0674] GTGTTATGTGAGAAAGTAACAGGCCAAATGAGTGCCTAAACGTTTCAT

[0675] GAGATTGTGTGACTGCACGTGTATGTAAGGAACTGACTGGTGAGAGA

[0676] AACTATTGGCAATATTGACTGAATGAGACAGGCTGTTAAACATGATTG

[0677] TGTGTGTGAAACTGTTAGGAGACTGTAGTAAGGCTGGAATCCATGACA

[0678] CAGAAAATGACTATGAGTGACAGAATGTCTGAGAGGCTGTGTGATTA

[0679] AGAGAATATAGTAGAGGCTGTAAATCCGACTGGGTGCGGTGGCTCCA

[0680] TGCTTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGAGGATCACTTG

[0681] AGGCCAGGAGCTTGAGACCAGCCTGGGCCACATGGTGAGACCCCGTC

[0682] ACTACTAAAAATTTAAAAAATTAGCATAACGTAGTGTTGTGCACCTGT

[0683] AATCCCAGCTACATGGGAGGCTGATGTGGGAGGACTACTTGAGGCCA

[0684] GGATTTTGAGTTTGAGACCAACCTGGGCAACATAGAAGGACCCTGCC

[0685] GCTACCAAAAAAAAAAAAATTACCCAGGTATAGTGGTGCATGCC

[0686] TGTAGTCCCAGCTACTGAGGACACTGAGTTGGGAGGATCGCTTCAGCC

[0687] CAGGAGTTTGAGTTTGAGACCAGCCTGGGCAATGTGGCAAAACCCTG

[0688] TCTCTCCAAATAGTTTAAAAAATTAGCCAGGTGTGGCGTGTGCCTGTA

[0689] GTCCCAGTTACTCGGGAGGCTGAGGTGGGAGGATGGTTTGAGCCCAG

[0690] GAGGTTGAGGCTGTAGTCTGCGATCACGCCACTGCACTCCAGCCTGGG

[0691] TAACAGAACCAGACCCTGTCTCGAAAAGAAAAGAAAGAAAAGAAAA

[0692] ACATAACTGTGTAGATAGGTTTAAAAAAAAAAAGAGAGAGAGAGAA

[0693] AATAACAGACCAAATGAGACTGTGTGAGAGGTCTAATGCCCTGCAGA

[0694] CCCTCGAATGTTCCAGGCCCTGGAGAAAAACCCTCTTCTGTTTTTCCTG

[0695] TTCCTCCACAGGCCCCTCCTGCTCAGTCCGCTGGGCTGGCTTCTCCTAC

[0696] TTCTCTAAAACTTGAAATGCTGGGGTTCCCCAGGGCAAAGCCCTGGGA

[0697] TTCCCTTCTCTCTTCTCACGCATCCTCTCTAGGTCATCTTATCCAGGTCT

[0698] TCACACTTGAAATACTACTTATCCTCCATGGGATGCCCACATTTTTACC

[0699] TCTAACTCAGACTGTCCTTCTGGCATTTTATCGTAATCTCTAAAGTTTT

[0700] GTTTATTTCATTGATTGATTCATTTAGCAGATGTTTATTGAGCATCCAC

[0701] TGTTTCCTGGTGCCTATCTAATGCCCTGCAGACCCAGCAGTTAACAAG

[0702] CCAGACAAAAATCCCTGCCCTTGTGGAACTGATATTTAGGGAGTGAG

[0703] AATAACAAGAAGCAGGCAAATACATAGTAGCAGGTAGGGATGTAATA

[0704] ATTAAATAAGACAAGACTCTCACTCTTTGTTTAAGGAATCTGCAGTCA

[0705] TTTTATTGCCTAAACGTGTGGGAAAAGATAGAGTGCTGACAGTCCTCT

[0706] TCCACAGGGAATCCTATGAGTATTTATACAGTTTAGAAACAAAGGAA

[0707] ATATTGTTAATATTATTACCAGGGCAACAGGTGGTTAAATAAAGAAGC

[0708] CAGCCAGAATTTCAGGTTTCTTTCTTTTTTTTTTTTTTTTTTTTTGGGAC

[0709] AGAGTCTCACTCTGTCGCCCAGGCTGGAGTGCAGTGGCACGATCTCAG

[0710] CTCACTAGAGCCTCTGCCTCCCGAGTTCAAGCGATTCTCCTGCCTCAG

[0711] CCTCCCAAGTAGCTGGGATTACAGGCATCCGCCACCACGCCTGGCTAA

[0712] TTTTTGTATTTTTAGTAGAGACGGCGTTTCACCATGTTGACCAGGCTGG

[0713] TCTCGAACTCCTGACGTCAGGTGATCCACCTGCCTCAATCTCCCAAAG

