Method for regulating circadian rhythm

Abstract

The present invention finds the effect of ATXN2 and / or ATXN2L in circadian rhythm. Thus, the present invention provides methods, medicaments and uses for modulating circadian rhythm in a subject. Meanwhile, the invention further provides a method for detecting the circadian rhythm of a subject and a biomarker capable of indicating circadian rhythm abnormity. The invention provides a brand new way and means for adjusting the circadian rhythm.

Description

Technical Field

[0001] The invention relates to a method for regulating circadian rhythm, to the diagnosis and treatment of circadian rhythm-related diseases, and belongs to the field of biology. Background Art

[0002] Organisms exhibit self-sustaining circadian rhythms of approximately 24 hours due to the Earth's rotation. Many important behavioral and physiological functions respond to circadian cycles, such as sleep and wakefulness, body temperature, and blood pressure. In humans and most mammals, circadian rhythms are usually controlled by a hierarchical network of central and peripheral pacemakers, among which the suprachiasmatic nucleus (SCN) located in the anterior hypothalamus is the brain's master circadian clock controller. The SCN entrains external time and transmits clock information to downstream peripheral controllers in other brain areas or peripheral tissues, such as the heart, liver, lungs, and kidneys.

[0003] At the molecular level, a group of "clock genes" regulate rhythms through positive and negative "transcription-translation feedback loops" (TTFL). The negative TTFL in mammals consists of the activators CLOCK and BMAL1, which bind to the e-box and activate the transcription of the repressor proteins Period (encoded by PER1 / 2 / 3) and Cryptochrome (CRY1 / 2). PER and CRY proteins heterodimerize and translocate back to the nucleus to repress their own transcription by removing the CLOCK-BMAL1 complex. Sequential events in the TTFL, including transcription, mRNA processing, and translation, occur in a circadian manner to maintain a precise 24-hour periodicity for many genes. However, major questions about how these rhythmic processes are coordinated in time and space remain unanswered.

[0004] In eukaryotic cells, complex biochemical reactions are cleverly compartmentalized to facilitate precise spatiotemporal control. This compartmentalization can be achieved by typical membrane-bound organelles, such as mitochondria and endoplasmic reticulum, as well as membrane-less organelles (MLOs). MLOs are dense macromolecular assemblies that undergo phase separation and mediate many subcellular biological processes by enriching specific biomolecules and excluding other molecules.

[0005] Here, we reveal the role of phase separation mediated by ATXN2 and ATXN2L in regulating oscillatory translation in circadian rhythms, and the role and impact of abnormal polyQ expansion of ATXN2 protein on circadian rhythms in neurodegenerative diseases. As an RNA-binding protein, ATXN2 is a well-established multifunctional regulator of post-transcriptional processes. In this study, we show that phase-separated condensates of RNA-binding proteins ATXN2 and ATXN2L coordinate spatiotemporally to rhythmically recruit translation machinery and specific sets of mRNA transcripts, allowing selective and temporal translational activation of core clock genes, thereby serving as a master regulator of rhythmic translation in mammals. Summary of the invention

[0006] The inventors surprisingly found that proteins containing LCD domains (such as clock gene proteins containing LCD domains) play an important role in circadian rhythm regulation.

[0007] Thus, on the one hand, the present invention provides a method for regulating circadian rhythm, comprising the step of regulating the expression and / or function of a protein comprising an LCD domain to regulate the circadian rhythm. Preferably, in some embodiments, regulating the function of a protein comprising an LCD domain is regulating the function of the LCD domain-mediated phase separation. More preferably, in some embodiments, regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain. In some embodiments, the LCD domain-mediated phase separation is regulated by up-regulating or down-regulating the expression of a protein comprising an LCD domain. In some embodiments, a protein comprising an LCD domain is modified, and the modification may be a mutation, truncation, deletion or replacement of a non-LCD domain of the protein.

[0008] In addition, ATXN2 and ATXN2L proteins play an important role in the regulation of circadian rhythms, and by regulating the expression or function of the two proteins, the circadian rhythms of cells or organisms can be accelerated or delayed, which can be used to regulate circadian rhythms in subjects in need (such as subjects who need to work shifts or jet lag), and can also be used to prevent or treat related diseases caused by circadian rhythm disorders. Furthermore, the inventors have also found that the expression levels of ATXN2 and ATXN2L can reflect the circadian rhythm status of the subject (such as whether it is abnormal), and the circadian rhythm status of the subject can be determined by detecting the expression of ATXN2 and ATXN2L. In addition, the inventors also discovered for the first time that the phenomenon of phase separation is closely related to the regulation of circadian rhythms, and that the circadian rhythm can be affected and regulated by regulating phase separation.

[0009] Thus, in one aspect, the present invention provides a method for regulating circadian rhythm, comprising the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate circadian rhythm. In some embodiments, the expression and / or function of ATXN2 and / or ATXN2L is regulated by regulating the transcription, translation, post-translational modification, protein degradation, etc. of ATXN2 and / or ATXN2L. In some embodiments, the expression and / or function of ATXN2 and / or ATXN2L is regulated by regulating the genes related to the upstream and downstream signaling pathways of ATXN2 and / or ATXN2L.

[0010] In some embodiments, the circadian rhythm is accelerated by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L. In some embodiments, the circadian rhythm is delayed by downregulating the expression of ATXN2L or upregulating the expression of ATXN2. In some embodiments, downregulating the expression of ATXN2 or downregulating the expression of ATXN2L is achieved by siRNA knockdown or CRISPR knockout. In some embodiments, upregulating the expression of ATXN2 or upregulating the expression of ATXN2L is achieved by expressing a gene in a cell through an expression vector or activating the transcription of a gene through CRISPR. In some embodiments, the expression vector is an AAV vector or a pLVX vector.

[0011] In some embodiments, the circadian rhythm is accelerated by inactivating the function of ATXN2 or enhancing the function of ATXN2L. In some embodiments, the circadian rhythm is delayed by inactivating the function of ATXN2L or enhancing the function of ATXN2. In some embodiments, the function of ATXN2 or the function of ATXN2L is its function of forming phase separation in the cell. In some embodiments, the function of inactivating ATXN2 or the function of inactivating ATXN2L is achieved by siRNA knockdown or CRISPR knockout.

[0012] In some embodiments, the expression of ATXN2 and ATXN2L is simultaneously upregulated to strengthen the circadian rhythm. In some embodiments, the expression of ATXN2 and ATXN2L is simultaneously downregulated to weaken the circadian rhythm.

[0013] In some embodiments, the expression of ATXN2 or ATXN2L is downregulated using an inhibitory nucleic acid targeting ATXN2 or ATXN2L. In some embodiments, preferably, the inhibitory nucleic acid targeting ATXN2 or ATXN2L is an antisense oligonucleotide (ASO) or an RNA interfering agent. Preferably, in some embodiments, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

[0014] In some embodiments, the expression of ATXN2 or ATXN2L is upregulated using an expression vector comprising an encoding ATXN2 and / or ATXN2L. In some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication-deficient. Preferably, in some embodiments, the expression vector is an AAV vector. In some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, AAV9.

[0015] In some embodiments, a CRISPR composition is used to upregulate or downregulate the expression of ATXN2 or ATXN2L. In some embodiments, the CRISPR composition comprises a Cas nuclease and a gRNA, optionally, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9) or 5'-CCCCGGATCTTAAAGGAGGA-3' (SEQ ID NO: 10).

[0016] In another aspect, the present invention provides one or more modulators or combinations of modulators for regulating ATXN2 and / or ATXN2L for use in the preparation of a medicament. In some embodiments, for the preparation of a medicament for preventing or treating a circadian rhythm-related disease. In some embodiments, for the preparation of a medicament for preventing or treating a disease associated with ATXN2 and / or ATXN2L gene disorders. In some embodiments, for the preparation of a medicament for regulating the circadian rhythm of a subject in need thereof. In some embodiments, for the preparation of a medicament for regulating phase separation.

[0017] In another aspect, the present invention provides a method comprising administering to a subject one or more modulators or combinations of modulators for regulating ATXN2 and / or ATXN2L. In some embodiments, the method is used to prevent or treat circadian rhythm-related diseases. In some embodiments, the method is used to prevent or treat ATXN2 and / or ATXN2L gene disorder-related diseases. In some embodiments, the method is used to regulate the circadian rhythm of a subject in need. In some embodiments, the method is used to regulate phase separation.

[0018] In some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain. Preferably, in some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders.

[0019] In some embodiments, the regulator for regulating ATXN2 and / or ATXN2L is an expression vector comprising an encoding ATXN2 and / or ATXN2L, which is used to upregulate the expression of ATXN2 and / or ATXN2L. In some embodiments, the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication-deficient. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12. Preferably, in some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, AAV9.

[0020] In some embodiments, the modulator for regulating ATXN2 and / or ATXN2L is an inhibitory nucleic acid targeting ATXN2 or ATXN2L. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

[0021] In some embodiments, the inhibitory nucleic acid targeting ATXN2 is siRNA, preferably, the sense strand of the siRNA is CCAGUUAGCAGAAGAAAUUTT (SEQ ID NO: 11), and the antisense strand of the siRNA is AAUUUCUUCUGCUAACUGGTT (SEQ ID NO: 12). In some embodiments, the inhibitory nucleic acid targeting ATXN2 is siRNA, preferably, the sense strand of the siRNA is GCAAGUGAAACAUCACCUATT (SEQ ID NO: 13), and the antisense strand of the siRNA is UAGGUGAUGUUUCACUUGCTT (SEQ ID NO: 14).

[0022] In some embodiments, the inhibitory nucleic acid is shRNA. Preferably, in some embodiments, the shRNA sequence targeting ATXN2 is CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTCGTTT TTG (SEQ ID NO: 15), CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTT TTG (SEQ ID NO: 16), CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTT TTG (SEQ ID NO: 17), CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTT TTG (SEQ ID NO: 18), or CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTT TTG (SEQ ID NO: 19). Preferably, in some embodiments, the shRNA sequence targeting ATXN2L is CCGGCCTCCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTT TTG (SEQ ID NO: 20), CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTT TTG (SEQ ID NO: 21), CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTT TTG (SEQ ID NO: 22), CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTT TTG (SEQ ID NO: 23), or CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTT TTG (SEQ ID NO: 24).

[0023] In some embodiments, the modulator for regulating ATXN2 and / or ATXN2L is a CRISPR composition. In some embodiments, the CRISPR composition comprises a Cas nuclease and a gRNA, wherein the gRNA targets ATXN2 and / or ATXN2L. In some embodiments, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' or 5'-GTATTGGAAATACCCCCAGT-3'. In some embodiments, the Cas enzyme is a dCas enzyme, such as dCas9. In some embodiments, the gRNA targets the promoter region of ATXN2 and / or ATXN2L.

[0024] The methods for regulating circadian rhythm provided by the present invention can be used for therapeutic or non-therapeutic purposes.

[0025] In another aspect, the present invention provides a biomarker combination for detecting circadian rhythm of a subject, comprising ATXN2 and / or ATXN2L. Preferably, in some embodiments, the biomarker combination consists of ATXN2 and / or ATXN2L.

[0026] In another aspect, the present invention also provides a reagent combination for detecting the biomarker combination of the present invention. In some embodiments, the reagent combination includes reagents for detecting the gene markers, such as primers, probes, antibodies, and optionally enzymes such as PCR enzymes, buffers, and product instructions.

[0027] In another aspect, the present invention also provides use of a reagent combination for detecting the biomarker combination of the present invention in preparing a reagent for detecting the circadian rhythm of a subject.

[0028] On the other hand, the present invention also provides a method for detecting the circadian rhythm of a subject, which comprises the following steps: determining the expression level of the aforementioned biomarker combination of the subject, preferably, in some embodiments, using the reagent combination of the present invention to determine the expression level; comparing the measured expression level with a reference level; determining the state of the circadian rhythm of the subject.

[0029] In some embodiments, the abnormal state of circadian rhythm can be used to diagnose circadian rhythm disorder or circadian rhythm-related disease.

[0030] On the other hand, the present invention also provides a cell model, which lacks ATXN2 and / or ATXN2L genes. Preferably, in some embodiments, the cell is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a Hela cell.

[0031] In another aspect, the present invention also provides an animal model, which lacks ATXN2 and / or ATXN2L genes. In some embodiments, preferably, the animal model is a mammal model, more preferably a rodent model, and most preferably a mouse model.

[0032] In some embodiments, the present invention also provides use of the cell model or animal model of the present invention in screening drugs for treating or preventing circadian rhythm-related diseases.

[0033] On the other hand, the present invention also provides an expression vector comprising a nucleic acid sequence encoding ATXN2 and ATXN2L or a nucleic acid sequence encoding the LCD domain of ATXN2 and ATXN2L. Preferably, in some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication-deficient. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, AAV9.

[0034] On the other hand, the present invention also provides an expression vector combination, which comprises a first expression vector and a second expression vector, wherein the first expression vector comprises a nucleic acid sequence encoding ATXN2 or a nucleic acid sequence encoding the LCD domain of ATXN2; the second expression vector comprises a nucleic acid sequence encoding ATXN2L or a nucleic acid sequence encoding the LCD domain of ATXN2L. Preferably, in some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication-deficient. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0035] On the other hand, the present invention also provides an inhibitory nucleic acid combination, which comprises a first inhibitory nucleic acid and a second inhibitory nucleic acid, wherein the first inhibitory nucleic acid targets ATXN2; the second inhibitory nucleic acid targets ATXN2L. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

[0036] On the other hand, the present invention also provides a CRISPR composition comprising a Cas enzyme, a first gRNA and a second gRNA, wherein the first gRNA targets ATXN2; the second gRNA targets ATXN2L. In some embodiments, the Cas enzyme is Cas9. In some embodiments, the first gRNA is 5'-GTATTGGAAATACCCCCAGT-3'; the second gRNA is 5'-GTATTGGAAATACCCCCAGT-3'.

[0037] In another aspect, the present invention also provides a composition comprising the expression vector, expression vector combination, inhibitory nucleic acid combination or CRISPR composition of the present invention, and a pharmaceutically acceptable carrier.

[0038] In some embodiments, the expression and / or protein function of ATXN2 and / or ATXN2L are regulated using the regulator or regulator combination of the present invention. In some embodiments, the regulator or regulator combination of the present invention may be an antibody, a compound, a small molecule compound, a fusion protein, a cytokine, etc. In some embodiments, the regulator or regulator combination of the present invention may be used to regulate the expression and / or function of ATXN2 and / or ATXN2L. In some embodiments, the regulator or regulator combination of the present invention may regulate the expression and / or function of ATXN2 and / or ATXN2L by regulating the transcription, translation, post-translational modification, protein degradation, etc. of ATXN2 and / or ATXN2L. In some embodiments, the regulator or regulator combination of the present invention may regulate the expression and / or function of ATXN2 and / or ATXN2L by regulating the relevant genes of the upstream and downstream signaling pathways of ATXN2 and / or ATXN2L.

[0039] In some embodiments, the modulator or combination of modulators of the present invention comprises the expression vector, the combination of expression vectors, the combination of inhibitory nucleic acids, the CRISPR composition or the composition. Preferably, in some embodiments, the modulator or combination of modulators of the present invention is the expression vector, the combination of expression vectors, the combination of inhibitory nucleic acids, the CRISPR composition or the composition.

[0040] In another aspect, the present invention also provides a method for regulating circadian rhythm, comprising the step of regulating phase separation.

[0041] In some embodiments, regulating the phase separation comprises regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm. In some embodiments, regulating the expression of ATXN2 and / or ATXN2L is up-regulating or down-regulating the expression of ATXN2 and / or ATXN2L. In some embodiments, regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

[0042] In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: increasing phase separation by up-regulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their functions. In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: reducing phase separation by down-regulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their functions. In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: increasing phase separation by up-regulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their functions, and reducing phase separation by down-regulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their functions.

[0043] In one aspect, the present invention also provides a method for treating a disease, comprising the step of regulating phase separation; the disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, drowsiness, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain.

[0044] In some embodiments, phase separation is regulated by regulating the expression and / or function of a protein comprising an LCD domain, preferably regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain.

[0045] In some embodiments, LCD domain-mediated phase separation is modulated by upregulating or downregulating expression of a protein comprising an LCD domain.

[0046] In one aspect, the present invention also provides use of an agent for detecting ATXN2 in the preparation of a detection agent for detecting circadian rhythm abnormalities and / or neurodegenerative diseases; optionally, when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, it is determined that the subject has an abnormal circadian rhythm and / or suffers from a neurodegenerative disease.

[0047] In one aspect, the present invention also provides a method for detecting whether a subject has an abnormal circadian rhythm and / or a neurodegenerative disease, comprising the step of detecting the protein sequence of ATXN2 in the subject, wherein when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, it is determined that the subject has an abnormal circadian rhythm and / or suffers from a neurodegenerative disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The present invention is described below with reference to the accompanying drawings only by way of example. It should be emphasized that the details shown are only exemplary and illustrative representations of preferred embodiments of the present invention, to describe the principles and concepts of the present invention. It is easy for a person skilled in the art to know how to practice in various forms of the present invention with reference to the accompanying drawings.

[0049] Figure 1 Protein synthesis oscillates along a circadian cycle and is regulated by ATXN2 and ATXN2L.

[0050] (A) HPG fluorescence staining results show protein synthesis activity at the indicated time points. U2OS cells were synchronized and pulse-labeled with HPG for 30 min, fixed, and subjected to Click-iTHPG reaction using Alexa-fluor488-azide. Scale bar = 20 μm.

[0051] (B) Corresponding quantitative analysis of the mean HPG fluorescence intensity in (A). Values ​​represented are mean ± SD (n = 4).

[0052] (C) Polysome fractionation curves of U2OS cells, cells were collected at 4 h intervals over 48 h after synchronization. Peaks corresponding to 40S, 60S, and 80S are indicated by arrows, and polysome markers are at the top.

[0053] (D) Quantification of polysome fraction distribution in (C) and (K) using the translation index. The translation index is defined as the ratio of the total area under the curve for heavy polysomes (more than 5+ ribosomes) and light polysomes (2-4 ribosomes), as Figure 7 Details are given in C.

[0054] (E and F) Polysome profiles of mouse brain (E) and liver (F) tissues collected at ZT 4, 8, 12, 16, 20, and 24 h.

[0055] (G) Western blotting of newly synthesized peptides labeled with puromycin in liver tissues of mice at different ages.

[0056] (H) Expression patterns of proteins in group 3 detected by mass spectrometry at different time points. The seven groups of genes were clustered according to their different temporal expression patterns using the fuzzy c-means clustering algorithm. Group 3 is shown here, and the others are shown in Figure 7 H. The blue lines represent the simulated curves for each group. The Y axis represents the normalized protein abundance.

[0057] (I) Scatter plot showing changes in protein levels in CT16 compared to CT4. The Y-axis shows the log2 fold change in CT16 relative to CT4, and the X-axis shows the log2 protein abundance at 16 h.

[0058] (J) Polysome profiles of cell lysates from CT12 WT (red), ATXN2 knockout (yellow), ATXN2L knockout (green), and ATXN2 / 2L double knockout (blue).

[0059] (K) Polysome profiles of ATXN2 / 2L double knockout cells collected for 48 hours. The corresponding quantitative analysis of translation index is represented in 1D.

