Use of sodium butyrate in the preparation of a drug for preventing and treating grass carp hemorrhagic disease

Abstract

The application discloses application of sodium butyrate in preparation of a medicine for preventing and treating grass carp hemorrhagic disease, wherein a structural formula of the sodium butyate is molecular formula C4H7NaO2, and a CAS number is 156-54-7; and the application further provides a medicine composition which comprises an effective dose of the sodium butyrate as an active ingredient, and further comprises a pharmaceutically acceptable carrier or excipient, and the dosage form comprises tablets, granules, powders, powders, suspensions, oral liquids, and the concentration of the sodium butyrate is 0.1-20 mM. Through a cell experiment, it is found that the sodium butyrate can significantly inhibit replication of grass carp reovirus in grass carp kidney cells, and improve expression of immune genes of the grass carp kidney cells, and it is proved that the sodium butyrate has a high efficient inhibiting effect on infection of the grass carp reovirus, and has the advantages of high safety and wide application prospect for preparing the medicine for preventing and treating the grass carp hemorrhagic disease caused by the grass carp reovirus.

Description

Technical Field

[0001] The invention belongs to the technical field of aquaculture and virus prevention and control, relates to the application of sodium butyrate as an antiviral drug for aquatic animals, and particularly relates to the application of sodium butyrate in preparing a drug for preventing and treating grass carp hemorrhagic disease. Background Art

[0002] Currently, grass carp accounts for approximately 20% of my country's total freshwater aquaculture production and is a key species in my country's bulk freshwater fish farming. Its excellent growth performance and high economic value, however, are subject to significant economic losses from viral disease outbreaks. Grass carp hemorrhagic disease, primarily caused by the grass carp reovirus, causes high mortality rates and rapid spread, resulting in significant economic losses for my country's aquaculture industry and severely impacting its development. Furthermore, effective prevention and control measures for grass carp hemorrhagic disease, such as safe and effective drugs and vaccines, are lacking. Therefore, there is an urgent need for the development of a broad-spectrum, highly effective, safe, pollution-free, and low-cost anti-grass carp reovirus drug.

[0003] Sodium butyrate is a short-chain fatty acid and a deacetylase inhibitor, inhibiting the activity of acetylase. It is also a healthy, safe, growth-promoting, and low-cost aquaculture feed additive, offering advantages such as high safety, environmental friendliness, and low cost. However, there are currently no reports of sodium butyrate being used to prevent and treat grass carp hemorrhagic disease. Summary of the Invention

[0004] In order to solve the problems in the prior art of high incidence, rapid spread and lack of effective prevention and control measures of grass carp hemorrhagic disease in aquaculture, the present invention aims to provide the use of sodium butyrate in the preparation of a medicament for preventing and treating grass carp hemorrhagic disease.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides the use of sodium butyrate in the preparation of a drug for preventing and treating grass carp hemorrhagic disease, wherein the structural formula of sodium butyrate is The molecular formula is C4H7NaO2 and the CAS number is 156-54-7.

[0007] The present invention also provides a pharmaceutical composition for preventing and treating grass carp hemorrhagic disease, which comprises an effective dose of sodium butyrate as an active ingredient, and the structural formula of sodium butyrate is The molecular formula is C4H7NaO2 and the CAS number is 156-54-7.

[0008] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient, and the dosage forms include tablets, granules, powders, granules, suspensions, and oral solutions.

[0009] Preferably, the concentration of sodium butyrate is 0.1-20 mM.

[0010] More preferably, the concentration of sodium butyrate is 0.5-10 mM.