[0714] TGTTGGGATTACAGGCGTGAGCCACCATGCCTGGCCAGTTTCAGGTCT

[0715] CTTGGAGAGTGTTTTCACAGGATAACACAGCAATGATTGTCTTGAAGT

[0716] CGTAGAATCTTAATAAGACTCCTTTGTTCAAAGCACATTTTCAAGGAT

[0717] AGCCTTATGTTATCAGAGAACAGAGTATGTCTGTAATGGATACAGATA

[0718] TTAACACATACTTTACTGCCCATAAAACAAGTGTTCCTGAAGAACTTC

[0719] TGTTTTAACAGCTGACCAAATTATTACATTTGAATTTGCAGAATTCCTC

[0720] TGCCTCCCTGAGAGCAGAGGAAATTAGGCATTGCCTTCCTATCTTTCT

[0721] TGTGCTTCTTTTTGTTAATTAAAAGCAAAATAAAAATTTTAAAGTGGG

[0722] CCCTGGAGTTTCATTAGGGTTTATAAAAAAAAAATAAAAAAATAAAA

[0723] AAAAAAGAAGGGCTGGTGTGATGGCTCATGCCTGTAATCCCAGCACT

[0724] TTGGGAGGCTGAGGTTGGGAGAAAATATTGAAGCCAGGAGTTTGAGA

[0725] CCAGCCTGGGCAACACAACGAGACCCCATCTATACAGAAAATAAAAA

[0726] CATTAGTTGTGTGGTGGTGTGTGCCTGTAGTCCCAGCTACTTGGGGAC

[0727] GCTAAGGTGGGAAAATCACTTGAGCCCAGGAGTTTGAGGCTGCAATG

[0728] AGCTATGATCAGACCACTGCACTCCAGCCCAGGTGACAGCAAGACTC

[0729] TGTCTCTTTAAAACAAAACAAACAAAAAAACAGGTTTGGAAGCTACT

[0730] GGGCTAGAGAGTGACAGGGATGCCAGACAAGGGTATGGGGAAGGCCT

[0731] CTGTGAGGAGGGGCAACATTTGTTATCCATCTTCTCGAGGGCCAGGAT

[0732] TTTTGTCTGTCCTATTCTCTGCTCTAATGCTAAGAACCGCATCTGGCAT

[0733] CCAGTAGGTGCTCAATAAATGTTGAATAAATTTATCAAACACAGAGCA

[0734] CCTACTATATGCCAGGCACTGTTCTAAAGACTTTCCAAAAGCTTAACT

[0735] CCTGGCCGGGCACGGTGACTCACGCCTGTAATCCTAGCACTTTGGGAG

[0736] GCCAAGGCAGGTGGATAACCTGAGGTCAGGAGTTCGAGACCAGCCTG

[0737] GCCAACATGGTGAAACCCTGTCTCCACTAAAAATACAAAAATTAGCT

[0738] GGACATGGTGGTACACGGCTGTAATCCCAGCTACTCAGGAGGCTGAG

[0739] GCAGGAGAATTGGTTGAAATCGGGAGGCAGAGGTTGCAGTGAGCCGA

[0740] GATCGTGACACTGCACGCCAGCCTGGGCGACGGAGTGAGACTCCATC

[0741] TCGACAAAACAAACAAAAGCTTAACTCGCAATCTTTGCAACACACCCT

[0742] ACCTATGTTGTAGGTGCTGTCTGTGAGCACATTTTACAGAGGGGAAAC

[0743] AGGCTCCAGAAGGGGGGTGTTATCTGCCTGAGGGTTCTCTGATGGAAT

[0744] ATGGCCCAGCTTATTCCCTCCTAATCACCCCAGACCCTGGTGTTGTCCC

[0745] CAGCTGGGCCCATGGAACAATGGATAGACCCCATTCCCCTCCTGAATC

[0746] CCTCCCCAGGCTCCTGCCACTTCCCTTTCTCACTTCCCTTGTGCTGACC

[0747] TCCCCGACCACAAGCTGACCACAGGGAACCTCTCAGGAAAGGAGGGC

[0748] CGAGGTTAAGGGAGGGTGGAAGGTGGAGCAACTGACTCGATGCTCCC

[0749] TCCACCCCCACGAGCAGGAACATACTGAGCACCGCACACTCACTTCAC

[0750] CCTGGTTCAACACCCCCACGAGGTTGACCCCGTCATTATGTTAGAGAT

[0751] TATGCATTTCCACATAGGGAAACTGAGGCTCAGGGGTGTTAAGTGAC

[0752] TCACCCAAGGTCACACGGCTAGGAAGTTGCTGCACGCTCCTATGCTCC

[0753] ATTTCCTCTGGGTGAGAATTTGTCCTAGGAGCTTCTATTGAACACTGTG

[0754] AGGTTGCTGGGGAGGAGCGCGAGGTGCTGGGATATAGTAACAAACAG