[0060] (L) Representative images showing nascent protein synthesis at different time points using Click-iT HPGAlexa Fluor 488 protein synthesis assay in ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout U2OS cells.

[0061] (M) Corresponding quantitative analysis of mean HPG fluorescence intensity in (L). Values ​​represented are mean ± SD (n = 4).

[0062] Figure 2 Atxn2 / 2L condensates oscillate in sync with the circadian cycle

[0063] (A) Representative immunofluorescence images illustrate the expression of Atxn2 or Atxn2l (red) in the SCN (left) and liver (right). Nuclei are labeled with DAPI (blue) and Atxn2 or Atxn2l condensates are marked with white arrows. Scale bar = 5 μm.

[0064] (B) Representative transmission electron microscopy (TEM) images of Atxn2 immunogold labeling in mouse white adipose tissue (WAT). Lipid droplets are labeled as LDs, and black dots represent Atxn2 proteins detected by gold particles. White arrows point to the Atxn2 group. Scale bars are 1 μm, 600 nm, and 200 nm, respectively.

[0065] (C) Representative TEM images showing immunogold labeling of Atxn2l in mice. Black dots correspond to Atxn2l protein detected by 18 nm gold particles, and black arrows indicate Atxn2l groups. Scale bars are 600 nm and 200 nm, respectively.

[0066] (D and E) Phase diagrams of in vitro purified ATXN2 (G) or ATXN2L (H) LCD proteins. The corresponding protein and NaCl concentrations are indicated. Alexa-568 LCD labeled with ATXN2 is shown in red, and Alexa-488 LCD labeled with ATXN2L is shown in green. Scale bar = 20 μm.

[0067] (F) FRAP curves of ATXN2 and ATXN2L liquid-like droplets. Values ​​represent mean ± SD (n = 6).

[0068] (G) Representative immunofluorescence images showing the expression of ATXN2 (red) and ATXN2L (green) in U2OS cells. DAPI is shown in blue, and white arrows point to ATXN2 or ATXN2L condensates. Scale bar = 10 μm.

[0069] (H) Representative images showing the expression of ATXN2 (red) and ATXN2L (green) in U2OS cells at different circadian time points. DAPI is shown in blue. Scale bar = 2 μm.

[0070] (I) Shows the expression of Atxn2 and Atxn2l (red) in SCNs at different time periods (ZT). Scale bar = 2 μm.

[0071] (J and K) Western blot results showing protein abundance of ATXN2 and ATXN2L in U2OS cells (J) and hypothalamic samples (K) at the indicated time points during the circadian cycle. β-Tubulin was used as a control.

[0072] Figure 3 ATXN2 forms oscillating translation initiation condensates.

[0073] (A) Phase distribution diagram of rhythmic proteins in the corresponding input whole proteome and ATXN2 immunoprecipitated proteome.

[0074] (B) Gene Ontology (GO) analysis of proteins enriched in ATXN2 condensates. The top 10 GO biological process annotations are shown in a bar graph ranked from most enriched (top) to least enriched (bottom), with the horizontal axis representing the -log10p value corresponding to each GO type.

[0075] (C) Bubble plot showing the most enriched types of proteins in the GO biological process annotation of ATXN2 condensates at different time points. The size of the dot represents the number of proteins enriched in the term, and the color of the dot represents the -log 10 p-value.

[0076] (D) The ATXN2 interaction network is shown in the figure. The largest group contains 25 translation-related proteins, and the node size indicates the degree of connectivity.

[0077] (E) Heatmaps showing the enrichment of translation initiation factors (top) and ribosomal components (bottom) in ATXN2 condensates at different time points.

[0078] (F) Western blot of ATXN2 co-immunoprecipitated proteins at different time points as indicated above.

[0079] Figure 4 Atxn2 / 2L condensates recruit translation machinery and specific mRNAs.

[0080] (A) Multiphase-separated condensates recruit ribosomes in vitro. Phase-separated liquid droplets formed by LCDs of ATXN2, ATXN2L, FUS, and YTHDC1 are labeled in green. Purified ribosomes are labeled in red. Scale bar = 20 μm.

[0081] (B) Schematic diagram of the PER2 mRNA molecule, where the two AUUUU / A-rich sequences in the 3'UTR are highlighted in yellow and light green, respectively. The AUUUU / A motif is in red.

[0082] (C) ATXN2 condensates selectively recruit specific RNAs in vitro. ATXN2 LCD protein is shown in green, and RNAs including PER2 5'UTR, two AUUUU / A-enriched subregions of PER2 3'UTR, PER1 3'UTR, CRY1 3'UTR, CRY2 3'UTR, CLOCK 3'UTR, BMAL1 3'UTR, FAM199X 3'UTR, RRBP1 3'UTR, and WFS1 3'UTR are shown in red. Scale bar = 10 μm.

[0083] (D and F) FUSLCD (D) and all M-to-S mutants of ATXN2 (F) fail to recruit specific RNAs in vitro. Proteins are shown in green and RNAs are shown in red. Scale bar = 10 μm.

[0084] (E) Representative images showing the in vitro phase separation state of the Atxn2LCD wild type and all M-to-S mutants. Scale bar = 20 μm.

[0085] (G) Representative images showing colocalization of Per2 mRNA and Atxn2 protein in the SCN at different time points. Immunostaining of Atxn2 protein is shown in green, Per2 mRNA is shown in purple, and nuclei are labeled with DAPI (blue). White arrows indicate colocalized Atxn2 condensates and Per2 mRNA. Scale bar = 10 μm.

[0086] (H) Representative images showing colocalization of Per2 mRNA and Atxn2 protein condensates in hypothalamic GT1-7 cells. Immunostaining of Atxn2 protein is shown in green, Per2 mRNA is shown in red, and cell nuclei are labeled with DAPI (blue). White arrows indicate colocalized Atxn2 condensates and Per2 mRNA. Scale bars are 5 μm and 1 μm, respectively.

[0087] Figure 5 ATXN2 / 2L condensates activate PER2 translation in vitro and in vivo.

[0088] (A) Histogram of in vitro translation efficiency of proteins added to phase-separated ATXN2 LCD WT (ATXN2 WT, left) or all M-to-S mutants (ATXN2 MS, right), expressed as relative luciferase activity. Relative luciferase activity was quantified for luciferase control (grey), luciferase-PER2 3'UTR (red), luciferase-CRY1 3'UTR (yellow), luciferase-WFS1 3'UTR (green), and luciferase-RRBP1 3'UTR (blue). Relative luciferase activity was normalized by luciferase of the control group. Values ​​are shown as mean ± SD (n = 3, ****p < 0.00005 by t-test).

[0089] (B) Schematic diagram showing nascent polypeptides labeled with the SunTag system and protein synthesis complexes dissociated by addition of puromycin.

[0090] (C) U2OS cells co-expressing scFv-GFP and translation reporter gene (SunTag 24x Representative images of PER2-3UTR and mCherry-ATXN2 without (left) or with (right) puromycin-induced translation inhibition. White boxes indicate colocalization of nascent synthesized PER2 peptide (green) and mCherry-tagged ATXN2 protein (red). Scale bars are 5 μm and 2 μm, respectively.

[0091] (D) Representative images of EGFP-ATXN2 (top) and EGFP-ATXN2-ΔLCD3 (bottom) complemented in double knockout cells. 3D statistical graphs showing the grayscale values ​​of the corresponding images (right). Scale bars are 10 μm and 2 μm, respectively.

[0092] (E) Polysome fractionation curves of EGFP-ATXN2 (top) and EGFP-ATXN2-ΔLCD3 (bottom) complemented cells, collected at 4 h intervals for 24 h after synchronization. Peaks corresponding to 40S, 60S, and 80S are indicated by arrows, and polysome markers are at the top.

[0093] (F) Western blot results showing protein abundance of ATXN2, CRY1, CLOCK, PER2, and puromycin-tagged nascent proteins in wild-type U2OS cells (left) and EGFP-ATXN2 (middle) or EGFP-ATXN2-ΔLCD3 (right) rescued cells. Cells were collected at 4 h intervals for 48 h after synchronization. Puromycin was added to the culture medium half an hour before sample collection. β-Tubulin was used as a control.

[0094] (G) Representative rhythms of PER2::LUC bioluminescence in ATXN2 knockout, ATXN2L knockout, ATXN2 / 2L double knockout U2OS cells, and EGFP-ATXN2 and EGFP-ATXN2-ΔLCD3 complemented cells. The culture medium contained 100 mM luciferin for recording bioluminescence. The amplitude and cycle length of the bioluminescence rhythm are shown as mean ± SD (n = 3, ****p < 0.00005 by t-test).

[0095] Figure 6 ATXN2 and ATXN2L jointly regulate circadian rhythms in mice.

[0096] (A) Flowchart illustrating the Atxn2 and Atxn2l knockout strategy. Exons are represented as numbered boxes and Cas9 / sgRNA target sites are indicated by black arrows. Yellow triangles indicate two LoxP sites in Atxn2l conditional knockout mice.

[0097] (B)Atxn2l flx / flx Mice were injected bilaterally with AAV-hSyn-mCherry-IRES-Cre into the SCN and allowed to recover over 2 weeks.

[0098] (C) Representative activity graphs of wheel running activity in light-dark (LD) and dark-dark (DD) for WT, three single knockout mice Atxn2- / -, Vip-Atxn2l- / -, SCN-Atxn2l- / -, and Atxn2+ / -; SCN-Atxn2l+ / - compound heterozygous knockout mice, and Atxn2- / -; SCN-Atxn2l- / - compound homozygous knockout mice. Mice were housed in 12L:12D for 7 days and then transferred to continuous darkness for 14 days. White shading indicates lights on, while gray shading indicates lights off.

[0099] (D) Mean circadian free-running period (mean ± SD) was measured by chi-square periodograms in DD over 14 days in the same animals described in (C). The period of Atxn2- / - mutants was slightly prolonged to 23.95 ± 0.05 h (n = 6, p = 0.0655, t-test). The period length was significantly shortened in Vip-Atxn2l- / - (n = 12, p = 0.0476, t-test) and SCN-Atxn2l- / - (n = 6, p = 0.0192, t-test) mice.

[0100] (E) The average amplitude of locomotor activity rhythm was analyzed by fast Fourier transform (FFT) over 14 days in DD. The amplitude of Atxn2- / - mice was significantly reduced to 0.213 ± 0.086 (n = 6, p = 0.011, t-test). Compound heterozygous knockout mice (n = 8, p = 0.0089, t-test) and compound homozygous knockout mice (n = 4, p < 0.0001, t-test) mice showed more severe amplitude loss.

[0101] (F) Schematic model illustrating that in the transcription-translation feedback loop, ATXN2 and ATXN2L form oscillatory points along the circadian cycle and activate the translation of PER and CRY mRNAs by recruiting components of the translation machinery.

[0102] Figure 7 ATXN2 and ATXN2L work together to regulate rhythmic translation.

[0103] (A) HPG fluorescence staining results show protein synthesis activity of THLE-2 and SH-SY5Y cells at different time points. Cells were synchronized, pulse-labeled with HPG for 30 min, fixed, and subjected to Click-iT HPG reaction using Alexa-fluor488-azide at the indicated time points. Scale bar = 20 μm.

[0104] (B) Corresponding quantification of mean HPG fluorescence intensity in (A). Values ​​represent mean ± SD (n = 4).

[0105] (C) Strategy to quantify translation fractionation curves using the area under the curve calculated from heavy and light polysomes. The translation index is the ratio of the areas associated with the heavy and light fractions.

[0106] (D) Representative immunoblots of newly synthesized peptides labeled with puromycin in U2OS, THLE-2, and SH-SY5Y cells.

[0107] (E and F) Figure 1 Quantification of the distribution of polysome fractions with translation index in E and 1F.

[0108] (G) Representative images of puromycin-labeled nascent proteins in the brain region surrounding the lateral ventricle (Lv). Puromycin was stereotaxically injected into the left lateral ventricle, and sagittal brain sections were stained with puromycin antibodies. Fluorescence intensity in the caudate putamen (CP), thalamus (TH), corpus callosum (cc), and hippocampus (HIP) regions was measured using ImageJ (right). Values ​​are shown as mean ± SD (****p < 0.00005 by t-test).

[0109] (H) Except for Group 3 ( Figure 1H) In addition, the total proteins with different expression patterns along the circadian rhythm were analyzed using the fuzzy c-means clustering algorithm.

[0110] (M) Figure 1 Quantification of polysome fraction distribution with translation index in J.

[0111] (I) Domain structures of ATXN2 and ATXN2L in representative species. The Lsm domain is in yellow, LsmAD is in red, the polyQ repeat domain is in green, the PAM is in purple, and the low complexity domain (LCD) is in blue.

[0112] (L) Phylogenetic tree of ATXN2 and ATXN2L indicates that ATXN2 and ATXN2L evolved from a common ancestor of atx2 in yeast and insects.

[0113] Figure 8 ATXN2 and ATXN2L phases segregate in a rhythmic manner in vitro and in vivo

[0114] (A) Representative immunofluorescence images showing the subcellular localization of Atxn2 and Atxn2l (red) in the suprachiasmatic nucleus (SCN). Nuclei were stained with DAPI (blue) and the two SCNs are delineated by white dashed lines.

[0115] (B) Representative immunofluorescence images of Atxn2 and Atxn2l condensates (red) in mouse cortex, hippocampus, and cerebellum regions. Nuclei were counterstained with DAPI (blue). Scale bar = 5 μm.

[0116] (C and D) Scatter plots showing the amino acid conservation of ATXN2 and ATXN2L. Lower conservation scores indicate more conserved sequences. Protein domains, including polyQ, LSm, LSmAD, PAM, and LCD, are depicted with red lines.

[0117] (E and F) show phase diagrams of ATXN2 (E) and ATXN2L (F) LCDs, respectively. Green dots indicate phase separation under the indicated conditions, while red dots indicate no phase separation.

[0118] (G) Representative immunofluorescence images of ATXN2 condensate formation (red or green) in various cell lines including THLE-2, GT1-7, and HeLa cells. Nuclei were counterstained with DAPI (blue). Scale bar = 10 μm.

[0119] (H) Localization of ATXN2 condensates relative to the endoplasmic reticulum (ER). The ER was stained using anti-knockout EL antibody (green), while ATXN2-mCherry is shown in red. Scale bars represent 10 μm and 5 μm.

[0120] (I) Immunostaining of ATXN2 in ATXN2 knockout U2OS cells, used as a negative control.

[0121] (JN) Figure 2 Quantification of the number and average size of ATXN2 and ATXN2L condensates in H, along the circadian cycle.

[0122] (O) Confocal microscopy images of ATXN2 in THLE-2 cells at different circadian time points are shown. Immunostained ATXN2 is shown in red, and the magnified images are indicated by white boxes. White triangles highlight ATXN2 condensates. Scale bars are 10 μm and 5 μm, respectively.

[0123] (P) Statistical analysis of the diameters of ATXN2 condensates at different time points (N).

[0124] (Q) Confocal microscopy images of Atxn2 and Atxn2l (red) in the suprachiasmatic nucleus (SCN) at different time points (ZT) are shown. The SCN is outlined by a white dashed circle. Scale bar = 200 μm.

[0125] (R) Quantitative analysis of ATXN2 / 2L protein levels along the circadian rhythm in U2OS cells.

[0126] (S) The abundance of ATXN2 protein fluctuates with the circadian cycle in HEK293T cells, SHSY-5Y cells, and HeLa cells. ATXN2 and β-tubulin were detected by Western blotting (WB) at different time points at 4 h intervals within 32 h after synchronization.

[0127] (T) Quantitative analysis of Atxn2 protein levels in the hypothalamus along the circadian rhythm.

[0128] (U) The abundance of Atxn2 protein oscillates in the mouse cerebellum and cortex. Animals housed on a normal light-dark cycle were used to collect tissues at different time points at 3-hour intervals. ZT 0 represents the time when the lights were on. β-Tubulin was used as a protein loading control.

[0129] (V and W) Quantification of ATXN2 / 2L RNA in U2OS cells (V) and ATXN2 RNA in the hypothalamus (W), respectively, along the circadian cycle. Each value was normalized to actin and converted to relative expression level of the first sample.

[0130] Fig. 9 ATXN2 condensates oscillate in a rhythmic manner and interact with translation-associated proteins.

[0131] (A) Pie chart depicting the percentage of cycling and non-cycling proteins. RAIN time series periodicity analysis was performed with a period of 24 h and a significance level of p < 0.05 to identify cycling and non-cycling proteins in the input whole proteome and ATXN2 immunoprecipitated (IP) proteome.

[0132] (B) Expression patterns of circulating proteins in the ATXN2 immunoprecipitation group. The time point of peak expression was used to classify proteins (p value < 0.05).

[0133] (C) Heat map showing the protein abundance distribution of the “translation” term in the GO classification at different time points.

[0134] (D) Ribosome density distribution of transcript translation reading frames, showing upregulation of TE from 4 to 12 h in WT cells (right), and downregulation in ATXN2 / 2L double knockout cells compared to 12 h WT cells (left). Top: ribosome density after the start codon. Bottom: ribosome density before the stop codon.

[0135] Fig.10 Atxn2 condensates recruit ribosomes and clock-related mRNAs.

[0136] (A) Schematic workflow of the 80S ribosomal subunit purification process.

[0137] (B) Figure 4 Corresponding quantification of ribosome enrichment in each condensate in A. White arrows are drawn in the droplets to indicate the analyzed fractions.

[0138] (C) The mRNA 3'UTR of core clock genes is enriched with AUUUU / A motifs, as shown in the schematic diagram.

[0139] (D) Experimental workflow for in vitro transcription.

[0140] (E) Figure 4 Corresponding quantification of ribosome enrichment in each condensate in C. White arrows are drawn in the Atxn2 droplets to indicate the analyzed fraction.

[0141] (F) The ATXN2LCD is enriched in methionine residues, highlighted in red. The numbers of all methionine residues are formatted as superscripts.

[0142] (G) Representative images showing the in vitro phase separation state of ATXN2LCD proteins, including seven single M-to-S mutants. Proteins were diluted to a final concentration of 80 μM. Scale bar = 20 μm.

[0143] Fig.11 Atxn2 phase separation is essential for rhythmic translation

[0144] (A) Experimental workflow for in vitro translation experiments.

[0145] (B) Representative images showing colocalization of Per2 mRNA and Atxn2 protein condensates in the cortex, hippocampus, substantia nigra (SN), and cerebellum, respectively. Colocalized Atxn2 condensates and Per2 mRNA are indicated by white arrows. Atxn2 protein is shown in green, while Per2 mRNA is shown in red. Nuclei are labeled with DAPI (blue). Scale bar = 5 μm.

[0146] (C) Domain composition of different ATXN2 mutants.

[0147] (D) Representative images of EGFP-ATXN2 mutants complemented in double knockout cells, except for ΔLCD3. 3D statistical plots of grayscale values ​​(bottom) corresponding to the images are shown. Scale bars are 10 μm and 2 μm, respectively.

[0148] (E) Figure 5 Quantification of the polysome fraction distribution with translation index in E .

[0149] (F) Western blot results showing the knockdown efficiency of ATXN2 and ATXN2L in PER2::LUCU2OS cells, with β-tubulin used as a control.

[0150] Fig.12 ATXN2 and ATXN2L jointly regulate circadian behavior.