[0011] Preferably, the sodium butyrate is in powder form, the mother liquor is first dissolved with PBS and then filtered through a 0.22 μm filter membrane, and the filtrate is frozen at -80°C for later use.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] Aiming at the problem that viral disease outbreaks during grass carp breeding cause grass carp deaths and economic losses but there is still a lack of effective prevention and treatment methods, the present invention finds through cell experiments that sodium butyrate can effectively inhibit the replication of grass carp reovirus in grass carp kidney cells and increase the expression of immune genes. That is, sodium butyrate can effectively resist grass carp reovirus infection, increase immune gene expression, and inhibit the proliferation of grass carp reovirus, thereby achieving the effect of resisting grass carp reovirus. The preparation of a drug for preventing and treating grass carp hemorrhagic disease caused by grass carp reovirus has the advantages of high safety and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The cell viability of CIK cells was detected 30 hours after adding different concentrations of sodium butyrate to the culture medium in the example; among them: (a) 0 mM; (b) 0.5 mM; (c) 1 mM; (d) 2.5 mM; (e) 5 mM; (f) 10 mM.

[0015] Figure 2 This is the viral replication level in cells infected with grass carp reovirus after sodium butyrate was added to the culture medium in the example.

[0016] Figure 3 The expression of CIK cell immune genes was detected after sodium butyrate was added to the culture medium in the examples. DETAILED DESCRIPTION

[0017] The technical solutions of the present invention are further illustrated below by way of examples. It is apparent that the described examples are only a portion of the embodiments of the present invention, rather than all of them. All other implementations derived by those skilled in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.

[0018] Example 1

[0019] This example verifies the inhibitory effect of sodium butyrate on grass carp reovirus infection through cell experiments. The specific steps are as follows:

[0020] 1. Cell recovery and viral infection

[0021] The frozen CIK cells were taken out of liquid nitrogen, thawed quickly, centrifuged and the supernatant removed, resuspended in fresh sterile M199 culture medium containing 10% fetal bovine serum, and cultured in a 27°C incubator. The revived cells were passaged to the third generation and then spread into six-well plates. The next day, they were pretreated with different concentrations of sodium butyrate for 4 hours, and after adding GCRV virus, they were placed in a 25°C incubator for infection. The virus was adsorbed for 1 hour, the supernatant was removed and washed three times with PBS, and then the drug culture medium with the same original concentration was added. The plates were cultured at 25°C for 24 hours, and the supernatant and cell samples were collected using Trizol.

[0022] 2. Cell viability test

[0023] Using the MuseTM Count and Viability Kit (Millipore), when CIK cells grew to 90%, the cell culture medium was replaced with maintenance medium containing different concentrations of sodium butyrate. The cells were returned to the incubator at 27°C and cultured for 30 hours. Samples were then taken for analysis. A cell viability value exceeding 90% indicated that the test drug was non-toxic.

[0024] 3. Immune gene testing

[0025] When the CIK cells grew to 90%, the cell culture medium was replaced with a maintenance medium containing sodium butyrate, and the cells were returned to the incubator at 27°C for 24 hours before sampling and analysis.

[0026] 4. RNA Extraction

[0027] (1) Add 100 μL of chloroform to every 0.5 mL of sample, mix thoroughly, and let stand for 5 minutes;

[0028] (2) Centrifugation at 12,000 rpm for 15 minutes at 4°C;

[0029] (3) Take the upper liquid and mix it thoroughly with pre-cooled isopropyl alcohol in a 1:1 ratio and let it stand for 10 minutes;

[0030] (4) Centrifugation at 12,000 rpm for 10 minutes at 4°C;

[0031] (5) Remove the supernatant and wash the precipitate with 75% enzyme-free ethanol;

[0032] (6) Centrifugation at 12,000 rpm for 10 minutes at 4°C;

[0033] (7) Completely remove the supernatant and open the lid to dry thoroughly;

[0034] (8) Dissolve the precipitate in DEPC water and measure the concentration.

[0035] 5. Reverse transcription

[0036] (1) Ice preparation of reaction solution, system as shown in Table 1:

[0037] Table 1

[0038] Reagents Usage Oligo dT Primer 1 μL dNTP Mixture 1 μL RNA 2 μg <![CDATA[RNase free dH2O]]> Fill to 10 μL

[0039] (2) 65℃ reaction for 5min, placed on ice cooling.