[0755] AACAAGACCAAGAGTAAGACAGGAAATGGGGAGGGGGAGAGTAGAGA

[0756] AGGAGGCAGAGGGGGACAGGGTGGGTCAAAGCAGGATGCCCTCCCA

[0757] GTTCCTCCTGCCTCTAGGTTCCTCTTTCCCTGCTGATTCCAGGAGCCTA

[0758] TCAACCCAGATAAAGCGGGACCTCCTCTCTGGTAGAGGTGCAGGGGG

[0759] CAGTACTCAACATGATCACAGAGGGAGCGCAGGCCCCTCGATTGTTG

[0760] CTGCCGCCGCTGCTCCTGCTGCTCACCCTGCCAGCCACAGGTGAGGGG

[0761] GTGAGGGCCCAGCTGGCCCCAGGGGTGTCCAGGCCCACCACATCCCT

[0762] GACCGAGCCCCACCCACCCATCCCCCTGGCCCTGTTACAGGCTCAGACC

[0763] CCGTGCTCTGCTTCACCCAGTATGAAGAATCCTCCGGCAAGTGCAAGG

[0764] GCCTCCTGGGGGGTGGTGTCAGCGTGGAAGACTGCTGTCTCAACACTG

[0765] CCTTTGCCTACCAGAAACGTAGTGGTGGGCTCTGTCAGCCTTGCAGGT

[0766] TAGGGGGAGCCTGGGGTGGGGGATGGGGGGGAGGGAAGGACTGTCT

[0767] GTGGGGGTCACCCAAAACTGGGCACTTTCTTTCTCTGGGACTTCCAAG

[0768] GGTGGCCCTGAGGCCCTGATCGTGACCATACCTCAGGGTTTCTCAACC

[0769] TTGTTACTATTGACATTTGGGGCTGGAAATTCTTGGCTGGGGGAGGGG

[0770] ATTGCTTACCTGTGTATTGTGGGATGTTTTGTAACACCCCTAGCCTTCC

[0771] ACTAGATGCCAGTAGCAATTCTCCCCACCAGCTGTGACAACCAAACAT

[0772] GTCAGCAGACATTGCCAAATGTCCCCTGGGGGTCAAAATCACCCCTGA

[0773] TTGAGAACCACTGACATAGCTCACACATATTGAGCACCTCCTGCACAC

[0774] TGGAAGCATTGCAGGTGGGGTGCAGCTTGGTATTTCCCTAATTTTGAT

[0775] GACAGCTCATGTTTATTGAGTGCTTACTGTATATGGACACACTGTGGG

[0776] GGCGGGAAAGTTTGGGGAATTCAAAGGGCAGCTCTAGGCCCCTAATT

[0777] ATGATGACACTTCACATTCATTGAGCACTCCCTGTATACCAGCTGCAT

[0778] GGCAGGGTTGGGAGATGAGCTTGAGGATTTCTGAGGGTAGCTCTAGTC

[0779] TCCTGATCATGATTTCCAGCTTGCATGGATTGAGCCCTTACCGTATGCC

[0780] AGACCTGTTTTCTACTTGTTTACTATATATCCCAGATACACCGTGGGCA

[0781] TGGGGAGCTTGGGGATTTTTGAGGGCAGCTCTGGGCCCCAAGTCATGT

[0782] CAACAGTTCATCACATCTATTTGGCATGAACAGCATACCTAGGGCTAT

[0783] GCAGTGGGTTGGGGATAGATCTGGGGTTATTTCTGAGGAGGCCTCTGA

[0784] GGTCATAGGGATGATGGCTCAGGTTTATTAAGCACTTTCTATTTACCT

[0785] ACTACCGTGTAGTGTGGTGATCTGGTGGGTTTCTGACAGCAGCCCTTG

[0786] GTTTCTAGTCCTTACCTTTGCTTACTGCGGACCTGGTGTTGGCCATGCA

[0787] GCCTTCCAATGGTAACTCCAGATGCCTGATTGTGAAGGTAAATGACAT

[0788] TATCAAGCACTTATTGTATATCCACTGCTTCCCATCAGTATCCCAATAT

[0789] CCCTAAAAGGTAAGGACTTATCAATCCATCGCACACGCACTTGCCTAG

[0790] CAACCCTTCGTGTCTGCCCACACTCTGGAGTCCCACATGCCATTCTTGT

[0791] TAGCTCATGCCAGGATGGGATGTGTGTGCTCTTCTCCAGAGGTCCCCA

[0792] CGATGGTCCCTGTGGTCCACATGGGCCCCTGTTCGGTGACGTGCTCT

[0793] GAGGGCTCCCAGCTGCGGTACCGGCGCTGTGTGGGCTGGAATGGGCA

[0794] GTGCTCTGGAAAGGTGGCACCTGGGACCCTGGAGTGGCAGCTCCAGG