[0151] (A) Representative images of the suprachiasmatic nucleus (SCN) showing mCherry expression two weeks after stereotaxic injection of AAV-hSyn-mCherry-IRES-Cre.

[0152] (B) Representative activity graphs of wheel running activity in different genetically modified mice. Mice were housed in 12L:12D for 7 days and then transferred to constant darkness for 14 days. White shading indicates lights on, while gray shading indicates lights off.

[0153] (C) Under LD conditions Figure 6 Average circadian free-running periods (mean ± SD) were measured over 7 days in the same animals shown in D and statistically analyzed using a two-tailed t-test. No significant differences were observed (ns, not significant).

[0154] (D) Body weight curves of male WT, Atxn2- / -, Vip-Atxn2l- / - and Atxn2+ / -; SCN-Atxn2l+ / - compound heterozygous knockout mice.

[0155] (E) Representative trajectory plots of WT and transgenic mice during the last 5 min of the open field test.

[0156] (F) Total movement distance was recorded and analyzed in the open field test. All data are presented as mean ± SD.

[0157] (G and H) Latency to the central area (G) and time spent in the center (H) were recorded and analyzed in the open field test. Data are presented as mean ± SD.

[0158] Fig.13 Use of inhibitory nucleic acids, CRISPR compositions ATXN2 and ATXN2L, and overexpression of ATXN2 using expression vectors

[0159] (A) Western Blot was used to verify the knockout of ATXN2 and ATXN2L by CRISPR-Cas9;

[0160] (B) Western Blot was used to verify the downregulation of ATXN2 expression by siRNA;

[0161] (C) Western Blot was used to verify the downregulation of ATXN2 and ATXN2L expression by shRNA

[0162] (D) Overexpression of ATXN2 in U2OS.

[0163] Fig.14 Schematic diagram of the construction of cells containing different lengths of polyQ, showing the domains contained in the two homologous proteins ATXN2 and ATXN2L, where the poly domain contained in ATXN2 has undergone various changes in polyQ lengths.

[0164] Fig.15 The rhythmic period of PER2 in ATXN2-0 / 22 / 39 / 57Q cell lines is illustrated. The PER2 period values ​​of 25 cells were calculated for each cell line, and each dot represents one cell. The average period of PER2 in ATXN2-0Q and ATXN2-22Q was 23.48 and 23.76 hours, respectively, which is approximately equal to 24 hours, with no significant difference. The average period of PER2 in ATXN2-39Q and ATXN2-57Q was 25.15 and 25.30 hours, respectively, which was significantly prolonged compared with ATXN2-22Q. *, P < 0.5; ***, P < 0.01. DETAILED DESCRIPTION

[0165] Listed below are definitions of various terms used to describe the compositions and nucleic acid combinations disclosed herein. These definitions apply to the terms used throughout this specification and claims, except where otherwise limited in specific cases, where these terms are used either individually or as part of a larger group.

[0166] General terms

[0167] As used herein, the terms "optional" and "optionally" include both the cases of being selected or not being selected. For example, "optionally modified" includes both the cases of being modified and not being modified.

[0168] As used herein, the terms "a," "an," and "the" are generally construed to cover both the singular and the plural.

[0169] As used herein, the term "includes" means the phrase "including (but not limited to)", and can be used interchangeably therewith. The term "comprising" used herein means the phrase "including (but not limited to)", and can be used interchangeably therewith. The technical solutions using "includes" or "comprising" in this patent can be further defined as "consisting of" or "composed of".

[0170] As used herein, the terms "one embodiment," "some embodiments," "embodiments," "specific embodiments," "related embodiments," "an embodiment," "another embodiment," or "further embodiments," or combinations thereof, mean that a particular feature, structure, or characteristic described in conjunction with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the aforementioned phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0171] As used herein, the term "subject", "subject in need" refers to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, goats.

[0172] As used herein, the term "expression vector" refers to a DNA construct containing a nucleic acid molecule operably connected to a suitable control sequence, which can achieve expression of the nucleic acid molecule in a suitable host. Such control sequences include promoters for achieving transcription, optional operator sequences for controlling such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. The vector may be a plasmid, a phage particle, a virus, or simply a potential genome insert. Viral vectors may be based on DNA (e.g., adenovirus, adeno-associated virus or vaccinia virus) or RNA, including oncolytic virus vectors (e.g., VSV), which may be replicable or non-replicable. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or, in some cases, may be integrated into the genome itself. In this specification, "plasmid", "expression plasmid", "vector" and "expression vector" are often used interchangeably.

[0173] As used herein, the term "regulate" refers to causing a change in the object being regulated. Depending on the object being regulated, a person skilled in the art can use conventional methods in the art to determine whether the object being regulated has changed. "Regulate" expression refers to "upregulating" or "downregulating" the expression of the corresponding gene or the protein encoded thereof.

[0174] As used herein, "up-regulation" or "down-regulation" expression refers to the expression of the corresponding gene or its encoded protein increasing or decreasing. In some embodiments, "up-regulation" can represent the expression of the corresponding gene or its encoded protein relative to the original level, increasing by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 100%, 110% or higher or any percentage between the above percentages. In some embodiments, "down-regulation" can represent the expression of the corresponding gene or its encoded protein relative to the original level, decreasing by 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 100% or any percentage between the above percentages.

[0175] The prior art cited in this specification is hereby incorporated by reference in its entirety and for all purposes.

[0176] Regulation of circadian rhythm

[0177] "Regulating circadian rhythm" refers to regulating the period, intensity, phase or frequency of the circadian rhythm of a cell or organism. For a cell or an organism, a change in circadian rhythm can be reflected in a rhythmic change in any biological or physiological characteristic. For example, in some embodiments, for a cell, "regulating circadian rhythm" can be reflected in a change in the period, intensity (or level or amplitude), phase or frequency of a cell's translation of a protein relative to time. In some embodiments, for an organism, "regulating circadian rhythm" can be reflected in a change in the period, intensity, phase or frequency of an organism's rhythmic behavior relative to time. In some embodiments, the organism can be a subject, and preferably the subject is a human or a mouse.

[0178] Those skilled in the art will appreciate that accelerating the circadian rhythm means shortening the circadian rhythm period, advancing the phase, or accelerating the frequency. Delaying the circadian rhythm means prolonging the circadian rhythm period, delaying the phase, or slowing down the frequency. In some embodiments, accelerating the circadian rhythm means shortening the circadian rhythm period or advancing the phase. In some embodiments, delaying the circadian rhythm means prolonging the circadian rhythm period or delaying the phase.

[0179] Those skilled in the art will understand that strengthening the circadian rhythm means that the intensity of the circadian rhythm increases, and weakening the circadian rhythm means that the intensity of the circadian rhythm decreases.

[0180] The inventors have found that the clock genes responsible for regulating circadian rhythms in cells and organisms often have phase separation. The inventors have found that phase separation is crucial for organisms to regulate circadian rhythms. Promoting or reducing the phase separation of clock genes can affect or regulate circadian rhythms.

[0181] The term "phase separation" refers to the fact that when external conditions such as temperature and pressure change, a multi-component system sometimes separates into several phases with different components and structures. This phenomenon is ubiquitous in physiological environments or cellular environments. The phase separation mediated by genes, proteins or domains referred to herein refers to the degree to which the protein or protein or domain encoded by the gene undergoes phase separation in physiological environmental conditions or cellular environmental conditions, which contributes to the rapid occurrence of biological functions related to the gene or protein or domain. Those skilled in the art will immediately understand that upregulating the expression of a gene or protein or domain or enhancing its function can improve the phase separation mediated by the gene or protein or domain; downregulating the expression of a gene or protein or domain or reducing its function can reduce the phase separation mediated by the gene or protein or domain.

[0182] The term "clock gene" refers to a gene in a cell or organism that is capable of regulating circadian rhythm. Prior to the present invention, it was not known in the art that AXTN2 and AXTN2L could be considered clock genes, nor that they could mediate phase separation.

[0183] Thus, the present invention provides a method for regulating circadian rhythm, which includes the step of regulating circadian rhythm by regulating phase separation. In some embodiments, regulating phase separation is to reduce or increase phase separation mediated by clock genes. In some embodiments, the intensity of circadian rhythm is increased by increasing phase separation mediated by clock genes, accelerating or delaying circadian rhythm. In some embodiments, the intensity of circadian rhythm is reduced by reducing phase separation mediated by clock genes, accelerating or delaying circadian rhythm. In some embodiments, increasing phase separation mediated by clock genes can be achieved by up-regulating the expression of clock genes or enhancing the phase separation function of clock genes. In some embodiments, reducing phase separation mediated by clock genes can be achieved by down-regulating the expression of clock genes or inactivating the phase separation function of clock genes.

[0184] Furthermore, the inventors have found that the LCD (low complexity domain) domain is crucial for the formation of phase separation. The inactivation or functional decline of the LCD domain can reduce or destroy the phenomenon of clock gene phase separation.

[0185] Thus, the present invention provides a method for regulating circadian rhythm, which includes the step of regulating phase separation mediated by the LCD domain of a clock gene. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by inactivating or reducing the function of the LCD domain. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by down-regulating the expression of a clock gene having an LCD domain. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by up-regulating the expression of a clock gene having an LCD domain. In some embodiments, the LCD domain of a clock gene can be expressed by an expression vector to regulate the phase separation mediated by the domain, thereby regulating the circadian rhythm.

[0186] Those skilled in the art will understand that any feasible technology in the art can be used to directly or indirectly regulate the expression of clock genes or regulate (inactivate or enhance) the function of clock genes, including but not limited to using gene editing technology, transfection technology, etc. to knock down, knock out genes, overexpress genes, etc. to directly regulate. Those skilled in the art can also use indirect methods to regulate the expression of clock genes or regulate (inactivate or enhance) the function of clock genes, including but not limited to regulating the upstream and downstream genes of the pathway (such as signal pathway, transcription process, translation process, etc.) in which the gene is located, and regulating the expression or function of the ubiquitinase of the protein encoded by the gene.

[0187] To achieve the purpose of regulating circadian rhythm, the above-mentioned phase separation regulation, phase separation regulation of clock gene production, phase separation regulation of LCD domain of clock gene, expression of LCD domain of clock gene, etc. can occur in any cell, subject or organism as needed to regulate the circadian rhythm of the cell, subject or organism, and it can also occur in any type of cell of any subject or organism as needed to regulate circadian rhythm. Preferably, in some embodiments, the above-mentioned phase separation regulation, phase separation regulation of clock gene, phase separation regulation of LCD domain of clock gene, expression of LCD domain of clock gene, etc. occur in suprachiasmatic nucleus (SCN) cells of the hypothalamus, or suprachiasmatic nucleus (SCN) cells of the hypothalamus of the subject or organism.

[0188] ATXN2 and ATXN2L

[0189] ATXN2 is a gene encoding a multifunctional protein containing multiple domains, and the protein encoded by it is called "Ataxin-2". In this article, "Ataxin-2" and "ATXN2" can be used interchangeably, and depending on the context, they can refer to both the gene and the protein or RNA encoded by the gene. ATXN2L is a homologous gene of ATXN2, and the protein encoded by it is called "Ataxin-2l". In this article, "Ataxin-2l" and "ATXN2L" can be used interchangeably, and depending on the context, they can refer to both the gene and the protein or RNA encoded by the gene.

[0190] The amino termini of ATXN2 and ATXN2L contain a polyglutamine sequence (poly-glutamine, polyQ) and an RNA binding domain, and the carboxyl termini contain a typical LCD (low complexity domain). The nucleic acid sequence of human ATXN2 is shown in SEQ ID NO: 1. The amino acid sequence of human ATXN2 is shown in SEQ ID NO: 2. The nucleic acid sequence of human ATXN2L is shown in SEQ ID NO: 3. The amino acid sequence of human ATXN2L is shown in SEQ ID NO: 4. The nucleic acid sequence of the LCD domain of human ATXN2 is shown in SEQ ID NO: 5, the amino acid sequence of the LCD domain of human ATXN2 is shown in SEQ ID NO: 6, and the nucleic acid sequence of the LCD domain of human ATXN2L is shown in SEQ ID NO: 7. The amino acid sequence of the LCD domain of human ATXN2L is shown in SEQ ID NO: 8.

[0191] The sequence of human ATXN2 with polyQ of 0 (denoted as ATXN2-0Q) is shown in SEQ ID NO: 25; the sequence of human ATXN2 with polyQ of 22 (denoted as ATXN2-22Q) is shown in SEQ ID NO: 26; the sequence of human ATXN2 with polyQ of 39 (denoted as ATXN2-39Q) is shown in SEQ ID NO: 27; the sequence of human ATXN2 with polyQ of 57 (denoted as ATXN2-57Q) is shown in SEQ ID NO: 28.

[0192] LCD (low complexity domain) domains exist not only in ATXN2 and ATXN2L proteins, but also in certain other proteins, especially clock gene proteins. Prior to the present invention, the art did not know the role of LCD domains in circadian rhythm regulation, nor did it know that regulating proteins containing LCD domains could regulate circadian rhythms. Whether a protein contains an LCD domain and how to determine the LCD domain are within the knowledge and capabilities of those skilled in the art.

[0193] The existing technologies mostly focus on the study of ATXN2 on ataxia, and the existing technologies also focus on the study of the polyQ sequence at the N-terminus of ATXN2. As for ATXN2L, the existing technologies have not studied its biochemical function or physiological function. At the same time, no existing technologies have disclosed the role of ATXN2 and ATXN2L in circadian rhythm, and no existing technologies have disclosed the LCD domain of ATXN2 and ATXN2L, especially the phase separation of the domain, and the role in circadian rhythm regulation.

[0194] The inventors surprisingly found that ATXN2 and ATXN2L can be used as new clock genes and play an important role in circadian rhythm. Therefore, the present invention provides a method for regulating circadian rhythm by regulating the gene expression or protein function of ATXN2 and / or ATXN2L. Further, the present invention also provides a method for regulating circadian rhythm by regulating the gene expression or protein function of the LCD domain of ATXN2 and / or ATXN2L. On the other hand, the present invention also provides a method for regulating circadian rhythm by regulating the phase separation ability of ATXN2 and / or ATXN2L.

[0195] On the other hand, the inventors also found that ATXN2 and ATXN2L are new clock genes, both of which have opposite effects on the cycle and phase of the circadian rhythm. Thus, in some embodiments, the cycle and phase of the circadian rhythm can be accelerated by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L. Similarly, in some embodiments, the cycle and phase of the circadian rhythm can be accelerated by inactivating the function of ATXN2 or enhancing the function of ATXN2L. In some embodiments, the cycle and phase of the circadian rhythm can be delayed by downregulating the expression of ATXN2L or upregulating the expression of ATXN2. Similarly, in some embodiments, the cycle and phase of the circadian rhythm can be delayed by inactivating the function of ATXN2L or enhancing the function of ATXN2.

[0196] On the other hand, the inventors also found that ATXN2 and ATXN2L have redundancy in regulating the intensity of circadian rhythms and the presence of circadian rhythms. For example, in the absence of both, the periodic rhythm of cell translation proteins disappears, and the intensity (level) of protein translation is significantly reduced. Thus, the present invention provides a method for regulating the intensity of circadian rhythms and restoring circadian rhythms. In some embodiments, the expression of ATXN2 and ATXN2L can be simultaneously upregulated or the functions of ATXN2 and ATXN2L can be enhanced to enhance the intensity of circadian rhythms or restore circadian rhythms. In some embodiments, the expression of ATXN2 and ATXN2L can be simultaneously downregulated or the functions of ATXN2 and ATXN2L can be simultaneously inactivated to reduce the intensity of circadian rhythms or to eliminate circadian rhythms.

[0197] To achieve the purpose of regulating circadian rhythm, the above-mentioned regulation of ATXN2 and ATXN2L expression and / or function, etc. can occur in any cell, subject or organism as needed to regulate the circadian rhythm of the cell, subject or organism, and it can also occur in any type of cell in any subject or organism as needed to regulate the circadian rhythm. Preferably, in some embodiments, the above-mentioned regulation of ATXN2 and ATXN2L expression and / or function, etc. occurs in the suprachiasmatic nucleus (SCN) cells of the hypothalamus, or the suprachiasmatic nucleus (SCN) cells of the hypothalamus of the subject or organism to better achieve circadian rhythm regulation of the subject or organism.

[0198] Inhibitory nucleic acids

[0199] Inhibitory nucleic acids can be used to achieve the purpose of down-regulating the expression of ATXN2 or ATXN2L. It will be appreciated by those skilled in the art that any type of inhibitory nucleic acid such as siRNA, shRNA, miRNA, antisense oligonucleotides (DNA or RNA) can be used to achieve the above purpose. Its design, testing, and conducting experiments to determine activity are all within the capabilities of those skilled in the art. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA (hairpin siRNA), a precursor microRNA (precursor microRNA, pre-miRNA) or a microRNA (microRNA, miRNA).

[0200] In some embodiments, siRNA or shRNA is used to down-regulate the expression of ATXN2 or ATXN2L. Preferably, in some embodiments, the inhibitory nucleic acid in the embodiments of the present invention is used to down-regulate the expression of ATXN2 or ATXN2L.

[0201] Expression vector

[0202] An expression vector comprising a nucleic acid sequence encoding ATXN2 and / or ATXN2L protein can be used to achieve the purpose of upregulating the expression of ATXN2 or ATXN2L. It will be appreciated by those skilled in the art that any type of expression vector used in the art for expressing genes can be used to achieve the above purpose. Its design, testing, and conducting experiments to determine activity are all within the capabilities of those skilled in the art.

[0203] With the sequence information provided, a skilled person can use available cloning techniques to produce nucleic acid sequences or vectors suitable for transduction into cells. The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from: adenovirus, adeno-associated virus (AAV) including mutated forms, retrovirus, slow virus, herpes virus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, poxvirus, and SV40. Preferably, the viral vector is replication defective, although it is envisioned that it can be replication deficient, capable of replication or conditional replication. The viral vector can generally maintain an extrachromosomal state without integration into the genome of the target cell. The preferred viral vector for introducing a nucleic acid sequence encoding ATXN2 and / or ATXN2L protein into neural cells is an AAV vector.

[0204] Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be complexed with transfection reagents to facilitate the uptake of viral vectors by target cells. Such agents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems can be used. The vectors used in the present invention are preferably suitable for use in vivo or in vitro, and are preferably suitable for use in humans. Plasmids are preferably AAV vector plasmids such as AAV1, AAV2, AAV4, AAV5, AAV8, AAV9.

[0205] The carrier will preferably comprise one or more regulating sequences to instruct the expression of the nucleic acid sequence in the target cell. The regulating sequence may comprise a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably connected to the nucleic acid sequence. The carrier may also comprise a selective marker, for example to determine the expression of the carrier in a growth system (for example a bacterial cell) or in a nervous system cell. In some embodiments, the carrier comprises one or more promoters, and the promoter may be operably connected to an expression cassette of the present invention, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a selective marker, a nucleic acid restriction site, and / or a homologous recombination site.

[0206] In some embodiments, the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication defective.