[0040] (3) Preparation of reaction solution, system as shown in Table 2:

[0041] Table 2

[0042]

[0043]

[0044] (4) After mixing, centrifugation, 30℃ incubation for 10min, 42℃ incubation for 60min, 95℃ incubation for 5min, finally placed on ice cooling.

[0045] 6, Fluorescence quantitative detection of mRNA expression level of target gene

[0046] (1) Fluorescence quantitative primer:

[0047] GCRV-JX01-vp7F: CAAGACCATTCAAGACTC

[0048] GCRV-JX01-vp7R: TCACTCACTTCGACTAAT

[0049] GCRV-JX01-NS31 F: ACCCCTCTGACGACACCC

[0050] GCRV-JX01-NS31 R: GAGCCTGAAGCCAGCACA

[0051] Gc-IFN1 F: GTCAATGCTCTGCTTGCGAAT

[0052] Gc-IFN1 R: CAAGAAACTTCACCTGGTCCT

[0053] Gc-ISG15 F: GTCTGTCACCTCTTCATGCA

[0054] Gc-ISG15R: CAGGAGAGCAGAAATCACAC

[0055] Gc-IRF11 F: AAGCAGTGCTGAAGATTGTGGA

[0056] Gc-IRF11 R:GTAACCTGAAGATTCCATCGTC

[0057] Gc-IRF7F: CGCCTGTGTTCGTCACTCGT

[0058] Gc-IRF7R: GGTGGTTGGAAAGCGTATTGG

[0059] Gc-STAT1 b F: ATGAGCACTACAGCCGTCTCA

[0060] Gc-STAT1 bR:CTTGAAGTCGTATTCGTCTTGC

[0061] Gc-TNFαF: AAGTCATAGGTCGAGGTCAGGG

[0062] Gc-TNFαR:CGTTTTTCACCTTCAATTAGCAGA

[0063] Gc-β-actin F: GGATGAAATTGCCGCACTGG

[0064] Gc-β-actin-R: ACCGACCATGACGCCCTGATGT

[0065] (2) Fluorescence Quantification The reaction system was prepared according to the ratio shown in Table 3. The reaction system was 25 μL:

[0066] Table 3

[0067] SYBR Premix Ex Taq 12.5μL Upstream primer 0.5μL Downstream primer 0.5μL cDNA 2μL <![CDATA[ddH2O]]> 9.5 μL

[0068] (3) After the quantitative PCR program was completed, the data were processed and the significant differences were analyzed using Graphpad Prism software.

[0069] like Figure 1 As shown, after adding sodium butyrate at concentrations of 0 mM, 0.5 mM, 1 mM, 2.5 mM, 5 mM, and 10 mM to the culture medium, the cell viability of CIK was detected 30 hours later, and it was found that the cell activity was above 90%, indicating that sodium butyrate was safe and non-toxic.

[0070] like Figure 2 As shown, 0.5-10 mM sodium butyrate treatment can significantly inhibit the replication of GCRV-JX01 in CIK cells.

[0071] like Figure 3 As shown, the expression of immune genes in CIK cells was detected after adding sodium butyrate, and it was found that sodium butyrate treatment could significantly increase the expression of immune genes.

[0072] In summary, the present invention discovered for the first time through cell experiments that sodium butyrate can inhibit grass carp reovirus and has a good anti-GCRV virus effect. Because of its low raw material cost, friendly to fish growth, green and safe, and low environmental pollution, it meets the current aquaculture industry's demand for green fish medicine.

[0073] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. The use of sodium butyrate in the preparation of a drug for resisting grass carp reovirus, characterized in that: The structural formula of sodium butyrate is , molecular formula is C4H7NaO2, CAS number is 156-54-7.

Images