[0795] CCTGTGAGGACCAGCAGTGCTGTCCTGGTGAGGAGGATGAGCAAGGC

[0796] GGGCAAGCACTCCCTGTCACCCAGCACTGGTGGGAACGATCGGTACA

[0797] GAGGTCCTCAGAGTGGGCCCGTCCCCAGTGTTTGTAAGGACCTAAGG

[0798] AGGAGAGTGGTGGGAGGTGAGGTCAGAGAGGTGAGGGTCCATTG

[0799] CCTGGGGGCCACAGAGGACGTTGGCTTTTCATCTGAGTAATTTGGA

[0800] CTGTGGGCAGAGGAGGAACGTGATCTGACTGGGGTTGGGAGGAGAAC

[0801] AGACTGTGCACGGTGAGGGTGAGAGGGGAAGCGGAGGCACCCATGTG

[0802] AAGGTTGCTGCGCAGGCCCGGTGAGCGGGGATGGTGGGCCCAGAAT

[0803] GGTGGCAGAGGATATAAGGACAGGATTAGCTCATGTGGGGCACTCAA

[0804] GGAAGCAAAGAGCCCTGAATGACACCCCACCTCCATCCCATTACCCTC

[0805] TCTTCTCTCCCACAGAGATGGGCGGCTGGTCTGGCTGGGGGCCCTGGG

[0806] AGCCTTGCTCTGTCACCTGCTCCAAAGGGACCCGGACCCGCAGGCGA

[0807] GCCTGTAATCACCCTGCTCCCAAGTGTGGGGGCCACTGCCCAGGACAG

[0808] GCACAGGAATCAGAGGCCTGTGACACCCAGCAGGTCTGCCCCAGTGA

[0809] GTGAGGGAAGCCACAGGATGCTGATGGGTGCACCCAGCGTGGGTCTG

[0810] CGGGGTTACAGCAGGGAACTGCCAGGCTGAGAGGACTTTAGCATGCA

[0811] TGACCACACCTGCATCCCTCCACCTCCCACCCCACCACAGCACACGGG

[0812] GCCTGGGCCACCTGGGGCCCCTGGACCCCCTGCTCAGCCTCCTGCCAC

[0813] GGTGGACCCCACGAACCTAAGGAGACACGAAGCCGCAAGTGTTCTGC

[0814] ACCTGAGCCCTCCCAGAAACCTCCTGGGAAGCCCTGCCCGGGGCTAG

[0815] CCTACGAGCAGCGGAGGTGCACCGGCCTGCCACCCTGCCCAGGTACA

[0816] CCAGGATGAGGCTGCTGATGTTGCTGGTGGGGCTCTTGATTGAGGGCA

[0817] GAGATGCTCTGCCATTTCTAGAGTTCCTAGGCCATGTGACCATGCAGC

[0818] CCTTCATTTGGGGACAGTCTGCTTCAAGGGTCTAGGGGCTGAGAGGAA

[0819] GGATTGAGGAGGCCTTTCTCCTCACTCCCTTTCCTCCTCCAACAGTGGC

[0820] TGGGGGCTGGGGGCCTTGGGGCCCTGTGAGCCCCTGCCCTGTGACCTG

[0821] TGGCCTGGGCCAGACCATGGAACAACGGACGTGCAATCACCCTGTGC

[0822] CCCAGCATGGGGGCCCCTTCTGTGCTGGCGATGCCACCCGGACCCACA

[0823] TCTGCAACACAGCTGTGCCCTGCCCTGGTCAGCATCTCAGGGTTCACG

[0824] ATTTGCATGCCTAAGTCCCCCTTGCCCTTCTCTGCTGCCCAGCTCCTGC

[0825] TGCTGAGGCCTTGTTCCTGTCTCTGATTCCTCCTTTCCTGGCCCTGATA

[0826] CCTTGTTTCCACCCCTGGTCCCCCATTCACACATCTGATCACCTCTACT

[0827] CCCTCCTACCGCCCTCATTCCTTCCTCTGAACCCCCTTGCTGATTCCCT

[0828] GCTTTGGTCCAATCCCCTGTTGCCCTGTCTCTGCAGTGGATGGGGAGT

[0829] GGGACTCGTGGGGGGAGTGGAGCCCCTGTATCCGACGGAACATGAAG

[0830] TCCATCAGCTGTCAAGAAATCCCGGGCCAGCAGTCACGCGGGAGGAC

[0831] CTGCAGGGGCCGCAAGTTTGACGGACATCGATGTGCCGGGCAACAGC

[0832] AGGATATCCGGCACTGCTACAGCATCCAGCACTGCCCCTGTGAGTGTC

[0833] CCACAGACTGTGCTCTGAGGGTGGGGTGGCCCATGCAGGATAAGGGG

[0834] TTTCCAACTCTCTGCTGTGGACCTCACGTCTCTGCAGCCTCCCTCTCAC

[0835] TTTCCCACCAAGACCTCCAGTTCTGACTCTGTGACCCCTACCCCTCATT