[0207] In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, in some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0208] CRISPR Composition

[0209] CRISPR compositions can be used to achieve the purpose of up-regulating or down-regulating the expression of ATXN2 or ATXN2L. Nucleases such as Cas enzymes and gRNA (guide RNA) are included in the system, which are used to inactivate genes or up-regulate or down-regulate the expression of genes. Those skilled in the art will understand and adjust the use of corresponding Cas enzymes according to the reagent needs, such as using Cas enzymes with partial inactivation of nucleic acid cleavage function or complete inactivation of nucleic acid cleavage function. Preferably, in some embodiments, the Cas enzyme used is Cas9 enzyme. In some embodiments, the Cas enzyme used is dCas9. In some embodiments, the gRNA used targets the promoter region of the target gene (such as ATXN2 or ATXN2L).

[0210] Pharmaceutical uses and treatment methods

[0211] According to the above findings of the present invention and the method for regulating circadian rhythm provided by the present invention, the present invention also provides the use of one or more regulators or a combination of regulators for regulating the expression or protein function of ATXN2 and / or ATXN2L in the preparation of the following drugs or reagents:

[0212] (1) Prevent or treat circadian rhythm-related diseases;

[0213] (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders;

[0214] (3) regulating the circadian rhythm of a subject in need thereof; and / or

[0215] (4) Regulating phase separation.

[0216] The present invention also provides a method for the following, comprising administering to a subject one or more modulators or a combination of modulators that modulate the expression or protein function of ATXN2 and / or ATXN2L:

[0217] (1) Prevent or treat circadian rhythm-related diseases;

[0218] (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders;

[0219] (3) regulating the circadian rhythm of a subject in need thereof; and / or

[0220] (4) Regulating phase separation.

[0221] Those skilled in the art will appreciate that the above-mentioned regulator or combination of regulators may be any reagent in the art that can achieve regulation of the expression or protein function of ATXN2 and / or ATXN2L, including but not limited to inhibitory nucleic acids targeting ATXN2 and / or ATXN2L, expression vectors for expressing ATXN2 and / or ATXN2L, and CRISPR compositions for targeting ATXN2 and / or ATXN2L.

[0222] In subjects with circadian rhythm-related diseases, the circadian rhythm can be regulated according to the methods of the present invention, such as regulating the period, phase, intensity and / or frequency of the circadian rhythm, to achieve the effect of improving the circadian rhythm, such as restoring the period, phase, intensity and / or frequency of the circadian rhythm, such as changing the circadian rhythm of subjects with circadian rhythm-related diseases to the level of the circadian rhythm of medically normal subjects.

[0223] In subjects with diseases associated with ATXN2 and / or ATXN2L gene disorders, circadian rhythms can also be regulated according to the methods of the present invention. At the same time, the expression of ATXN2 and / or ATXN2L genes in the subject can be regulated according to the type of ATXN2 and / or ATXN2L gene disorder in the disease. For example, in subjects whose ATXN2 and / or ATXN2L expression is significantly lower than the ATXN2 expression level of medically normal subjects, the expression of ATXN2 and / or ATXN2L is upregulated; in subjects whose ATXN2 and / or ATXN2L expression is significantly higher than the ATXN2 expression level of medically normal subjects, the expression of ATXN2 and / or ATXN2L is downregulated.

[0224] In some embodiments, the circadian rhythm-related disease or ATXN2 and / or ATXN2L gene disorder-related disease is selected from sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain. Preferably, in some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, drowsiness, sleep disorders, and sleep disorders.

[0225] The above-mentioned modulators or combinations of modulators that regulate the expression or protein function of ATXN2 and / or ATXN2L can also be used in subjects who have not been medically diagnosed with a disease, and can be used to regulate any subject in need who has not been medically diagnosed with a disease. In some ways, it is used for subjects who need to work in shifts and need to adjust jet lag.

[0226] Regardless of whether it is used for subjects with or without diseases, those skilled in the art can apply the modulator or modulator combination disclosed in the present invention as needed, or use the method for regulating circadian rhythm of the present invention. For example:

[0227] In subjects with shortened or phase-advanced circadian rhythms or in subjects in need of delayed circadian rhythms, expression of ATXN2 and / or ATXN2L is upregulated.

[0228] In subjects with prolonged circadian period or phase delay or in subjects in need of accelerated circadian rhythm, ATXN2L expression is upregulated and / or ATXN2 expression is downregulated.

[0229] In subjects with increased circadian cycle strength or in subjects in need of weakened circadian rhythm, expression of both ATXN2L and ATXN2 is downregulated.

[0230] In subjects with reduced circadian cycle strength or in subjects in need of strengthening the circadian rhythm, expression of both ATXN2L and ATXN2 is upregulated.

[0231] In some embodiments, the modulator that regulates the expression or protein function of ATXN2 and / or ATXN2L is a modulator that upregulates the expression of ATXN2 and / or ATXN2L or a modulator that enhances the protein function of ATXN2 and / or ATXN2L. Preferably, in some embodiments, the modulator that regulates the expression of ATXN2 and / or ATXN2L is an expression vector comprising an encoding ATXN2 and / or ATXN2L.

[0232] In some embodiments, the modulator that regulates the expression or protein function of ATXN2 and / or ATXN2L is a modulator that downregulates the expression of ATXN2 and / or ATXN2L or a modulator that reduces the protein function of ATXN2 and / or ATXN2L. Preferably, in some embodiments, the modulator that regulates the expression of ATXN2 and / or ATXN2L is or targets an inhibitory nucleic acid of ATXN2 or ATXN2L.

[0233] Biomarkers and detection and diagnostic methods

[0234] Based on the above findings, the present invention also provides a biomarker combination for detecting circadian rhythms in subjects, which includes ATXN2 and / or ATXN2L. Preferably, it is composed of ATXN2 and / or ATXN2L. In some embodiments, the biomarker combination includes or consists of ATXN2 and / or ATXN2L genes. In some embodiments, the biomarker combination includes or consists of ATXN2 and / or ATXN2L proteins. In some embodiments, the biomarker combination is the ATXN2 gene or the ATXN2 protein. In some embodiments, the biomarker combination is the ATXN2L gene or the ATXN2L protein. The "combination" in the "biomarker combination" herein does not limit the components of the biomarker combination to be more than one.

[0235] Due to the important functions of ATXN2 and ATXN2L in circadian rhythm regulation, they can be used as biomarkers to identify or detect the state of the subject's circadian rhythm. Those skilled in the art will understand that the state can be determined to be abnormal or in need of change based on medical knowledge, or determined to be in need of change based on the needs or feelings of the subject. The need to change refers to any aspect of the circadian rhythm such as the period, intensity, phase or frequency that needs to be changed. For example: The period or phase of the circadian rhythm of a subject who needs jet lag may need to be changed so that the corresponding aspects of their circadian rhythm are consistent with the day and night operation of the time zone in which they are located.

[0236] In some embodiments, decreased expression of ATXN2 in a subject relative to a medically normal subject or increased expression of ATXN2L in a subject relative to a medically normal subject indicates a state of the subject's circadian rhythm, such as an acceleration of the period or phase of the subject's circadian rhythm.

[0237] In some embodiments, elevated expression of ATXN2 in a subject relative to a medically normal subject or decreased expression of ATXN2L in a subject relative to a medically normal subject indicates a state of the subject's circadian rhythm, such as a delay in the period or phase of the subject's circadian rhythm.

[0238] In some embodiments, decreased expression of both ATXN2 and ATXN2L in a subject relative to a medically normal subject indicates the state of the subject's circadian rhythm, such as a decrease in the strength of the subject's circadian rhythm.

[0239] In some embodiments, elevated expression of both ATXN2 and ATXN2L in a subject relative to a medically normal subject indicates the state of the subject's circadian rhythm, such as an increase in the strength of the subject's circadian rhythm.

[0240] Based on the expression of ATXN2 and / or ATXN2L being indicative of the circadian rhythm status of the subject, the methods of the present application can be used to regulate the circadian rhythm of the subject, such as downregulating the intensity of the circadian rhythm in a subject with increased circadian rhythm intensity.

[0241] Based on this, the present invention also provides a reagent combination for detecting the biomarker combination of the present invention, which includes reagents for detecting the gene markers, such as primers, probes, antibodies, and optionally enzymes such as PCR enzymes, buffers, and product instructions. It will be understood by those skilled in the art that any primer, probe, or antibody for detecting the biomarker combination in the art can be used to detect the expression level of the biomarker combination. As needed, those skilled in the art can also freely select relevant enzymes (such as PCR enzymes), buffers, etc. in the art to complete the detection.

[0242] Based on this, the present invention also provides a method for detecting the circadian rhythm of a subject, which comprises the following steps:

[0243] Determining the expression level of the aforementioned biomarker combination in the subject;

[0244] comparing the measured expression level to a reference level;

[0245] The state of the subject's circadian rhythm is determined.

[0246] In some embodiments, the expression level of the aforementioned biomarker combination of the subject can be determined using the reagent or reagent combination for detecting the biomarker combination of the present invention.

[0247] The reference level of the biomarker combination is the reference level of a subject with a medically normal circadian rhythm. Those skilled in the art will appreciate that the reference level can be obtained by conventional methods in the art. For example, the reference level is obtained by analyzing gene sequencing data or immunohistochemical data of a subject with a medically normal circadian rhythm. The gene sequencing data or immunohistochemical data may come from temporarily recruited subjects with medically normal circadian rhythms or from historical data. When the expression level of the subject's biomarker combination has a medically significant difference from the expression level of the biomarker combination of a subject with a medically normal circadian rhythm, it can be determined that the subject's rhythm is abnormal or needs to be changed. Those skilled in the art can understand the significance of the medically significant difference based on their own instructions and experience.

[0248] In some embodiments, the state of circadian rhythm can be used to diagnose circadian rhythm disorders or circadian rhythm-related diseases.

[0249] Cell and animal models

[0250] The present invention provides a cell model or an animal model, which lacks ATXN2 and / or ATXN2L genes.

[0251] In some embodiments, the cell model or animal model lacks the ATXN2 gene, and the cell model or animal model can serve as a cell model for accelerated circadian rhythm period and phase.

[0252] In some embodiments, the cell model or animal model lacks the ATXN2L gene, and the cell model or animal model can serve as a cell model of circadian rhythm period and phase delay.

[0253] In some embodiments, the cell model or animal model lacks both the ATXN2 gene and the ATXN2L gene, and the cell model or animal model can be used as a cell model for reduced circadian rhythm intensity or disappeared circadian rhythm.

[0254] In some embodiments, both copies of the ATXN2 gene of the animal model are deleted. In some embodiments, both copies of the ATXN2L gene of the animal model are deleted. In some embodiments, one copy of each of the ATXN2 gene and the ATXN2L gene of the animal model is deleted.

[0255] In some embodiments, the cell model is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a Hela cell.

[0256] In some embodiments, the animal model is a mammalian model, more preferably a rodent model, and most preferably a mouse model.

[0257] Based on this, the present invention also provides the use of the cell model or animal model of the present invention in screening drugs for treating or preventing circadian rhythm-related diseases. The screening method includes, but is not limited to, applying candidate drugs (such as compounds) to the above-mentioned cell model or animal model to detect those candidate drugs that can improve the abnormal state of circadian rhythm.

[0258] Compositions and preparations

[0259] The expression vector, expression vector combination, CRISPR composition or inhibitory nucleic acid of the present invention can be administered in the form of a composition. The present invention provides a composition comprising the expression vector, expression vector combination, CRISPR composition or inhibitory nucleic acid of the present invention, and a pharmaceutically acceptable carrier or excipient.

[0260] The expression vector, expression vector combination, CRISPR composition inhibitory nucleic acid or composition of the present invention can be regarded as a regulator or regulator combination of the present invention that regulates the expression or protein function of ATXN2 and / or ATXN2L.

[0261] The composition may be a liquid or solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

[0262] Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0263] The composition may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0264] Expression vector, mRNA, protein, cell or composition according to the present invention can be administered parenterally, for example intravenously or by infusion technique. Expression vector, mRNA, protein, cell or composition can be administered in the form of sterile aqueous solution, and this sterile aqueous solution can contain other substances, for example enough salt or glucose to make solution isotonic with blood. The aqueous solution can be appropriately buffered (preferably pH is 3 to 9). Pharmaceutical composition can be prepared accordingly. It is easy to complete by standard pharmaceutical techniques well known to those skilled in the art to prepare suitable formulations under aseptic conditions.

[0265] The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions of the present invention can be administered systemically, such as by intravenous injection, or can be administered locally, for example by targeted administration to the hypothalamus. Suitably, the expression vector, expression vector combination, inhibitory nucleic acid, CRISPR composition or composition can be administered by injection into the ventricle. In one embodiment, the expression vector, expression vector combination, inhibitory nucleic acid, CRISPR composition or composition can be administered by injection into the spinal cord or lateral ventricle. In one embodiment, the expression vector, expression vector combination, inhibitory nucleic acid, CRISPR composition or composition can be administered by intrathecal injection.

[0266] The expression vector, expression vector combination, inhibitory nucleic acid, CRISPR composition or composition of the present invention can be administered as a single dose, in other words, no subsequent doses may be required. In the case where repeated doses are required, different viral serotypes can be used in the vector. For example, the vector used in the first dose may include AAV2 or AAV8, and the vector used in subsequent doses may include AAV9. The expression vector, expression vector combination, inhibitory nucleic acid, CRISPR composition or composition of the present invention can be administered once a day, once every two days, once every three days, once a week, twice a day, three times a day, or more.

[0267] The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions of the present invention can be administered at different doses (e.g., measured as vector genomes (μg) / kg). In any case, the physician will determine the actual dose that is most suitable for any individual subject and will vary with the age, weight and response of the particular subject. In some embodiments, the expression vector content in the composition is 1×10 11 -1×10 14 Viruses / ml, preferably 1×10 12 -1×10 13Viruses / ml. In some embodiments, the dosage of inhibitory nucleic acid is about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg. The intermediate values ​​and ranges of these quoted values ​​are also intended to be part of the present invention. In some embodiments, the CRISPR composition includes a Cas enzyme, a gRNA, and an acceptable carrier, and the dosage thereof is about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg. Values ​​and ranges intermediate to these recited values ​​are also intended to be part of the present invention.

[0268] Example

[0269] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0270] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0271] Experimental methods

[0272] 1. Experimental Model

[0273] Cell lines

[0274] This study used human osteosarcoma cell line U2OS, hypothalamic GnRH cell line GT1-7, neuroblastoma cell line SH-SY5Y, human embryonic kidney cell line HEK293T and human liver epithelial cell line THLE-2. All human cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, C11995500CP), supplemented with 10% fetal bovine serum (Mediatech, 35-081-CV) and 1% penicillin and streptomycin (Hyclone, SV30010), and maintained at 37°C in an environment containing 5% CO2.

[0275] CRISPR KO cell lines

[0276] Guide RNAs (gRNAs) targeting the ATXN2 gene (5'-GTATTGGAAATACCCCCAGT-3') and the ATXN2L gene (5'-CCCCGGATCTTAAAGGAGGA-3') were designed using the online software Benchling (https: / / benchling.com / editor). The guide RNA sequences were then cloned into the pX459 vector following the protocol established in the CRISPR genome engineering toolbox of the Zhang laboratory.

[0277] After transfection, cells were cultured in the presence of 1 μg / mL puromycin for 3 days to select single clones with successful knockout. Single colonies were collected and knockout cells were verified by western blotting, immunostaining against target proteins, and sequencing.

[0278] Mouse Model

[0279] Atxn2- / - mice (strain number T016843) and Atxn2lflx / flx mice (strain number T052332) were purchased from GemPharmatech (Nanjing, China). Vip-IRES-Cre mice were generously provided by Dr. Zhong Yi's laboratory at Tsinghua University. C57BL / 6J controls of the same age were obtained from the Laboratory Animal Resource Center of Tsinghua University. All animal experiments described in this study were performed in accordance with the guidelines and approved by the Institutional Animal Care and Use Committee of Tsinghua University and the Animal Welfare and Ethics Committee of Tsinghua University. All mice were housed in a pathogen-free barrier facility. Wild-type, Atxn2 knockout mice (Atxn2+ / - and Atxn2- / -), and Atxn2l tissue-specific Cre-driven knockout mice (Atxn2lflx / + and Atxn2lflx / flx) of the same age were randomly selected for experiments.

[0280] 2. Experimental details

[0281] Protein synthesis analysis was performed using the Click-iT HPG system.

[0282] U2OS cells were synchronized for two hours using 200 nM dexamethasone. The medium was then replaced with DMEM without dexamethasone. To prepare the Click-iT HPG working solution, the stock solution was diluted 1:1000 in pre-warmed medium without L-methionine to achieve a final HPG concentration of 50 μM. 30 minutes before the indicated time, the medium was replaced with the HPG working solution. After incubation at 37 °C for 30 minutes, the cells were washed once with PBS and fixed with 4% formaldehyde. Alexa Fluor 488 azide was then coupled to HPG via a click reaction. HPG-incorporated proteins were subsequently detected using confocal microscopy.

[0283] Polysome profiling

[0284] 10% and 50% sucrose solutions were prepared in polysome buffer containing 20mM Tris-HCl pH 7.4, 15mM MgCl2, 150mM NaCl under RNase-free conditions. BioComp Model 108 Gradient Master was used to prepare 10%-50% sucrose gradients for polysome separation. For cultured U2OS cells, one 15cm dish was treated with 0.1mg / mL cycloheximide for 10 minutes. Cells were rinsed twice with 1× PBS containing 0.1mg / mL cycloheximide, collected and resuspended in 20mM Tris-HCl pH 7.5, 15mM MgCl2, 150mM NaCl, 1% Triton X-100, 0.1mg / mL cycloheximide, 1mM DTT, 2U / μL mouse RNase inhibitor and 1× protease inhibitor. The solution was incubated on ice for 10 minutes and then centrifuged at 12,000 g for 10 minutes at 4° C. The clarified supernatant from the lysed cells was loaded onto a 10-50% sucrose gradient and centrifuged at 36,000 rpm at 4° C. for 120 minutes using a Beckman SW41 rotor.

[0285] For mouse brain tissue and liver tissue, 50 or 20 mg of tissue powder was lysed with polysome lysis buffer, respectively. After incubation on ice for 20 minutes, the resuspended solution was centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant from the lysed tissue was loaded onto a 10-50% sucrose gradient and centrifuged at 36,000 rpm, 4°C for 120 minutes using a Beckman SW41 rotor.

[0286] An ISCO gradient fractionation system (ISCO Model 160 Gradient Former Foxy Jr. Fraction Collector) was used to separate sucrose gradient components, and the abundance of ribosomal RNA was observed by monitoring the absorbance at 254 nm.

[0287] Surface induction of translation (SUnSET) assay

[0288] The SUnSET assay measures mRNA translation rates by measuring the extent of puromycin incorporation. In this assay, cells were synchronized with dexamethasone and then replaced with fresh culture medium containing 1 μg / mL puromycin at different time points. After incubation at 37 ° C for 30 minutes, the cells were washed with ice-cold 1×PBS and lysed with RIPA buffer (50mM Tris pH7.4, 150mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS). Similarly, in mouse liver tissue, 100 μL of 20mM puromycin in PBS was intraperitoneally injected into 8-week-old mice. After 1 hour, the tissues were collected, quickly frozen in liquid nitrogen, ground with a pestle, and lysed with RIPA buffer. Protein concentration was measured using the BCA protein assay, and protein lysates were analyzed by SDS-PAGE and Western blot using anti-puromycin antibodies to detect the extent of puromycin incorporation.

[0289] To measure the rate of protein synthesis in the mouse brain, puromycin was stereotaxically injected into the left ventricle of the mouse brain. Mice were anesthetized with isoflurane and fixed using a stereotaxic frame equipped with a heating blanket to maintain body temperature throughout the procedure. After removing hair and cleaning the shaved area with iodine and alcohol, a small incision was made to expose the skull surface, and a small hole was drilled in the skull to allow the injection of 3 μL of puromycin (10 mg / mL) using a nanoliter syringe. The injection rate was controlled by a pump at 0.2 μL / min. The needle remained in place for 10 minutes and then was slowly withdrawn. One hour after the injection, the mice were perfused with saline and then 4% paraformaldehyde (PFA), and the brain was immediately removed and fixed in 4% PFA for immunofluorescence analysis. Sagittal brain sections were stained with anti-puromycin primary antibody overnight at 4°C, and then fluorescently conjugated secondary antibodies (Alexa Fluor 594) were incubated for 1 hour at room temperature in the dark and then stained with DAPI. Images were acquired using an Olympus IXplore spinning disk microscope.

[0290] Gene evolution tree construction

[0291] To obtain orthologs of ATXN2 and ATXN2L proteins, the inventors searched for homologous sequences in several organisms, including Saccharomyces cerevisiae, Drosophila melanogaster, Caenorhabditis elegans, and metazoans using the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ) and EnSDbl (https: / / asia.enSDbl.org / index.html) websites. The resulting ATXN2 / ATXN2L homologous proteins (Table S2) were used to construct an evolutionary tree. The amino acid sequences were aligned using the Clustal W program, and the evolutionary tree was constructed using the MEGA-X software, using the neighbor-joining method and 1,000 bootstrap replications.

[0292] Ribosome profiling (Ribo-seq) library preparation and sequencing

[0293] For each sample, a 15 cm U2OS cell culture dish was treated with 0.1 mg / mL cycloheximide at 37°C for 1 minute. The cells were then rinsed once with ice-cold PBS containing 0.1 mg / mL cycloheximide, followed by 300 μL lysis buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 1 mM DTT, 25 U / mL TURBO DNase and 0.1 mg / mL cycloheximide). The cell lysate was incubated on ice for 10 minutes, and then the supernatant was separated by centrifugation at 20,000 rcf for 5 minutes at 4°C. The RNA concentration of the supernatant was determined by measuring the absorbance at 260 nm using a spectrophotometer.

[0294] To generate ribosome protection fragments (RPFs), cell lysates were digested with 90U / A260 / mL (A260 of cell lysate minus A260 of lysis buffer) of RNase I at 4°C for 30 minutes with gentle rotation. The digested cell lysate was then overlaid on a 1M sucrose cushion and ribosomes were precipitated by centrifugation at 70,000rpm for 2 hours at 4°C in a Beckman 90Ti rotor. The ribosome pellet was then dissolved in 1mL TRIzol reagent and the RNA sample was purified according to the manufacturer's instructions. RNA samples were separated on a 15% (wt / vol) polyacrylamide TBE-urea gel and gel slices corresponding to 26-34nt were cut. RPFs were recovered by adding 0.4mL RNA extraction buffer (400mM ammonium acetate, 0.05% SDS) to the broken gel slices, rotating overnight at room temperature and precipitating with isopropanol.

[0295] Total RNA samples were heat-lysed at 94°C with T4 polynucleotide kinase buffer (NEB) for 20 min. Next, the fragmented total RNA samples and RPFs were subjected to library preparation. Briefly, RNA samples were end-repaired with T4 PNK and ligated with pre-adenylated 3' adapters, followed by cDNA synthesis and purification. The cDNA was then circularized by CircLigase ssDNA ligase, and the libraries were indexed during PCR amplification. The libraries were pooled and sequenced on the HiSeq X Ten platform, and 150bp paired-end reads were generated. Sequencing was performed by Anuoyou Gene Technology Co., Ltd.

[0296] RNA-seq and Ribo-seq data processing and analysis

[0297] Adapter sequences (5'-CTGTAGGCACCATCAAT-3') were removed from mRNA and Ribo-seq data using Cutadapt, and low-quality reads were discarded using fastx quality filters (http: / / hannonlab.cshl.edu / fastx_toolkit / ). Quality control was performed using FastQC (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ). Contamination with ribosomal RNA was identified by aligning reads to human rRNA sequences using Bowtie, and the corresponding reads were removed from subsequent analysis. Reads with a length of 25-35 nt were retained for ribosome profiling.

[0298] RNA sequencing reads were counted using HTSeq-count in intersection-strict mode, while RPF reads were counted using a custom Python script by Xiao. Raw counts of ribosome footprints and RNA were normalized using DESeq2 to eliminate the bias of sequencing depth. Normalized RPF counts were further normalized by the sum of mitochondrial RPFs. RPF counts were divided by RNA counts to obtain translation efficiency. Statistical analysis of differentially transcribed genes in each pair of samples was performed using the R package Xtail.

[0299] Flow cytometry to measure cell apoptosis

[0300] Cells were first seeded into 35 mm culture dishes and synchronized with 200 nM dexamethasone (DXMS) for two hours. Cell apoptosis was then assessed by flow cytometry analysis using the Annexin V-FITC Apoptosis Detection Kit (Solarbio, CA1020), using Annexin V-FITC staining and propidium iodide (PI). The synchronized cells were then washed in cold PBS and digested at eight-hour intervals, with each time point repeated twice. After digestion, the cells were centrifuged and resuspended in binding buffer. Cells were stained with FITC-labeled Annexin and analyzed by flow cytometry. For double staining, PI was added 5 minutes before flow cytometry analysis using a CytoFlex LX flow cytometer.

[0301] Cell proliferation assay

[0302] In this experiment, cells of different genotypes (WT, ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout) were seeded into 48-well plates at a starting density of 12,000 cells per well. After 12 hours of seeding, cells were treated with 200 nM DXMS for two hours to synchronize the cells. Then, the medium was replaced with fresh medium without DXMS, and real-time cell proliferation was monitored using the IncuCyte Live Cell Analysis System (ESSEN Bioscience).

[0303] Cell proliferation capacity was measured by quantifying the cell confluence of cell images over time. Proliferation curves were plotted by calculating the fold change (FC) of cell confluence at different time points compared to the confluence at time 0. This experiment was designed to compare the cell proliferation capacity of cells of different genotypes under these conditions.

[0304] Cell cycle analysis using flow cytometry

[0305] U2OS cells were synchronized with DXMS and then stained with Hoechst 33342 to monitor their cell cycle progression over a 24-hour period. Staining was performed by adding 1 μg / mL Hoechst 33342 to the cells and incubating for 30 minutes. The cells were then washed 3 times with PBS and collected at 8-hour intervals for 24 hours, with 2 replicates per time point. The cells were collected and the supernatant removed by centrifugation at 1000 rpm for 5 minutes. The cell pellet was resuspended in cold PBS and cell cycle analysis was performed using a 405 nm UV laser and a CytoFlex LX flow cytometer.

[0306] Real-time quantitative PCR

[0307] Total RNA was extracted from cultured cells or dissected tissues using TRIzol (Invitrogen Ambion, Shanghai) according to the manufacturer's protocol. III 1st Strand cDNA Synthesis SuperMix for qPCR (YEASEN) was used for reverse transcription. Gene-specific primers (Table S1) and SYBR green supermix were used in Bio-Rad CFX96 or Roche Quantitative reverse transcription-PCR (qRT-PCR) was performed on a 480°C thermal cycler. Quantitative analysis was performed using the ΔΔCT method, with actin as an internal control.

[0308] For AAV titration, viral particles were cleaved with proteinase K and a portion of the WPRE element was amplified using WPRE-F and WPRE-R primers. The pAAV plasmid containing the Cre sequence was used as a standard stock.

[0309] Immunofluorescence (IF)

[0310] Cells grown on glass-bottom confocal dishes were fixed with 4% paraformaldehyde solution for 15 minutes, permeabilized with 0.5% Triton X-100 in phosphate-buffered saline (PBS) for 15 minutes, and blocked with 10% normal goat serum for 30 minutes at room temperature.

[0311] To stain mouse tissue sections, animals were deeply anesthetized with Avertin, then intracardially perfused with ice-cold 0.01M PBS, followed by 4% PFA in PBS (pH 7.4). The brain and liver were dissected and fixed overnight in 4% PFA at 4°C. The tissues were rinsed with PBS and then transferred to PBS containing 30% sucrose for 24 hours. Afterwards, they were frozen on dry ice and embedded in OCT. Coronal sections of the brain (14 μm) or liver (7 μm) were cut at -20°C with a cryostat (Leica, CM3050S). Tissue sections were permeabilized with 0.5% Triton X-100 in PBS for 30 minutes at room temperature and blocked with 10% normal goat serum for 1 hour at room temperature.

[0312] Cells and tissue sections were stained with primary antibodies against ATXN2 (Proteintech, 21776-1-AP) or ATXN2L (Proteintech, 24822-1-AP) at 4°C overnight. The corresponding fluorescent conjugated secondary antibodies (AlexaFluor488 / 594, Thermo Fisher Scientific, goat anti-rabit) were then incubated at room temperature in the dark for 1 hour. Cells and tissues were then stained with DAPI. Images were acquired using a Nikon AX confocal microscope and an Olympus IXplore spinning disk microscope.

[0313] Immunogold electron microscopy analysis

[0314] White adipose tissue (WAT) and liver were fixed in 0.1M Sorensen phosphate buffer (pH=7.2) containing 3% formaldehyde and 0.2M sucrose. Tissue samples were sectioned and processed by the University of Michigan Microscopy Core. Ultrathin sections (80nm) were cut, placed on bare nickel grids, and stored at 4°C. For immunogold labeling, grids were quenched in 80mM glycine and incubated in blocking solution (EMS25599) containing 0.2% Tween-20 for 1 hour at room temperature. Next, the grids were incubated with primary antibodies overnight in a humidified chamber at 4°C. The grids were then incubated with 18nm colloidal gold antibody (1:25v / v, JacksonImmunoResearch 711-215-152) at room temperature for 1 hour, followed by post-fixation in 1% glutaraldehyde and contrast staining using 0.5% uranyl acetate. After carbon evaporation, the grids were imaged using a JEOL electron microscope at the University of Michigan Microscopy Core.

[0315] Protein conservation analysis

[0316] ATXN2 and ATXN2L homologous protein sequences from 200 species were retrieved from EnSDbl (https: / / www.enSDbl.org / , version 107, 2022-08-16). Multiple sequence alignment (MSA) was performed using Clustal Omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) with default settings. Protein site conservation scores were calculated using ConSurf with a Bayesian model and default settings.

[0317] Protein expression and purification

[0318] The coding sequences of ATXN2 LCD (amino acids 1125-1312), ATXN2L LCD (amino acids 875-1075), FUS LCD (amino acids 1-214), and YTHDC1 LCD (amino acids 494-727) were amplified from human cDNA and cloned into the pHis empty vector with an N-terminal 6×His tag. All ATXN2 LCD mutations were introduced by site-directed mutagenesis. BL21-(DE3)-RIPL E. coli cells were used to express the recombinant proteins. Briefly, BL21(DE3) cells were transformed with the corresponding plasmids and plated on LB agar with ampicillin selection at 37°C. Single colonies were inoculated into 5 mL LB cultures and grown overnight in a shaker at 37°C at 220 rpm. The cultures were added to 1 L LB medium and grown at 37°C until OD600 reached 0.6. Cells were induced with 0.5 mM IPTG at 220 rpm for 4 hours at 37 ° C, and then centrifuged at 4,000 rpm for 25 minutes at 4 ° C to collect the cells. The pellet was resuspended in a denaturing lysis buffer (20 mM Tris-HCl pH 7.4, 200 mM NaCl, 6 M guanidine hydrochloride, 0.1 mM PMSF, 20 mM β-mercaptoethanol and a protease inhibitor cocktail) and then sonicated with a cell ultrasonic disruptor for 20 minutes (10 seconds on / 10 seconds off, 180 W). After centrifugation at 20,000 g for 40 minutes, the supernatant was collected and loaded onto a Ni-NTA resin and incubated for 30 minutes at 4 ° C. The Ni-NTA resin was washed with a wash buffer (20 mM Tris-HCl pH 7.4, 200 mM NaCl, 6 M guanidine hydrochloride, 0.1 mM PMSF, 20 mM β-mercaptoethanol and 20 mM imidazole) and eluted with an elution buffer (200 mM NaCl, 20 mM Tris-HCl pH 7.4, 6 M guanidine hydrochloride, 0.1 mM PMSF, 20 mM β-mercaptoethanol and 300 mM imidazole). The purified protein was further concentrated to 2-4 mM using an Amicon filter (Millipore). All protein purities were confirmed by SDS-PAGE.

[0319] To label the purified protein with fluorescent dye, 200 ng / mL Alexa Fluor 488 / 568-C5-maleimide (Thermo Fisher Scientific) was added and the mixture was incubated on ice for 1 h in the dark. Free dye was removed using a spin desalting column (Cytiva). After equilibration, the protein sample was loaded onto the desalting column and centrifuged at 2,000 g for 1 min at 4 °C. The protein that flowed through the column was collected for future use.

[0320] In vitro phase separation assay

[0321] Phase separation assays were performed using glass-bottom 384-well plates. The purified proteins were diluted into dilution buffer containing 50-1000 mM NaCl and 20 mM Tris-HCl pH 7.4 to achieve a final protein concentration (2.5-120 μM for ATXN2 LCD, 10-80 μM for ATXN2L LCD, 60 μM for FUS LCD, and 65 μM for YTHDC1). The resulting phase-separated droplets were added to 384-well plates and allowed to stand at room temperature for 30 minutes. Images of the condensates were captured using an Olympus IXplore spinning disk microscope.

[0322] Measuring fluorescence recovery after photobleaching (FRAP)

[0323] To evaluate the fluidity of phase-separated droplets formed by ATXN2 and ATXN2L LCD, the inventors performed FRAP using a Nikon A1HD25 confocal microscope. Protein condensates were bleached with a 561nm or 488nm laser pulse, and the fluorescence recovery intensity was recorded for 500 seconds at 5-second intervals for ATXN2LCD and for 360 seconds at 10-second intervals for ATXN2LLCD. The fluorescence intensity of the bleached area was analyzed using NIS-Elements AR 5.4 software, and the recovery curve indicating the change in fluorescence intensity over time was plotted using GraphPad Prism. Six parallel replicates were performed, and the data are presented as mean ± standard deviation (SD).

[0324] Immunoblotting

[0325] Cells were lysed with RIPA buffer on ice for half an hour and then centrifuged at 12,000 rpm for 5 minutes at 4°C for supernatant separation. Mouse tissues were first frozen in liquid nitrogen and then homogenized into fine powder. Lysates were obtained by sonicating the tissues at 90W for 10 seconds in RIPA buffer and then centrifuged. 10 or 20 μg of protein samples were separated by SDS-PAGE on 8% or 12% polyacrylamide gels and transferred to PVDF membranes. The membranes were incubated with specific primary antibodies overnight at 4°C. The blots were then incubated with peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific) at room temperature for 1 hour. The membranes were washed three times with TBS-T (10mM Tris-HCl pH 7.4, 0.15M NaCl, 0.05% Tween-20) for 5 minutes each time, and protein bands were observed by chemiluminescence using the Tanon4800Multi imaging system. The grayscale values ​​of the bands were quantified using ImageJ software.

[0326] Cryo-grinding immunoprecipitation

[0327] U2OS cells were synchronized with 200nM DXMS for two hours and then collected and cryogenically frozen at four-hour intervals over a 24-hour period (repeated 3 times at each time point). The frozen cells were then ground into a fine powder and resuspended in 2 volumes of lysis buffer, which consisted of 20mM HEPES / KOH pH 7.4, 150mM NaCl, 0.1% (w / v) NP-40, 0.1% (w / v) Tween-20, 1mM DTT, 2% (v / v) glycerol, and 1 / 100 (v / v) protease inhibitor cocktail (SigmaAldrich). The cell lysate was briefly sonicated and centrifuged at 20,000g for 10 minutes. Magnetic protein A / G beads coupled to the ATXN2 antibody were added to the cell lysate at a concentration of 400μg beads per 0.1 gram of frozen cell powder and incubated at 4°C for 5 minutes. The beads were washed three times with 1mL lysis buffer. Protein was eluted using 0.2M glycine (pH 2.0). Prior to mass spectrometry (LC-MS / MS) analysis, samples were added to 6× protein loading buffer and incubated at 95° C. for 20 min.

[0328] Mass spectrometry data acquisition and analysis

[0329] Proteins co-immunoprecipitated with ATXN2 were separated on 1D-SDS PAGE. The corresponding gel lanes were excised, reduced with 10 mM TCEP, and alkylated with 40 mM chloroacetamide. In-gel digestion was performed overnight at 37°C using sequence grade modified trypsin (Promega) in 50 mM ammonium bicarbonate. The resulting peptides were extracted twice with 50% acetonitrile in water containing 1% trifluoroacetic acid for 30 minutes each. The extracts were then centrifuged in a speedVac to reduce the volume.

[0330] The UltiMateTM 3000RSLCnano system was directly connected to a Q Exactive HF-X mass spectrometer for LC-MS / MS analysis. The peptides were loaded onto a trapping column (75 μm × 20 mm, 3 μm C18, The samples were then separated on an analytical column (100 μm inner diameter, filled internally with ReproSil-Pur C18-AQ 1.9 μm resin from Dr. Maisch GmbH) with a gradient of 4-70% mobile phase B (80% acetonitrile and 0.08% formic acid) at a flow rate of 250 nL / min for 120 min. MS analysis was performed in data dependent acquisition (DDA) mode with one full scan (300-1800 m / z, resolution = 60,000, 200 m / z), automatic gain control (AGC) of 3e6, and maximum injection time (IT) of 20 ms. This was followed by the first 40 MS / MS scans with high energy collision dissociation (AGC of 2e5, maximum IT 100 ms, isolation window 0.4 m / z, normalized collision energy of 32%, resolution = 45,000, 200 m / z).

[0331] For proteomics data analysis, the MS / MS data were searched against the Uniprot mouse database using the SEQUEST search engine in Proteome Discoverer 2.3 software. The search criteria required full trypsin specificity, allowed two missed cleavages, and set carbamidomethylation (C) as a fixed modification. Oxidation (M) and acetylation (protein N-terminus) were set as variable modifications. The precursor ion mass tolerance was set to 10 ppm for all MS acquired in the Orbitrap mass analyzer and the fragment ion mass tolerance was set to 20 mmu for all MS2 spectra acquired. The false discovery rate for peptides was set to 0.01 and determined by searching the reverse database. Relative protein quantification was calculated as the median of all possible pairwise peptide ratios.

[0332] Bioinformatics and statistical analysis of proteomics data

[0333] For proteomic analysis of wild-type U2OS cells based on protein expression patterns over 24 hours, the inventors used a fuzzy c-means clustering algorithm and identified seven distinct groups of genes. The center of each group is indicated by a blue line in the figure, while the y-axis represents normalized protein abundance. The inventors performed fuzzy clustering analysis on the proteomic data using the R package Mfuzz and removed genes with missing values ​​at six time points before clustering. The abundance values ​​of the remaining genes were Z-score transformed before fuzzy c-means clustering.