[0836] GCAGTGAAAGGATCATGGTCAGAGTGGAGTACCTGGGGGCTGTGCAT

[0837] GCCCCCCTGTGGACCTAATCCTACCCGTGCCCGCCAGCGCCTCTGCAC

[0838] ACCCTTGCTCCCCAAGTACCCGTGAGTGAGAGGGCAAAGTATGCCTG

[0839] GGAGGGGGTCATTATATTACAGGCGGAGAGTCGGCTACCCCAGGAA

[0840] ACCAGGGTTTCCACTGCTGAATCTAAGGTATCTGCCTTGCCGAGTGCC

[0841] ACCTCCCAGCTGCAGGAAGTGGGGAGAAACTAAGAAGATGAGAAAG

[0842] AAGTTCTTGGAGGATAATTCGTAGCCTCTGTGCCCCCTCAGTCACCTGT

[0843] TCAGTCACTCATCCACTTAGTCCTTCATGTGTCATTGACTCCGACCTTC

[0844] AGTTACCCATGCTTTTAGCTGCCATCACTCAGGCCTCCATTCACTGCCT

[0845] GCCTCCCACAGTCACTCATGCCTCCATCCACTTTGTCAGCATCTCACTG

[0846] AGCCAAGGCACTCCAAGGCTTTTTCAGCAACAGTTGCAGATACACAC

[0847] AGCCCAGATCCTGTGGATCCTCCAAGGGACCCAGCTGAGCAAGCCCC

[0848] TGACAGGAGGCATATGAGGAACAGCTGGTGCATGCAACAGGTGCTGC

[0849] CACCTCAACCTAGGTCCAGGAAGCTGACTGGGCCTCCCAGGGCAGGT

[0850] AGGGGTTGGGAAAGGCATTCCTGGCATCAAGACTGTGAACGGAGCCT

[0851] TGGAGCTAGGTGATTAGCCGCTATAAGTGTTTCCAGGTGCCAGAGGGG

[0852] CCCAGGTGTTAGAGAGGGTTAAAATGTTCATCCCTTTTCTTCCTTCCAC

[0853] ATACATCAAGCTACTAGATTAAGTGAACTATTCCCAGCTCGTGGAAGG

[0854] GCTGCCATCTGGGAAGGGATCTCCCGGCTGAGGGGGTTAGAGTGGGG

[0855] CCTGAAGATTAGAGGTGTTGAATGGAGGCACAAAGGACTTGAGTGAG

[0856] CGAGAGACTGAGTGGAGGAAGAAGCAATTGAGAGAACTGGGATGGG

[0857] AGTGAATGGAGGGCTTTCCTAGTGGGACAAATAACCCAGGTAAAGAC

[0858] CTTTCTGGACAGGGACTGAGCTTGAATAAAGTGGAGGAGACAGAGAG

[0859] AGAGATTGGCTTGGGGCAGGGATTTGGGCCCAACAATAAGGCCTTGA

[0860] ATGTCAGGACAAGGCATTGGGTTTTTTCCTGGAGGCAGTGGAAAGAG

[0861] ATATAAAGGGTATATATTTCGGAGGTAAAAGAAAGTAGCTCATGCCA

[0862] ACAAGTAACATTCACCAGCATTTATTGAGCACTTGCTGTGTGCCAGGC

[0863] ACTGCTCTGAGCACTTTACCTGAATTAACTCATTTATCCTCATTCAACC

[0864] CCGTGAGGTGAGTATTAATATTACTATTCCTACCATTCTCATTTTGCAG

[0865] ATGAGGGAAACCGAGGCACAGAGAAGCTAAAGAAATTGCCCAATATC

[0866] CTATAGCTAAAAAGTAGTGTTGGGAGGCCAGGCACAGTGGCTCACGC

[0867] CTGTAATCCCAGCAACACTTTGGGAGGCTGAGGCAGGAGCATCACTT

[0868] GAGCCCAGGAGATTGAGGCTGCAGTGAGCTATGATTGTGCCACTGCA

[0869] CTGCAGCCTGGGCAACAGAGTGAGACCCTGCCTCAAAAAAAAAAAAG

[0870] GAAAAAAAAAAAAAAAAAAAGTAGCCCTCGGCATATAGCAGGCACT

[0871] CAATAAGAATTGAATGCATTCTTGCCTTCCCTGAGATTCTCCCTTCCGT

[0872] TCCTCCCCACCCCTAATGCCTCAGGCCCACCGTTTCCATGGTCGAAGG

[0873] TCAGGGCGAGAAGAACGTGACCTTCTGGGGGAGACCGCTGCCACGGT

[0874] GTGAGGAGCTACAAGGGCAGAAGCTGGTGGTGGAGGAGAAACGACC

[0875] ATGTCTACACGTGCCTGCTTGCAAAGACCCTGAGGAAGAGGAACTCT

[0876] AACACTTCTCTCCTCCACTCTGAGCCCCCTGACCTTCCAAACCTCAATA