[0334] The inventors used the R package RAIN to detect rhythmic proteins with a period of 24 hours, a period increment of 4, and a p-value cutoff of <0.05. The RAIN algorithm is an improved version of JTK-Cycle, which provides excellent sensitivity in rhythmicity analysis by detecting symmetric and asymmetric rhythms. Rhythmic proteins were classified by the phases expected by RAIN, and the frequency distribution of cycle candidates in different phases was visualized using rose plots generated using ggplot2 (https: / / rdocumentation.org / packages / ggplot2 / versions / 3.3.6).

[0335] The inventors used all ATXN2-related proteins and rhythmic proteins with peak values ​​at different time points (p value ≤ 0.05) to perform gene ontology (GO) analysis using metascape (https: / / metascape.org / gp / index.html# / main). Translation-related proteins, translation initiation factors, and ribosomal components were classified, and the temporal abundance curves of each protein at different time points were visualized as heat maps using TB Tools. GO classifications at different time points were visualized in bubble plots using ggplot2. In addition, the inventors clustered ATXN2 immune proteins at a peak value of 16 hours using STRING (https: / / cn.string-db.org / ) and Cytoscape.

[0336] Cell aggregate analysis

[0337] To determine whether ATXN2 forms cell condensates in representative images from different cell lines, the staining images were reconstructed using MATLAB. Specifically, the imread() function was used to read the images and generate a three-dimensional variable, where the first two dimensions represent the size of the image and the last dimension records the grayscale intensity of the color channel associated with the protein. The grayscale value of the image was then read using the rgb2gray() function. To standardize the image parameters, the image was converted to two dimensions and the size was set to 300x300, which corresponds to the length and width of the inventor's image. The meshgrid() function was used to convert and visualize the two-dimensional array variable into three dimensions. Finally, the mesh() function overlaid the 3D results of the previous step with the 2D image for analysis.

[0338] Purification of human 80S ribosomal subunit

[0339] HEK 293T cells were cultured and treated with 0.1 mg / mL cycloheximide for 10 minutes at 37°C and 5% CO2. The cells were then washed twice with 0.1 mg / mL cycloheximide in 1× PBS. Afterwards, the cells were resuspended in a lysis buffer consisting of 20 mM Tris-HCl pH 7.4, 15 mM MgCl2, 50 mM KCl, 0.5 mM EDTA, 1% Triton X-100, 0.1 mg / mL cycloheximide, 2 mM DTT, 2 U / μL mouse RNase inhibitor, and 1× protease inhibitor. The samples were incubated on ice for 10 minutes and then centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was loaded onto a 9 mL sucrose cushion (20 mM Tris pH 7.5, 15 mM MgCl2, 50 mM KCl, 0.5 mM EDTA, 34% sucrose, 2 mM DTT, and 2 U / μL mouse RNase inhibitor) in a 16 mm x 76 mm polycarbonate ultracentrifuge tube. The crude ribosomes were precipitated by centrifugation at 70,000 rpm for 2 hours using a Beckman 90Ti rotor. The resulting pellet was slowly homogenized in lysis buffer at 4°C. The crude ribosomal subunits were further purified using a 10-40% sucrose gradient prepared using a BioComp Gradient Master in ribosome fraction buffer (sucrose diluted in a buffer containing 15 mM Tris-HCl pH 7.4, 15 mM MgCl2, and 300 mM NaCl prepared under RNase-free conditions). The crude subunits were loaded onto the gradient and centrifuged at 36,000 rpm (Beckman SW41Ti rotor) for 2 hours at 4°C. Fractions were collected from top to bottom using a BioComp piston gradient fractionator. Sample absorbance was recorded using a UV reader, and the fractions corresponding to 80S were collected and used for the third purification. A solution of 10.5% PEG 20,000 was slowly added to the 80S fraction, followed by incubation on ice for 10 minutes and centrifugation at 10,000 rpm, 4°C for 10 minutes. Finally, the purified 80S ribosome was resuspended in 200 μL buffer containing 150 mM NaCl, 20 mM Tris-HCl pH 7.4 and 1× protease inhibitors to a final concentration of 5 mg / mL.

[0340] Phase separation in vitro recruitment assay

[0341] The purified 80S ribosome solution was added to a phase separation buffer containing 25 mM Tris-HCl pH 7.5 and 150 mM NaCl to a final concentration of 0.5 mg / mL. The purified proteins, including ATXN2 LCD, ATXN2LLCD, FUS LCD, and YTHDC1 LCD, were then diluted 1:50 into this 80S-containing buffer, resulting in a final concentration of 40 μM for ATXN2 LCD, ATXN2LLCD, and FUS LCD, and 20 μM for YTHDC1 LCD. The resulting condensates were then allowed to settle in a 384-well plate at room temperature for 30 minutes, and images of the condensates were captured using an Olympus IXplore spinning disk microscope.

[0342] To test RNA recruitment, DNA sequences of PER2 5'UTR and 3'UTR, FAM199X 3'UTR, BMAL1 3'UTR, CLOCK 3'UTR, PER1 3'UTR, CRY1 3'UTR, CRY2 3'UTR, WFS1 3'UTR, and RRBP1 3'UTR (listed in Table S4) were amplified by PCR from cDNA extracted from HEK293T cells using a 5' primer containing a T7 RNA polymerase promoter sequence (5'-TAATACGACTCACTATAGGG-3'). Target RNA fragments were obtained using an in vitro transcription kit (Thermo Fisher Scientific). Subsequently, Turbo DNase was added to eliminate the DNA template, and then RNA was labeled with red fluorescence using propidium iodide. The RNA was then mixed with propidium iodide at a ratio of 1:5 and diluted to a concentration of 250 ng / μL with phase separation dilution buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl). The phase-separated protein was added to the system to a final protein concentration of 50 μM. The protein-RNA mixture was incubated at room temperature for 30 minutes, and images of the condensate were taken using an Olympus IXplore spinning disk microscope.

[0343] RNA fluorescence in situ hybridization

[0344] All reagents used for RNA fluorescence in situ hybridization were from RNAscope TMMultiplex Fluorescent V2Assay (ACD). Mouse brain sections were treated with hydrogen peroxide for 10 minutes at room temperature. The slides were then target retrieved using RNAscope 1X Target Retrieval Reagent at 99°C for 15 minutes. After treatment with RNAscope Protease III for 10 minutes, the brain tissue was placed in a HybEZ oven and hybridized with the Mouse-Per2 probe at 40°C for 2 hours. The slides were washed twice with preheated wash buffer (ACD). Subsequently, the probe signal was amplified using AMP solution and labeled with the fluorophore Opal 690. After multiple washes, immunofluorescence staining was followed.

[0345] Single-molecule fluorescence in situ hybridization combined with immunocytochemistry

[0346] Hypothalamic GbRH GT1-7 cells were cultured on coverslips in 24-well plates and fixed with 4% PFA for 15 min at room temperature. The cells were then stored in 1× PBS containing 0.5% bovine serum albumin (BSA). For the hybridization chain reaction assay (HCR), public codes were used to design Per2 probes targeting mRNA sequences. The probe sequences were synthesized by Sangon Biotech, China.

[0347] For HCR, cells were first permeabilized in 70% ethanol for 16 h at 4 °C and then treated with 0.5% Triton X-100 in 1 × PBS for 30 min at 37 °C. Cells were then washed with 1 × PBS at room temperature and prehybridized in 30% probe hybridization buffer at 37 °C for 15 min, followed by incubation in 30% probe hybridization buffer containing the Per2 probe for 3 h at 37 °C. After mRNA hybridization, washing and amplification steps were performed as described previously.

[0348] For immunocytochemistry assays, HCR-labeled sections were further stained. HCR-labeled sections were first blocked with 10% donkey serum in 1× PBS for 1 hour, and then incubated with ATXN2 antibody diluted in 1× PBS solution containing 1% donkey serum, 1% BSA, and 0.1% Triton X-100 at 4°C for 12 hours. The cells were then washed three times with 1× PBS and stained with secondary antibodies for 2 hours at room temperature. Finally, the stained cells were mounted on slides for further imaging using an Olympus IXplore spinning disc microscope.

[0349] In vitro translation assay

[0350] use In vitro translation assays were performed using Quick Coupled Transcription / Translation Systems (Promega). To create plasmids T7-luciferase-PER2-3'UTR, T7-luciferase-CRY1-3'UTR, T7-luciferase-WFS1-3'UTR, and T7-luciferase-RRBP1-3'UTR, the corresponding 3'UTRs were inserted downstream of the luciferase sequence with a T7 promoter that was modified based on the luciferase T7 control DNA in the kit. Quick Master Mix, 1 mM methionine, and plasmid DNA templates (T7-luciferase, T7-luciferase-PER2-3'UTR, T7-luciferase-CRY1-3'UTR, T7-luciferase-WFS1-3'UTR, and T7-luciferase-RRBP1-3'UTR) were mixed under RNase-free conditions. To investigate the effect of ATXN2 phase separation on translation, 2 μL of ATXN2 phase separation condensate or an equal amount of all M-to-S mutant proteins (60 μM) were added. The reaction was incubated at 30 °C for 1 h, and luciferase activity was measured using a luciferase reporter assay kit (YEASEN).

[0351] SunTag fluorescence imaging

[0352] SunTag-related plasmids, including pcDNA4TO-24×GCN4-v4-24×PP7 and pHR-scFv-GCN4-sfGFP-GB1, were kindly provided by Dr. Weirui Ma from Zhejiang University. The coding sequence and 3' untranslated region (UTR) of PER2 mRNA were inserted into the pcDNA4TO-24×GCN4-v4-24×PP7 backbone to generate the pcDNA4TO-24×GCN4-PER2_3UTR-24×PP7 plasmid. The ATXN2 coding sequence was also cloned into the pLVX vector, and the mCherry tag was fused to its N-terminus, resulting in the pLVX-mCherry-ATXN2 plasmid. To observe the colocalization of ATXN2 condensates and PER2 nascent peptides in living cells, U2OS cells were transfected with pLVX-mCherry-ATXN2, pcDNA4TO-24×GCN4-PER2_3UTR-24×PP7, and PHR-scFv-GCN4-sfGFP-GB1 for 12 h. Cells for PER2 translation observation were subsequently treated with 1 μg / mL doxycycline for 6 h. To confirm that the observed GFP signal corresponded to translation events, 100 μg / mL of the translation inhibitor puromycin was added to the culture medium during continuous live cell imaging. Images were taken using an Olympus IXplore spinning disk microscope.

[0353] Bioluminescence recording

[0354] The U2OS PER2:LUC cell line was kindly provided by Dr. Erquan Zhang, Beijing Institutes for Biological Sciences. To generate ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout cells, pX459 plasmid with ATXN2 / 2L knockout single guide RNA (sgRNA) was transfected into U2OS PER2:LUC cells. Recombinant DNA pLVX-EGFP-ATXN2-FL and pLVX-EGFP-ATXN2-LCD3 were then transfected into ATXN2 / 2L double knockout cells for complementation experiments. Cells were grown in 35 mm dishes and synchronized with 200 nM DXMS. The culture medium was replaced with recording medium containing 100 mM luciferin for recording bioluminescence. Data were collected in a LumiCycle luminometer at 36 °C for 3–4 days. Data (excluding the first 24 h cycle) were analyzed using LumiCycle analysis software as described previously.

[0355] Lentiviral production

[0356] HEK293T cells were used to produce lentiviral particles following an established protocol using second-generation packaging plasmids (pMD2.G and psPAX2). The lentiviral backbone and packaging plasmids (pLVX-EGFP-ATXN2-WT and pLVX-EGFP-ATXN2-ΔLCD3) were transfected into HEK293T cells, and the medium containing the lentivirus was harvested 24 hours later. The viral supernatant was collected and filtered through a 0.45 μm filter to remove cell debris. The lentivirus was added to the ATXN2 / 2L double knockout cells 2 days after inoculation. GFP-positive cells were then selected using flow cytometry.

[0357] Adeno-associated virus (AAV) packaging and stereotactic surgery

[0358] pAAV plasmids containing the rAAV genome were packaged into AAV8 capsids by triple transient transfection with polyethyleneimine. Viruses were harvested 6 days after transfection and purified by iodixanol density gradients. AAV particles were then concentrated in Amicon filter devices and titrated by real-time PCR.

[0359] For stereotaxic surgery, animals were anesthetized with isoflurane and placed in a stereotaxic apparatus. Depending on the experimental paradigm, 300 nL of AAV8-mCherry-IRES-Cre virus (~1×1012 vg / mL) was injected into the SCN at specific anatomical coordinates (ML: ±0.25 mm, AP: -0.40 mm, DV: 5.75 mm). Injections were performed using a glass cannula and a microinjection pump, entering each hemisphere sequentially at a flow rate of 100 nL / min. The glass cannula was left in place for 10 minutes and fully withdrawn 10 minutes after viral delivery. Animals were tested at least two weeks after viral injection to ensure optimal transgene expression. Correct viral expression in the SCN was confirmed post hoc using histology.

[0360] Behavioral analysis of locomotor activity rhythms in mice

[0361] To monitor circadian rhythms of locomotor activity, mice aged 8 to 12 weeks were housed individually in cages equipped with wheels placed in a light-tight box. At least seven days before the start of the experiment, mice were acclimated to a 12-h light / 12-h dark photoperiod (LD 12:12), with lights on at 7 a.m. (ZT0) and off at 7 p.m. (ZT12). Food and water were provided ad libitum. Behavioral rhythms were recorded for at least 7 days in LD and at least 14 days in constant darkness (DD). Actograms, χ2 periodograms, and fast Fourier transform (FFT) power spectrum analyses were performed using ClockLab software (Actimetrics, Wilmette, IL). χ2 periodograms were performed with 1-min resolution over a period range of 5–36 h in LD or DD. FFTs were performed in DD as power spectra normalized over a period range of 0 to 48 h / period. The effects of genotype on period length and amplitude in FFTs were analyzed using unpaired t-tests.

[0362] Open field test

[0363] The animal behavior in the open field was recorded using the automated system EthoVision XT14 (Noldus; TSE Multi-Conditioning System, TSE Systems). The open field experimental apparatus is a box with a size of 50cm x 50cm x50cm, and a light intensity of 300 lux is applied to the central area. The central area is defined as a 15cm x15cm square in the center of the box, and the rest of the box is defined as the peripheral area. Mice are introduced into the corner of the open field box and allowed to explore for 10 minutes. Between each experiment, the open air test equipment is cleaned with 70% alcohol to remove odors. EthoVision XT14 software is used to measure parameters, the total distance traveled and the time spent in the central area of ​​the open field in the last 5 minutes of each experiment.

[0364] Quantitative and statistical analysis methods

[0365] Unless otherwise stated, the figures were generated using GraphPad Prism software. The R packages used in the analysis and the statistical tests employed are described in their respective methods sections. Unless otherwise stated, all statistical tests were performed using GraphPad Prism software. Unpaired t-tests were used to compare two groups.

[0366] To quantify the results of the western blot analysis, ImageJ software was used. The normalized intensity presented as a bar graph was calculated by comparing the gray value intensity of the protein of interest to that of tubulin.

[0367] Example 1. Protein synthesis oscillates with circadian rhythm and is regulated by ATXN2 and ATXN2L

[0368] The inventors first focused on the rhythm of protein translation. Rhythmic protein synthesis was analyzed using the human bone osteosarcoma epithelial cell line U2OS, which is widely used in circadian rhythm research. To this end, the inventors treated U2OS cells with dexamethasone (DXMS), a powerful circadian rhythm inducer that resets and synchronizes the clocks in cultured cells, and labeled newly synthesized proteins with the non-classical methionine analog homopropargylglycine (HPG), which was visualized by azide-containing fluorescent dyes through a copper-catalyzed cycloaddition (CLICK) reaction. The inventors found that wild-type U2OS cells exhibited a clear circadian rhythm of translation activation within 48 hours ( Figure 1 A and 1B), it begins to increase 4 hours or 28 hours after the onset of the circadian rhythm (CT4 or CT28), reaches a peak at CT12-16 (and CT36-40, respectively), and then rapidly decreases. This translation oscillation is common in different cell types, as similar phenomena observed by the inventors in the liver cell line THLE-2 and the neuroblastoma cell line SH-SY5Y ( Figure 7 A and 8B).

[0369] Next, the inventors performed polysome fractionation analysis as an alternative method to assess global translation activity at different time points during the circadian cycle. Specifically, the ratio of the area under the curve for heavy polysomes (5+ ribosomes) and light polysomes (2-4 ribosomes) was defined as the "translation index" ( Figure 7 C). This analysis showed that the translation index of wild-type U2OS cells was low at CT4, peaked around CT12-CT16, and then declined at CT20-24. A similar oscillatory pattern was observed during the second circadian cycle ( Figure 1 C, 1D). This is consistent with Figure 1 The results shown in A and 1B are consistent. In addition, the inventors used surface translation sensing (SUnSET) technology to measure protein synthesis and detect rhythmic protein synthesis in corresponding cell lines ( Figure 7 D).

[0370] Oscillations in protein synthesis at the tissue level in mice have been reported. Consistent with previous results, the inventors observed similar oscillation patterns in brain and liver tissues ( Figure 1 E-1F, 8E-8F), and a higher translation index was observed at ZT12. After puromycin was injected into the lateral ventricle (Lv), the inventors observed rhythmic translation activation in the brain ( Figure 7 G). To assess the levels of newly synthesized proteins in the liver, the inventors injected puromycin intraperitoneally into mice and then performed Western blot analysis on whole liver tissue lysates ( Figure 1 G). Taken together, these results suggest that translation oscillations occur in both tissues.

[0371] The inventors next set out to identify potential regulators of this rhythmic translation. To this end, the inventors performed proteomic analysis of U2OS cells at six circadian time points. Using the fuzzy c-means clustering method, the proteins were then clustered into seven different groups based on their temporal expression patterns ( Figure 1 H, 8H). These seven groups represent different patterns of protein abundance changes with the circadian rhythm. Interestingly, the proteins in group 3 (522 in total) showed features that were highly consistent with the translation activation pattern of the biological clock ( Figure 1 AD and 1H).

[0372] Assuming that oscillating RNA-binding proteins (RBPs) are involved in the rhythmic activation of protein translation, we next calculated the fold changes of all group 3 proteins by comparing their peak levels at CT16 with their baseline levels at CT4 ( Figure 1 I). Interestingly, two RBPs ranked among the top 10 proteins with the largest increase from CT4 to CT16. One of these RBPs is ATXN2, which ranked second in our analysis ( Figure 1 I). Another RBP is DHX40, which is known to be mainly localized in the nucleus.

[0373] To better understand the role of ATXN2 in rhythmic translation oscillations, the inventors constructed an ATXN2 knockout U2OS cell line to explore the potential function of ATXN2 in circadian regulation. Figure 1As shown in Figures J and 8I, knockout of ATXN2 in U2OS cells resulted in a certain reduction in the heavy polysome fraction at CT12, indicating a slight decrease in the overall translation rate. The inventors performed bioinformatics analysis on ATXN2 and identified a paralog named ATXN2-like (ATXN2L), which has high domain similarity and sequence identity with ATXN2 ( Figure 7 I). From an evolutionary perspective, the phylogenetic tree of ATXN2 and ATXN2L orthologs suggests that ATXN2 and ATXN2L are rooted in a common ancestor, namely pbp1 in yeast and atx-2 in insects ( Figure 7 L).

[0374] Similar to ATXN2 knockout, knockout of ATXN2L resulted in a modest decrease in the translation index of CT12. Moreover, in ATXN2 / 2L double knockout cells, the translation index was significantly lower than that of WT, ATXN2 knockout, or ATXN2L single knockout cells on CT12 ( Figure 7 M).

[0375] As shown by changes in heavy polysomes at different circadian time points, the rhythm of translation activation was almost completely disrupted after ATXN2 and ATXN2L knockout ( Figure 1 D and 1K). HPG labeling analysis also confirmed that in our double knockout cells, the rhythm of translation activation was lost during both circadian cycles measured ( Figure 1 L and 1M). Interestingly, ATXN2L knockout cells exhibited a delayed phase shift compared to the advanced phase shift of ATXN2 knockout cells, suggesting a potential role for both proteins in regulating the circadian phase. Together, these results clearly demonstrate that ATXN2 / 2L together regulate oscillatory translational activation along the circadian rhythm

[0376] The above experiments show that knocking out or downregulating ATXN2 can accelerate the circadian rhythm, knocking out or downregulating ATXN2L can delay the circadian rhythm, and knocking out or downregulating both ATXN2 and ATXN2L can weaken the circadian rhythm.

[0377] Example 2. ATXN2 / 2L condensates oscillate synchronously with circadian rhythms

[0378] To investigate the potential mechanism of this rhythmic translation, the inventors next examined the expression and distribution of Atxn2 and Atxn2l at different time points by immunostaining of mouse tissues. The inventors found that Atxn2 and Atxn2l were significantly enriched in the SCN ( Figure 8 A). Interestingly, these two proteins appear to form perinuclear condensates in the SCN ( Figure 3 A). The inventors have observed similar condensates in other brain regions such as the cortex, hippocampus, and cerebellum ( Figure 8 B). Since many peripheral tissues also exhibit circadian rhythms, the inventors next examined Atxn2 and 2l expression in peripheral organs. Transmission electron microscopy (TEM) analysis of white adipose tissue (WAT) and liver showed that Atxn2 and Atxn2l formed cytoplasmic condensates, consistent with observations using fluorescence microscopy ( Figure 2 B-3C).

[0379] Together, these findings suggest that not only are ATXN2 / 2L expressed in a wide range of tissues, but that these proteins form condensates at specific intracellular locations, suggesting that phase separation is involved in their regulation. To test this hypothesis, the inventors set out to identify the drivers of phase separation of ATXN2 and 2L by performing in vitro phase separation experiments. Both ATXN2 and ATXN2L contain multiple domains with distinct features, including LSm (like-Sm) and LSm-related domains for RNA binding, a PABP-associated motif (PAM2), and a long low-complexity domain (LCD) at the C-terminus. The LCD of both proteins is conserved among orthologs from more than 200 species ( Figure 8 C and 8D).

[0380] As expected, the ATXN2 LCD(1125-1312) and ATXN2L LCD(875-1075) proteins phase separated in vitro in a protein concentration- and salt concentration-dependent manner ( Figure 2 D-3E, 8E-8F). We then used fluorescence recovery after photobleaching (FRAP) to define the liquid properties of ATXN2 and ATXN2L LCD droplets. Figure 2 As shown in F, the fluorescence was bleached and then recovered within a few minutes, indicating that the C-terminal LCD of ATXN2 / 2L can undergo liquid-liquid phase separation.

[0381] To evaluate the subcellular localization of ATXN2 / 2L in more detail, the inventors examined their presence in several cultured human cell lines, including the hypothalamic GnRH cell line GT1-7. The inventors detected significant ATXN2 / 2L condensates by immunofluorescence in U2OS, THLE-2, GT1-7, and HeLa ( Figure 2 G, 8G). Co-staining with organelle markers showed that ATXN2 condensates were cross-distributed with the endoplasmic reticulum ( Figure 8 H). The specificity of the antibody was verified in ATXN2 knockout cells ( Figure 8 I).

[0382] It is noteworthy that the inventors observed a high degree of heterogeneity in the number of ATXN2 condensates in the cytoplasm, a fact that may be related to the heterogeneity of the cellular circadian clock. Notably, once cells are synchronized, ATXN2 / 2L condensates oscillate in a time-dependent manner ( Figure 2 H), peaked at CT12 to CT16, and then decreased significantly. The inventors found that the number and size of ATXN2 condensates oscillated between 100-700 nm in diameter, synchronized with the DXMS-induced circadian rhythm ( Figure 8 J-8N). The inventors observed that THLE-2 cells ( Figure 8 O and 8Q), and also in the SCN region of the hypothalamus that oscillates along a 24-hour time period ( Figure 2 I and 8Q).

[0383] To dissect the mechanistic basis of the observed rhythmic oscillations of ATXN2 / 2L condensates, the inventors examined their protein levels in several synchronized cell lines. ATXN2 / 2L protein levels exhibited a rhythmic pattern that cycled over a 24-hour period ( Figure 2 J, 8R-8S). Atxn2 protein levels also fluctuate rhythmically in our mouse hypothalamus samples, where the central pacemaker SCN is located, and in other brain regions, such as the cerebellum and cortex ( Figure 2 K and 8T-8U). The inventors then analyzed the time-dependent changes in ATXN2 mRNA levels in U2OS cells and hypothalamic samples, which also exhibited a rhythmic pattern similar to the 24-h circadian cycle in both cell types ( Figure 8 V-8W).

[0384] Together, these results strongly suggest that the expression of ATXN2 and 2L cycles within a circadian cycle, leading to fluctuations and cycling of ATXN2 / 2L cellular condensates.

[0385] The above experiments indicate that the phase separation regulating function of ATXN2 and ATXN2L, especially the phase separation regulating function of the LCD region of ATXN2 and ATXN2L, is essential for maintaining the circadian rhythm cycle.

[0386] Example 3. ATXN2 forms oscillating translation initiation condensates

[0387] Since ATXN2 condensates oscillate in a circadian-dependent manner, the inventors attempted to isolate ATXN2 condensates at different time points to analyze their components. The inventors used the cryo-mill-IP technique, which performs rapid immunoprecipitation at a near-native starting concentration, which largely preserves the integrity of protein complexes and phase-separated condensates. The inventors synchronized U2OS cells and collected them at CT4, 8, 12, 16, 20, and 24, respectively, for subsequent IP mass spectrometry analysis. The inventors used the RAIN (Rhythmicity Analysis Combined with Nonparametric Methods) algorithm to analyze the proteins co-immunoprecipitated with ATXN2 at different time points and found that 52% of the ATXN2-associated proteins showed a 24-hour rhythm in the input (p-value < 0.05 and Fig. 9 A), showing that ATXN2 condensates are enriched for rhythmic cycling proteins.

[0388] Then, the inventors obtained different oscillation phase diagrams calculated by the RAIN algorithm, which classified each protein into groups that reached peak values ​​at different time points ( Fig. 9 B). The phases of the cycling proteins were essentially evenly distributed in the total input protein sample. In sharp contrast, proteins with oscillatory phases matching ATXN2(CT8-16) were enriched in ATXN2 co-immunoprecipitated proteins ( Figure 3 A). These results suggest that these proteins are recruited to ATXN2 condensates at specific times in the cycle. Gene Ontology (GO) analysis of the immunoprecipitated proteins showed strong enrichment for mRNA processing and translation ( Figure 3 B). In addition, proteins related to mRNA processing or metabolism were particularly enriched in CT12, while translation-related proteins peaked from CT12 to CT16 ( Figure 3 C) These results suggest that ATXN2 condensates regulate different steps of mRNA-related events in a sequential manner.

[0389] To further analyze the putative functions of ATXN2-related proteins in CT16, the inventors performed a network clustering analysis using a Markov clustering algorithm and a search tool for retrieving interacting genes / proteins (STRING 9.1). The largest network group in the network, containing 25 proteins, was called the "translation-related protein" group because it included many well-characterized translation factors, such as EIF2A, EIF3I, and ribosomal proteins ( Figure 3 D).

[0390] Further analysis showed that ATXN2-associated translation initiation factors and ribosomal proteins peaked between CT12 and CT16, whereas this pattern was absent in the overall input protein sample ( Figure 3E and 9C). These events coincided with the peak of ATXN2 condensate formation, which was most prominent at CT12-CT16. Interestingly, major translation initiation complex components, including EIF4G2, EIF4A4, EIF4B, EIF2A, and EIF2B, were enriched in ATXN2 condensates in a rhythmic manner, with the highest peak at CT12-CT16. The interaction between ATXN2 and the corresponding translation-related proteins was confirmed by Western blotting ( Figure 3 F) In contrast to the observed enrichment of translation initiation complexes, we did not detect any translation elongation factors in ATXN2 condensates.

[0391] These results suggest that ATXN2 condensates promote the assembly of translation initiation complexes by concentrating translation initiation factors and ribosomes. Figure 2 A, 2I), the ribosome occupancy patterns of these genes on the translation reading frame at different circadian time points ( Fig. 9 B) or ATXN2 / 2L double knockout ( Fig. 9 C) are the same, indicating that ATXN2 / 2L-dependent rhythmic translation regulation likely occurs during translation initiation.

[0392] Example 4. ATXN2 / 2L condensates recruit translation machinery and specific mRNAs

[0393] So far, we have well demonstrated that ATXN2 and 2L positively regulate circadian translation and that they form oscillating condensates via phase separation. Next, we further evaluated how phase separation helps to selectively recruit the translation machinery. We isolated 80S ribosomal subunits and incubated them with ATXN2 and ATXN2L droplets, where ribosomal complexes could be enriched ( Fig.10 A). Other phase-separated systems, including those of FUS and YTHDC1, were used as controls and were also enriched. The inventors' results showed that the selectivity of ribosome enrichment to phase-separated condensates was small ( Figure 4 A and 10B).

[0394] The inventors next assessed whether ATXN2 / 2L condensates selectively recruit mRNAs. Previous studies based on PAR-CLIP experiments have shown that ATXN2 binds primarily to uridine-rich elements in mRNAs, more specifically to AUUUU / A-rich motifs. Therefore, the inventors examined the sequences of a range of core clock genes. The inventors found that both PER2 and CRY1 mRNAs have two long sequences rich in AUUUU / A sequences in their 3'UTRs, but rarely in their 5'UTRs ( Figure 4B and 10C). These results suggest that ATXN2 condensates may regulate the translation of PER2 and CRY1 by specifically binding to their 3'UTR sequences.

[0395] The inventors transcribed 11 RNAs in vitro, PER2 5'UTR, two AUUUU-enriched PER2 3'UTR fragments, 3'UTRs of several other clock genes, as well as FAM199X, a known ATXN2 substrate as a positive control, and two negative controls, RRBP1 and WFS1 (which do not bind ATXN2 and show no rhythmic translation fluctuations at CT4 and CT12 in WT cells according to Ribo-seq data). Figure 4 As shown in C and 10E, the PER2 3'UTR was strongly enriched in ATXN2 condensates; however, the 5'UTR did not have this enrichment. As expected, two negative controls failed to be recruited to ATXN2 droplets. Two other clock-related molecules, CRY1 and BMAL1, were also recruited to the liquid-like droplets, strongly suggesting that selectivity is achieved through the 3'UTR of the circadian clock gene.

[0396] To ensure that the observed binding was independent of the protein species in the droplets, the inventors used FUS droplets as a negative control. None of these RNAs were enriched by FUS droplets ( Figure 4 D). The inventors also constructed a series of control mutants with insufficient phase separation ability. Since the methionine residues in Pbp1 (yeast atx2) drive phase separation, the inventors constructed mutants in which single and all methionines were mutated to serine (MS) and tested their phase separation ability ( Fig.10 F). The M1268S single mutant and all M-to-S mutants no longer undergo phase separation ( Figure 4 E and 10G). When all M-to-S mutants of ATXN2 no longer phase separate, RNA and protein no longer colocalize ( Figure 4 F).

[0397] Inspired by the above in vitro observations, the inventors further tested the selective enrichment of PER2 3'UTR by ATXN2 phase separation in vivo. The inventors performed immunofluorescence combined with RNAscope single-molecule fluorescence in situ hybridization to detect whether Per2 mRNA colocalizes with Atxn2 condensates in the mouse brain. The results were particularly striking in the SCN, where abundant Per2 mRNA colocalized with Atxn2 condensates in a rhythmic manner. The inventors also observed that the cytoplasmic colocalization of Atxn2 condensates and mRNA peaked at CT12 ( Figure 4 G), which was further verified in hypothalamic GT1-7 cells ( Figure 4H). Colocalization was less prominent in other brain regions, suggesting a specific role for Atxn2 in activating Per2 translation in the SCN ( Fig.11 B).

[0398] Taken together, these results suggest that ATXN2 condensates are able to enrich ribosomal complexes and specific mRNAs, such as PER2, which may further promote translation activation as a circadian function.

[0399] Example 5. ATXN2 / 2L condensates activate PER2 translation in vitro and in vivo

[0400] Given that ATXN2 condensates enrich for translation machinery, we next assessed whether phase separation is required for translation activation. We first performed in vitro translation assays using either phase-separated or phase-separation-defective ATXN2 LCD proteins ( Fig.11 A). Although the translation efficiency of PER2 and CRY1 was 2-3 times higher than the control in ATXN2 condensates, the inventors observed no significant change in translation efficiency in the presence of ATXN2M-S mutant protein ( Figure 6 A). Furthermore, ATXN2 droplets failed to promote the translation of two negative controls, WFS1 and RRBP1. These results strongly suggest that the translational activities of PER2 and CRY1 can be regulated in ATXN2 LCD phase-separated condensates.

[0401] After the inventors' analysis of static protein translation, the inventors next confirmed the inventors' findings of dynamic translation events. To this end, the inventors performed single-molecule detection using the SunTag system, as previously established. To ensure accurate capture of translation events, the inventors used the Tet-on system and doxycycline-induced expression of the PER2 polypeptide to eliminate background fluorescence that interfered with the signal and to capture nascent PER2 peptides labeled with the SunTag ( Figure 5 B). The inventors observed that nascent PER2 peptides emerged from mCherry-ATXN2 condensates after addition of doxycycline ( Figure 5 C), and the SunTag fluorescence signal disappeared from ATXN2 condensates after addition of the translation inhibitor puromycin ( Figure 5 B and 6C). These results confirm that active translation events occur in the phase-separated system.

[0402] To provide direct evidence supporting the contribution of ATXN2 phase separation to translation activation, the inventors expressed ATXN2 full-length protein or ATXN2 mutants with specific residues deleted or mutated in ATXN2 / 2L double knockout cells ( Fig.11C) to perform complementation experiments. Among them, cells lacking C-terminal LCD3 in ATXN2 (925-1312) had no cytoplasmic condensates ( Figure 5 D and 11D). We then used polysome fractionation analysis to assess global translational oscillations in wild-type and ATXN2-ΔLCD3 cell lines. As expected, wild-type ATXN2 clearly rescued translational repression in our double knockout cells ( Figure 5 E, 11D). However, the ATXN2-ΔLCD3 mutant failed to activate translation oscillations along the circadian rhythm. A similar phenomenon can be observed by SUnSET analysis ( Figure 5 F).

[0403] In addition, the inventors tested whether ATXN2 could rescue the translation of core clock genes that were suppressed after ATXN2 / 2L double knockout. CRY1, CLOCK, and PER2 proteins showed oscillatory expression patterns in both WT and full-length ATXN2 complemented cells ( Figure 5 F). However, the ATXN2-ΔLCD3 mutant failed to promote the translation of these three clock proteins. At the same time, the inventors measured the cell-autonomous circadian rhythm-TTFL period and amplitude to determine whether the phase separation of ATXN2 regulates the circadian behavior of cultured cells. Using the previously reported PER2::LUC cell line13, the inventors measured the luciferase reporter gene expression of ATXN2, ATXN2L single cells and double knockout (DKO) cells by real-time luminescence experiments ( Fig.11 D) Figure 5 G shows that both ATXN2 and ATXN2L knockout cells have defective circadian amplitude rhythms, but cycle length is not altered. ATXN2 / 2L double knockout severely suppresses the high-amplitude phenotype while slightly affecting circadian cycle length, indicating a role for ATXN2 / 2L in maintaining circadian robustness. Interestingly, in ATXN2 / 2L double knockout cells, wild-type ATXN2 expression rescued the abnormal cell-autonomous circadian behavior, while the ATXN2-ΔLCD3 mutant did not, indicating that phase separation of ATXN2 maintains 24-hour periodicity and high-amplitude rhythmicity in cells.

[0404] Together, these findings indicate that ATXN2 phase separation is required for translational activation of PER2 and other clock molecules as well as for cell-autonomous circadian behavior.

[0405] The above results indicate that upregulating the expression of ATXN2 and ATXN2L can strengthen or restore the intensity of the circadian rhythm, among which the function of regulating phase separation of LCD of ATXN2 and ATXN2L is crucial for strengthening or restoring the function of circadian rhythm.

[0406] Example 6. ATXN2 and ATXN2L co-regulate circadian rhythm in mice

[0407] To explore the potential role of ATXN2 and ATXN2L in the regulation of physiological circadian rhythms, the inventors next constructed several knockout mouse strains. Since Atxn2l knockout mice are embryonic lethal, the inventors constructed conditional tissue-specific knockout mice, VIP-Cre-driven Atxn2l knockout (Vip-Atxn2l- / -), and SCN-AAV8-Cre-driven Atxn2l knockout (Atxn2lflx / flx mice injected with AAV8-mCherry-IRES-Cre in the SCN are called SCN-Atxn2l- / -)( Figure 6 A and 7B). In addition, the inventors constructed Atxn2+ / -; Atxn2lflx / + mice (Atxn2+ / -; SCN-Atxn2l+ / -) and Atxn2- / -; Atxn2lflx / flx mice (Atxn2- / -; SCN-Atxn2l- / -) by injecting AAV8-mCherry-IRES-Cre into the SCN of Atxn2 and Atxn2l compound heterozygous and homozygous knockout mice. The expression of mCherry-IRES-Cre in the SCN was confirmed by fluorescence in brain sections ( Fig.12 A).

[0408] To monitor their circadian behavior, the inventors continuously recorded the running wheel activity of wild-type and transgenic mice. The mice were initially maintained in a 12-hour light / 12-hour dark cycle (LD) and subsequently transferred to constant darkness (DD). Four representative activity graphs of each mouse strain show their activity under LD and DD ( Figure 6 C and Fig.12 B) All transgenic mice ( Fig.12C) did not show any discernible changes in circadian behavior under LD conditions, but were affected by Atxn2 / 2l deficiency under DD. Under DD, the average period of wild-type mice was 23.90 ± 0.05 hours (mean ± SD, n = 14), calculated by χ2periodogram, while the stable period of Atxn2- / - mutants was slightly prolonged to 23.95 ± 0.05 hours (n = 6, t-test, p = 0.0655). In contrast, both types of Atxn2l knockout mice driven by VIP-Cre (Vip-Atxn2l- / -) and SCN-Cre (SCN-Atxn2l- / -) showed significantly shortened periods of 23.82 ± 0.13 and 23.76 ± 0.17, respectively. However, circadian cycle timing was not significantly affected in compound heterozygous or homozygous knockout mice (Atxn2+ / -; SCN-Atxn21+ / - and Atxn2- / -; SCN-Atxn21- / -). Figure 6 D).