[0877] AACTAGCCTCTTCGAGTTCGTCTACGATTCCTTAAAGGAGGAAAAACA

[0878] ACCTATCCCCTTCCCCAAAAGTAGGGTGATAGCATCTCATAGGGCAAA

[0879] CAGCACAGCACGGGCCAAGACACAGCAGCCTGTTGCGGAAAACAGTA

[0880] TTTTCCACTGTGGTCGCAGGTTGGCAGGAGTGAAAGCGAGTGTGCAGT

[0881] CCCAGCCTCTCCCCGCCGCTGCCATAACCCCAATGTCTGGGCCCTGCG

[0882] CAGCCCCCTTAGAGCCTCAGGGCCGCCCGGCACGTTCCTCTGCAGAGC

[0883] TCCGCGTTACGGGTTTCCTGATTGGCTACTTGTCCTGGCAGGCACTTCT

[0884] TGATTGGCCGGCGTGCTTGTTCGTTGTCTCCCCGTCTCCTGGACCTCCC

[0885] TAGATTCCCACCAGCCGGAACCCTGGAGGAGCCTCTGCCGGCCGACTC

[0886] CGACTCCGCGTCAGTCGAGGATGAACGGCAGAGGCGTGGCCGAGGCT

[0887] GGCACCCTGCCGCCCGAGCACCTGCACCCACCCACTCCCGACAGCCC

[0888] AGCTCCAATGCCACAATTACCAGCGACAAATAGCTCGGCGAGGCGGG

[0889] GGGCGGGCCGAGGAAGTGCCTGTGTTGCGCTCTGAGCTGAGGAGGGG

[0890] CAAAGAAGCTAGAGTCAGTATCCGCCCGGAGGAGCCCCCAAGACAAA

[0891] TCCAGACACTTTCCTCTGGTAATTTGTTCATTCATTCAACACTTATTAG

[0892] CGCCTGCTGTATGCTAAAGCTGAGTCTGAGCATCTAGGGTGGAGGAG

[0893] GGCTGGTAGAAAGAGGACATCTGAGTGAGGGAACAGACTCAGAAGGT

[0894] ATTCCTTTCGTGTGAACATCTATTCAACACTTAACGCCTACTGTATACT

[0895] AACAATAGTGCTGGACATCACGGAGAATAGAGAAGAAGAGGAATCA

[0896] GAGCGTTACGTGTCTCCGCAGTAAAGGGAACAAAGCCAGACACCAGT

[0897] GCTTTAGCATTTGCTCATTCATTTACCACTTACTGAATGCCGGGCCCC

[0898] TTGTGAAGAGACGCATCATAAGAATCATAATAATCATGGTAATAGCTA

[0899] CTACTT

[0900] Compound Table

[0901] Helm annotation index:

[0902] [LR](G) is β-D-oxy-LNA guanosine [LR](T) is β-D-oxy-LNA thymidine [LR](A) is β-D-oxy-LNA adenine [LR]([5meC]) is β-D-oxy-LNA 5-methylcytidine [dR](G) is DNA guanosine [dR](T) is DNA thymidine [dR](A) is DNA adenine [dR](C) is DNA cytidine

[0903]

[0904]

[0905]

[0906]

[0907]

[0908]

[0909]

Claims

1. An antisense oligonucleotide, wherein the antisense oligonucleotide has a length of 8 to 40 nucleotides and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length, which is complementary to a transcribed human CFP-ELK1 intergenic region.

2. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

3. The antisense oligonucleotide according to claim 1 or claim 2, wherein the contiguous nucleotide sequence is the same length as the antisense oligonucleotide. 4 . The antisense oligonucleotide according to claim 1 , wherein the contiguous nucleotide sequence is at least 75% complementary to the transcribed human ELK1-CFP intergenic region.