[0409] In addition to the change in period, the inventors also measured other parameters related to circadian rhythms, such as the amplitude of the rhythm to indicate the robustness of the circadian rhythm. Figure 6 As shown in E, the results between compound knockout mice were indeed significantly different compared to WT (amplitude: 0.296 ± 0.044). Power spectrum analysis using FFT detected low-amplitude rhythms in compound heterozygous knockout mice in DD (amplitude: 0.190 ± 0.106). A more severe loss of circadian rhythm was observed in compound homozygous knockout mice (amplitude: 0.153 ± 0.057).

[0410] Furthermore, to ensure that the changes in periodicity and high-amplitude rhythms were not caused by physiological changes, the inventors checked the body weight, locomotor activity, and anxiety-like behavior of all transgenic mice. All of these parameters were normal ( Fig.12 D-12H).

[0411] These results, together with our observations in knockout cells, suggest that ATXN2 and 2L coordinately regulate rhythmic translation to maintain circadian behavior in mammals.

[0412] Example 7. Use of inhibitory nucleic acids, CRISPR compositions ATXN2 and ATXN2L, and overexpression of ATXN2 using expression vectors.

[0413] (1) Using CRISPR-Cas9 technology, the inventors successfully knocked out ATXN2 and ATXN2L in U2OS cells. The results verified by Western Blot are as follows Fig.13As shown in A, the numbers represent cell samples collected at different time points. The gRNAs used in this experiment are as follows: 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9), which targets ATXN2, and 5'-CCCCGGATCTTAAAGGAGGA-3' (SEQ ID NO: 10), which targets ATXN2L.

[0414] The results show that ATXN2 and ATXN2L were successfully knocked out, and the expression of both was downregulated. At the same time, the inventors tested the circadian rhythm in the cells, and the results showed that knocking out ATXN2 (i.e., causing downregulation of ATXN2 expression) can accelerate the circadian rhythm, and knocking out ATXN2L (i.e., causing downregulation of ATXN2 expression) can delay the circadian rhythm.

[0415] (2) Using siRNA, the inventors successfully knocked down the expression of ATXN2 protein in U2OS cells. The results of Western Blot verification are as follows: Fig.13 B. The siRNAs used in this experiment are as follows:

[0416] siRNA1: sense strand is CCAGUUAGCAGAAGAAAUUTT (SEQ ID NO: 11), antisense strand is AAUUUCUUCUGCUAACUGGTT (SEQ ID NO: 12);

[0417] siRNA2: the sense strand is GCAAGUGAAACAUCACCUATT (SEQ ID NO: 13), and the antisense strand is UAGGUGAUGUUUCACUUGCTT (SEQ ID NO: 14).

[0418] This result indicates that the expression of ATXN2 is downregulated. At the same time, the inventors tested the circadian rhythm in the cells, and the results showed that downregulating the expression of ATXN2 can accelerate the circadian rhythm.

[0419] (3) Using shRNA, the inventors successfully knocked down the expression of ATXN2 protein in GL 261 cells. The results verified by Western Blot are as follows Fig.13 C, the numbers represent the shRNA numbers used. The shRNAs used in this experiment are as follows:

[0420] The shRNA targeting ATXN2 is:

[0421] CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTTC GTTTTG(SEQ ID NO:15),CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTT TTG(SEQ ID NO:16),CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTT TTG(SEQ ID NO:16) NO:17), CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTT TTG (SEQ ID NO:18), or CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTT TTG (SEQ ID NO:19).

[0422] The shRNA targeting ATXN2L is:

[0423] CCGGCCTCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAG GTTTTG (SEQ ID NO: 20), CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTT TTG (SEQ ID NO: 21), CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTT TTG (SEQ ID NO: 21) NO:22), CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTT TTG (SEQ ID NO:23), or CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTT TTG (SEQ ID NO:24).

[0424] The results show that the expression of ATXN2 and ATXN2L is downregulated. At the same time, the inventors tested the circadian rhythm in the cells, and the results showed that downregulating the expression of ATXN2 can accelerate the circadian rhythm, and downregulating the expression of ATXN2L can delay the circadian rhythm.

[0425] (4) The inventors overexpressed ATXN2 by transfecting U2OS cells with pLVX-EGFP-ATXN2 plasmid, and the protein expression was as follows Fig.13 As shown in D, the green signal is EGFP-ATXN2 protein. This result shows that the expression of ATXN2 is upregulated. At the same time, the inventors tested the circadian rhythm in the cells, and the results showed that upregulating the expression of ATXN2 can delay the circadian rhythm.

[0426] Example 8. Abnormal expansion of PolyQ can lead to a significant extension of the rhythmic period of the core rhythmic protein PER2.

[0427] In order to explore the role and influence of abnormal polyQ expansion of ATXN2 protein on circadian rhythm in neurodegenerative diseases, the inventors constructed cells containing different lengths of polyQ by the following method, namely normal 22Q and 0Q with polyQ removed, and polyQ expanded to 39Q and 57Q in disease states (such as Fig.14 On this basis, the fluorescence values ​​of PER2 in these four types of cells were detected for 4 days.

[0428] Materials and methods :

[0429] 1. Cell line construction: Design the guide RNA (gRNA) sequence of the CRISPR / Cas9 system at the corresponding position of the human ATXN2 and ATXN2L genome sequences, insert it into the pX459 plasmid, and transfect it into HEK293T cells for lentiviral packaging. Infect U2OS cells to obtain the ATXN2 / 2L-double KO U2OS cell line. On this basis, construct ATXN2 / 2L fusion expression plasmids containing proteins with different lengths of polyQ (0, 22, 39, 57) and Flag tags, transfect it into HEK293T cells for lentiviral packaging, and infect different ATXN2 / 2L-double KO U2OS cell lines. Obtain a cell line containing ATXN2-0 / 22 / 39 / 57Q.

[0430] 2. Establishment of luciferase reporter gene system: After obtaining cell lines containing ATXN2 with different lengths of polyQ, a fusion expression plasmid containing the PER2 promoter sequence and the luciferase sequence was transferred. The obtained cell line can be tested for luciferase activity by adding luciferin as a luciferase reaction substrate in the culture medium. Through 4 consecutive days of luciferase activity detection, one photo was taken every hour, and the exposure time of each photo was 15 minutes, which characterized the rhythmic oscillation changes of PER2. The detected signal value was Fourier transformed to calculate the cycle of each cell.

[0431] The results show that compared with 22Q, the removal of polyQ has no significant effect on the PER2 rhythm, but the abnormal expansion of polyQ significantly increases the rhythmic period of PER2 ( Fig.15 ).

[0432] discuss

[0433] Accurate 24-hour cell-autonomous oscillations are maintained by a complex molecular network. Here, the inventors identify ATXN2 and ATXN2L as master regulators of rhythmic translation ( Figure 6 F).

[0434] ATXN2 was previously known to be a risk factor for spinocerebellar ataxia type 2 and ALS. Its physiological functions are diverse, including mRNA processing, or regulators of its stability and expression. In Drosophila, Atx2 has been reported to regulate circadian rhythms by assisting Per translation. However, the circadian rhythm changes in Atxn2-knockout mammals appear to be weak. Evolutionary analysis provides two possible explanations. First, Drosophila Atx2 interacts with the translation activator TWENTY-FOUR (TYF) and binds to PERIOD (per) mRNA to initiate its translation. However, TYF protein is only found in dipteran insects and is not conserved in mammals. Second, ATXN2L originally originated from a gene duplication event 500 million years ago, or appeared in the branch of vertebrates after TYF disappeared. The inventors' work strongly supports the importance of ATXN2L. Functional redundancy is often observed in the regulation of circadian rhythms, such as the existence of multiple isoforms of many clock proteins, for example, Cry1 and Cry 2, and mPer1-3. This increased complexity suggests that mammals require more circadian regulation to properly maintain all physiological functions throughout the organism.

[0435] ATXN2 and ATXN2L have similar domain distributions, except that human ATXN2 has a polyglutamine fragment at its N-terminus. In our study, we found that ATXN2 and ATXN2L play a compensatory role in regulating translation rhythm. Further studies may explain in more detail the mechanism of how these two molecules are precisely coordinated and reveal more mechanisms of the importance of redundancy at the molecular level.

[0436] In previous reports, LCD of ATXN2 was shown to be required for RNA granule assembly and required for long-term memory in Drosophila. In fact, LCD of ATXN2 is conserved among orthologs in more than 200 species. Therefore, the role of ATXN2 LCD in driving phase separation or mRNA granule formation may be conserved. In a previous study, Ataxin2 was shown to colocalize with pABP and ribosomal subunits in human neurons. However, few studies have reported the function of ATXN2 condensates in mammals. Here, the inventors show that ATXN2 and 2L condensates oscillate and regulate a range of biological processes in a temporal manner.

[0437] Most previously described phase separation systems have been studied in the context of cells in stable and homogeneous states (e.g., stress conditions) or during unidirectional transitions (e.g., cell differentiation and development). Here, the inventors demonstrate the physiological function of the flow of an undulating phase separation system that regulates cellular rhythms. This time-dependent phase separation is associated with transcriptional regulation. At each step of transcription, including initiation, elongation, and termination, specific condensates are formed. The liquid information flow model previously proposed to explain how transcription is achieved may also apply to the translation process. Based on the inventors' own findings, the inventors believe that translation is initiated in ATXN2 condensates. Other mechanisms that are dependent on or independent of phase separation subsequently assist protein translation in the elongation phase. In addition, previous studies have shown that there is an uncoupling between mRNA oscillations and protein oscillations. Although the inventors' results clearly indicate that ATXN2 phase separation condensates play an important role in translation activation, it may also be one of the potential mechanisms of this uncoupling. In summary, the inventors' work can provide a more detailed understanding of how phase separation performs spatiotemporal regulation of various cellular activities.

[0438] In addition, the inventors' work also has important implications for future disease research. Recent experimental evidence suggests a bidirectional relationship between circadian rhythm disturbances and many human malignant diseases, including tumors, type 2 diabetes, psychiatric disorders, and neurodegenerative diseases. The onset of these diseases is insidious and progressive, with circadian rhythm disturbances observed in the early stages. Sleep-related pathologies, including progressive loss of dream recall and reduced REM frequency, have been reported in SCA2 patients. ATXN2 constitutes an effective modifier of Tar-DNA binding protein (TDP-43) proteinopathy. ATXN2 antisense oligonucleotides (ASOs) have been suggested as an effective therapy for ALS. Based on the rhythmicity of ATXN2 condensates revealed in this study, the timing of application should be carefully considered in future treatments.

[0439] It is noteworthy that while the core clock in mammals is regulated by interlocking positive and negative feedback loops, the inventors have focused primarily on addressing the role of ATXN2 / 2L in the negative TTFL. In addition to the first negative feedback loop, there is a second positive loop involving Nr1d1 / Reverb-alpha and RORs, as well as a tertiary TTFL involving Dec1 / Dec2. Rev-Erbα works in concert with Rev-Erbβ and RORα to co-regulate the circadian expression of BMAL1. Oscillatory expression of Nr1d1 / Reverb-alpha and RORs is not only present in the SCN, but has also been proposed to coordinate circadian metabolic processes. Further studies to more fully understand circadian rhythms are essential to better understand how phase separation and protein translation are coordinated.

[0440] In conclusion, our findings elucidate the physiological relevance of rhythmic ATXN2-mediated phase separation and should greatly aid future circadian studies and the development of new biomarkers for aging and the onset of neurodegenerative diseases.

Claims

1. A method for regulating circadian rhythm, comprising the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm, Optionally, the regulating the expression of ATXN2 and / or ATXN2L is up-regulating or down-regulating the expression of ATXN2 and / or ATXN2L; the regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

2. The method according to claim 1, comprising accelerating the circadian rhythm by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L; and / or delaying the circadian rhythm by downregulating the expression of ATXN2L or upregulating the expression of ATXN2.

3. The method according to claim 1, comprising accelerating the circadian rhythm by inactivating the function of ATXN2 or enhancing the function of ATXN2L; and / or delaying the circadian rhythm by inactivating the function of ATXN2L or enhancing the function of ATXN2. 4 . The method of claim 1 , comprising enhancing circadian rhythm by simultaneously upregulating the expression of ATXN2 and ATXN2L.

5. The method of claim 1, comprising attenuating circadian rhythm by simultaneously downregulating the expression of ATXN2 and ATXN2L. 6 . The method according to claim 3 , wherein the function of ATXN2 or the function of ATXN2L is a function of forming phase separation in cells.

7. The method of claim 2, wherein the expression of ATXN2 or ATXN2L is downregulated using an inhibitory nucleic acid targeting ATXN2 or ATXN2L.

8. The method of claim 7, wherein the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA). 9 . The method according to claim 2 , wherein the expression of ATXN2 or ATXN2L is upregulated using an expression vector comprising a protein encoding ATXN2 and / or ATXN2L.

10. The method according to claim 9, wherein the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors, preferably, the expression vector is replication-defective.

11. The method according to claim 9, wherein the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

12. The method of claim 2, wherein a CRISPR composition is used to upregulate or downregulate the expression of ATXN2 or ATXN2L.

13. The method of claim 12, wherein the CRISPR composition comprises a Cas nuclease and a gRNA, wherein the gRNA targets ATXN2 or ATXN2L, and optionally, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9) or 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 10).

14. A method for regulating circadian rhythm, comprising the step of regulating circadian rhythm by regulating the expression and / or function of a protein containing an LCD domain, preferably, regulating the function of a protein containing an LCD domain is regulating the function of the LCD domain-mediated phase separation, more preferably, regulating a protein containing an LCD domain is regulating a clock gene protein containing an LCD domain.

15. The method of claim 14, wherein LCD domain-mediated phase separation is regulated by up-regulating or down-regulating the expression of a protein comprising an LCD domain.

16. Use of one or more modulators or combinations of modulators for regulating ATXN2 and / or ATXN2L in the preparation of the following drugs or agents: (1) Prevent or treat circadian rhythm-related diseases; (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders; (3) regulating the circadian rhythm of a subject in need thereof; and / or (4) Regulating phase separation.

17. A method for: administering to a subject one or more modulators or combinations of modulators that modulate the expression or protein function of ATXN2 and / or ATXN2L: (1) Prevent or treat circadian rhythm-related diseases; (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders; (3) regulating the circadian rhythm of a subject in need thereof; and / or (4) Regulating phase separation.

18. The use according to claim 16 or the method according to claim 17, wherein the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain; Preferably, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, and sleep disturbances.

19. The use according to claim 16 or the method according to claim 17, wherein the regulator for regulating the expression of ATXN2 and / or ATXN2L is an expression vector comprising an encoding ATXN2 and / or ATXN2L, which is used to upregulate the expression of ATXN2 and / or ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

20. The use according to claim 16 or the method according to claim 17, wherein the modulator of the expression of ATXN2 and / or ATXN2L is or targets an inhibitory nucleic acid of ATXN2 or ATXN2L, Optionally, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

21. The use according to claim 16 or the method according to claim 17, wherein the modulator that modulates the expression of ATXN2 and / or ATXN2L is a CRISPR composition; Optionally, the CRISPR composition comprises a Cas nuclease and a gRNA that targets ATXN2 or ATXN2L, optionally, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' or 5'-GTATTGGAAATACCCCCAGT-3'.

22. A biomarker combination for detecting circadian rhythm of a subject, comprising ATXN2 and / or ATXN2L, preferably, consisting of ATXN2 and / or ATXN2L.

23. A reagent combination for detecting the biomarker combination of claim 22, comprising reagents for detecting the gene markers, such as primers, probes, antibodies, optionally enzymes such as PCR enzymes, buffers, and product instructions.

24. Use of the reagent combination according to claim 23 in preparing a reagent for detecting the circadian rhythm of a subject.

25. A method for detecting a subject's circadian rhythm, comprising the following steps: Determining the expression level of the biomarker combination of claim 22 in the subject, preferably, using the reagent combination of claim 23 to determine the expression level; comparing the measured expression level to a reference level; The state of the subject's circadian rhythm is determined.

26. The use according to claim 24, wherein the state of the circadian rhythm can be used to diagnose circadian rhythm disorders or circadian rhythm-related diseases.

27. A cell model lacking ATXN2 and / or ATXN2L gene, preferably the cell is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a Hela cell.

28. An animal model lacking ATXN2 and / or ATXN2L gene; preferably, the animal model is a mammalian model, more preferably a rodent model, and most preferably a mouse model.

29. Use of the cell model or animal model according to claim 27 or 28 for screening drugs for treating or preventing circadian rhythm-related diseases.

30. An expression vector comprising a nucleic acid sequence encoding ATXN2 and ATXN2L or a nucleic acid sequence encoding the LCD region of ATXN2 and ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

31. An expression vector combination, comprising a first expression vector and a second expression vector, wherein the first expression vector comprises a nucleic acid sequence encoding ATXN2 or a nucleic acid sequence encoding an LCD domain of ATXN2; and the second expression vector comprises a nucleic acid sequence encoding ATXN2L or a nucleic acid sequence encoding an LCD domain of ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

32. An inhibitory nucleic acid combination comprising a first inhibitory nucleic acid and a second inhibitory nucleic acid, wherein the first inhibitory nucleic acid targets ATXN2; and the second inhibitory nucleic acid targets ATXN2L; Optionally, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

33. A CRISPR composition comprising a Cas enzyme, a first gRNA and a second gRNA, wherein the first gRNA targets ATXN2; the second gRNA targets ATXN2L; Preferably, the Cas enzyme is Cas9; Preferably, the first gRNA is 5'-GTATTGGAAATACCCCCAGT-3'; the second gRNA is 5'-GTATTGGAAATACCCCCAGT-3'.

34. A composition comprising the expression vector, expression vector combination or inhibitory nucleic acid combination of the preceding claims, and a pharmaceutically acceptable carrier.

35. The use according to claim 16 or the method according to claim 17, wherein the regulator or the combination of regulators comprises the expression vector according to claim 30, the expression vector combination according to claim 31, the inhibitory nucleic acid combination according to claim 32, the CRISPR composition according to claim 33 or the composition according to claim 34, preferably, the regulator or the combination of regulators is the expression vector according to claim 30, the expression vector combination according to claim 31, the inhibitory nucleic acid combination according to claim 32, the CRISPR composition according to claim 33 or the composition according to claim 34.

36. A method of regulating circadian rhythm comprising the step of regulating phase separation.

37. The method according to claim 36, wherein regulating the phase separation comprises the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm, Optionally, the regulating the expression of ATXN2 and / or ATXN2L is up-regulating or down-regulating the expression of ATXN2 and / or ATXN2L; the regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

38. The method according to any one of claims 36-37, comprising: Improving phase separation by upregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their functions; And / or downregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their functions to reduce phase separation.

39. A method for treating a disease comprising the step of regulating phase separation; The disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain.

40. The method according to claim 39, comprising regulating phase separation by regulating the expression and / or function of a protein comprising an LCD domain, preferably regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain.

41. The method of claim 40, wherein LCD domain-mediated phase separation is modulated by upregulating or downregulating expression of a protein comprising an LCD domain.

42. Use of a reagent for detecting ATXN2 in the preparation of a detection agent for detecting circadian rhythm abnormalities and / or neurodegenerative diseases; optionally, when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease.

43. A method for detecting whether a subject has an abnormal circadian rhythm and / or a neurodegenerative disease, comprising the step of detecting the protein sequence of ATXN2 in the subject, wherein when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease.

Images