5. The antisense oligonucleotide of claim 4, wherein the contiguous nucleotide sequence is at least 80%, at least 85%, at least 90% or at least 95% complementary to the transcribed human ELK1-CFP intergenic region. The antisense oligonucleotide according to claim 5 , wherein the contiguous nucleotide sequence is completely complementary to the transcribed human ELK1-CFP intergenic region. 7 . The antisense oligonucleotide according to claim 1 , wherein the transcribed human ELK1-CFP intergenic region comprises SEQ ID NO 1 or a fragment thereof.

8. The antisense oligonucleotide according to any one of claims 1 to 7, wherein the transcribed human ELK1-CFP intergenic region consists of SEQ ID NO 1 or a fragment thereof. 9 . The antisense oligonucleotide according to claim 1 , wherein the transcribed human ELK1-CFP intergenic region is SEQ ID NO 1 or a fragment thereof.

10. The antisense oligonucleotide of any one of claims 7 to 9, wherein the fragment is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length. 11 . The antisense oligonucleotide according to any one of claims 1 to 10 , wherein the transcribed human ELK1-CFP intergenic region is within a human ELK1-CFP pre-mRNA transcript.

12. The antisense oligonucleotide according to any one of claims 7 to 11, wherein the contiguous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO 95, SEQ ID NO 96, SEQ ID NO 97, SEQ ID NO 98, SEQ ID NO 99, SEQ ID NO 100, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 103, SEQ ID NO 104, SEQ ID NO 105, SEQ ID NO 106, SEQ ID NO 107, SEQ ID NO 108, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 111, SEQ ID NO 112, SEQ ID NO 113, SEQ ID NO 114, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122. SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134, SEQ ID NO 135. SEQ ID NO 136, SEQ ID NO 137, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149, SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153. SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 166, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 175, SEQ ID NO 176, SEQ ID NO 177, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 184, SEQ ID NO 185, SEQ ID NO 186 and SEQ ID NO 187.

13. The antisense oligonucleotide of claim 12, wherein the contiguous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO 98, SEQ ID NO 101, SEQ ID NO 102, SEQ ID NO 105, SEQ ID NO 107, SEQ ID NO 109, SEQ ID NO 110, SEQ ID NO 113, SEQ ID NO 115, SEQ ID NO 116, SEQ ID NO 117, SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 120, SEQ ID NO 121, SEQ ID NO 122, SEQ ID NO 123, SEQ ID NO 124, SEQ ID NO 125, SEQ ID NO 126, SEQ ID NO 127, SEQ ID NO 128, SEQ ID NO 129, SEQ ID NO 130, SEQ ID NO 131, SEQ ID NO 132, SEQ ID NO 133, SEQ ID NO 134. SEQ ID NO 135, SEQ ID NO 138, SEQ ID NO 139, SEQ ID NO 140, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 143, SEQ ID NO 144, SEQ ID NO 145, SEQ ID NO 146, SEQ ID NO 147, SEQ ID NO 148, SEQ ID NO 149. SEQ ID NO 150, SEQ ID NO 151, SEQ ID NO 152, SEQ ID NO 153, SEQ ID NO 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO 157, SEQ ID NO 158, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO 170, SEQ ID NO 171, SEQ ID NO 172, SEQ ID NO 173, SEQ ID NO 174, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 182, SEQ ID NOSEQ ID NO 183, SEQ ID NO 185, SEQ ID NO 186, and SEQ ID NO 187.

14. The antisense oligonucleotide of claim 13, wherein the contiguous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO 118, SEQ ID NO 119, SEQ ID NO 124, SEQ ID NO 126, SEQ ID NO 128, SEQ ID NO 132, SEQ ID NO 141, SEQ ID NO 142, SEQ ID NO 145, SEQ ID NO 154, SEQ ID NO 157, SEQ ID NO 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO 162, SEQ ID NO 163, SEQ ID NO 164, SEQ ID NO 165, SEQ ID NO 168, SEQ ID NO 169, and SEQ ID NO 172, or a fragment thereof.

15. The antisense oligonucleotide of any one of claims 12 to 14, wherein the fragment is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

16. The antisense oligonucleotide according to any one of claims 1 to 15, wherein the antisense oligonucleotide is single-stranded.

17. The antisense oligonucleotide according to any one of claims 1 to 16, wherein the contiguous nucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48. SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 75, SEQID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 82, SEQ ID NO 83, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 91, SEQ ID NO 92, SEQ ID NO 93 and SEQ ID NO 94.

18. The antisense oligonucleotide of claim 17, wherein the contiguous nucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NO 5, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 20, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41, SEQ ID NO 42, SEQ ID NO 45, SEQ ID NO 46, 46. ​​SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60. SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 76, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 79, SEQ ID NO 80, SEQ ID NO 81, SEQ ID NO 84, SEQ ID NO 85, SEQ ID NO 89, SEQ ID NO 90, SEQ ID NO 92, SEQ ID NO 93 and SEQ ID NO 94.

19. The antisense oligonucleotide of claim 18, wherein the contiguous nucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 31, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 39, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO52, SEQ ID NO 61, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 67, SEQ ID NO 68, SEQ ID NO 69, SEQ ID NO 70, SEQ ID NO 71, SEQ ID NO 72, SEQ ID NO 75, SEQ ID NO 76, and SEQ ID NO 79, or at least 10 contiguous nucleotides thereof.

20. The antisense oligonucleotide according to any one of claims 1 to 19, comprising one or more modified nucleosides.

21. The antisense oligonucleotide of claim 20, wherein the one or more modified nucleosides are independently selected from 2'-O-methyl-RNA and LNA nucleosides.

22. An antisense oligonucleotide according to claim 20 or claim 21, wherein the antisense oligonucleotide comprises any number of LNAs at the 5' end.

23. An antisense oligonucleotide according to claim 20 or claim 21, wherein the antisense oligonucleotide comprises any number of LNAs at the 3' end.

24. An antisense oligonucleotide according to claim 20 or claim 21, wherein the antisense oligonucleotide comprises an arbitrary number of LNAs at the 5' end and an arbitrary number of LNAs at the 3' end.

25. The antisense oligonucleotide according to any one of claims 1 to 24, wherein the antisense oligonucleotide is capable of recruiting RNase H1.

26. The antisense oligonucleotide according to any one of claims 1 to 25, wherein the antisense oligonucleotide is a gapmer.

27. The antisense-oligonucleotide of any one of claims 1 to 26, wherein the antisense-oligonucleotide comprises at least one modified internucleoside linkage.

28. The antisense oligonucleotide of any one of claims 1 to 27, wherein one or more or all of the modified internucleoside linkages comprise phosphorothioate linkages.

29. The antisense oligonucleotide of claim 28, wherein all of the internucleoside linkages present in the antisense oligonucleotide are phosphorothioate internucleoside linkages.

30. The antisense oligonucleotide of any one of claims 1 to 29, wherein the antisense oligonucleotide is capable of reducing the level of ELK1-CFP pre-mRNA transcript in a cell by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to a control.

31. The antisense oligonucleotide of claim 30, wherein the control is a cell that has not been exposed to the antisense oligonucleotide.

32. The antisense oligonucleotide of any one of claims 1 to 31, wherein the antisense oligonucleotide is covalently attached to at least one conjugate moiety.

33. The antisense oligonucleotide according to any one of claims 1 to 32, wherein the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.

34. The antisense oligonucleotide of claim 33, wherein the salt is a sodium salt or a potassium salt.

35. The antisense oligonucleotide of any one of claims 1 to 34, wherein the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

36. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 35 and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant.

37. The pharmaceutical composition of claim 36, wherein the pharmaceutical composition comprises an aqueous diluent or solvent, such as phosphate buffered saline.

38. An in vivo or in vitro method for reducing the level of ELK1-CFP pre-mRNA transcript in a target cell, the method comprising exposing the cell to an effective amount of an antisense oligonucleotide according to any one of claims 1 to 31 or a pharmaceutical composition according to claim 36 or claim 37.

39. The method of claim 37, wherein the cell is a human cell or a mammalian cell.

40. The method of claim 38 or claim 39, wherein the level of human ELK1-CFP pre-mRNA transcript is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to a control.

41. The method of claim 40, wherein the control is a cell that has not been exposed to the antisense oligonucleotide.

42. A method for treating or preventing a disease, the method comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to claim 36 or claim 37 to a subject suffering from or susceptible to the disease.

43. The antisense oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to claim 36 or claim 37, for use as a medicament for treating or preventing a disease in a subject.

44. Use of an antisense oligonucleotide according to any one of claims 1 to 35 or a pharmaceutical composition according to claim 36 or claim 37 for the preparation of a medicament for treating or preventing a disease in a subject.

45. The method according to claim 42, the antisense oligonucleotide for use or the pharmaceutical composition according to claim 43 or the use according to claim 44, wherein the disease is associated with increased levels of human ELK1-CFP pre-mRNA transcripts.

46. ​​The method of claim 42, the antisense oligonucleotide for use or the pharmaceutical composition of claim 44, or the use of claim 45, wherein the disease is amyotrophic lateral sclerosis (ALS).

Images