Porcine circovirus type 3 antibody detection kit and preparation method and application thereof
By preparing the porcine circovirus type 3 Cap protein monoclonal antibody P3 and the corresponding detection kit, the problem of lack of rapid diagnostic methods in PCV3 prevention and control was solved, and efficient and low-cost porcine circovirus type 3 antibody detection was achieved, which is suitable for early screening and epidemiological surveys in pig farms.
Patent Information
- Application Number
- CN202411604649.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-11-12
AI Technical Summary
The existing technology lacks safe and effective PCV3 vaccines and efficient diagnostic methods, which makes PCV3 prevention and control difficult. In addition, existing detection methods are time-consuming and costly, and are not suitable for rapid diagnosis in pig farms.
Develop monoclonal antibody P3 against porcine circovirus type 3 Cap protein and prepare corresponding antibody detection kit, including porcine circovirus type 3 Cap protein and supporting detection reagents, for rapid and sensitive detection of porcine circovirus type 3 antibodies.
It has achieved rapid, sensitive and highly specific porcine circovirus type 3 antibody detection, which is suitable for early screening, immune evaluation and epidemiological investigation, and meets the rapid diagnosis needs of pig farms.
Smart Images

Figure CN119176868B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of biotechnology, in particular to a porcine circovirus type 3 antibody detection kit and a preparation method and application thereof. BACKGROUND
[0002] Porcine circovirus type 3 (PCV3) belongs to the single-stranded DNA virus of the Circoviridae family, and has caused widespread concern in the pig industry all over the world since it was first reported in 2016. The PCV3 genome is relatively simple and contains two open reading frames (ORF), which encode replication protein (Rep) and capsid protein (Cap) respectively. Among them, the Rep protein is responsible for the replication and transcription regulation of the virus, and is a key enzyme in the process of viral infection and replication; and the Cap protein is the main structural protein of PCV3, which is located on the surface of the viral capsid, directly mediates the binding with the host cell, and is the main immunogenic protein of PCV3, and is often used as the main target for the development of vaccines and diagnostic reagents.
[0003] At present, the PCV3 isolation and culture technology is not mature, and there is no safe and effective PCV3 vaccine product. In the prevention and control of PCV3, it still needs to rely on the biological safety prevention and control measures. In the biological safety prevention and control, the pig farm should do well in the monitoring of PCV3, avoid the introduction of PCV3, timely eliminate the pigs carrying PCV3, and eliminate the source of infection; do well in the physical isolation, prevent the introduction of the carrier into the pig farm; implement the disinfection work well, cut off the transmission route and the like.
[0004] At present, the diagnosis technology of new animal diseases such as PCV3 is insufficient, mainly the molecular biology detection technology based on conventional PCR and qPCR. These detection methods are time-consuming, high in cost, high in equipment requirement, and inconvenient for the rapid diagnosis and application of the pig farm. The research on the serological detection technology of PCV3 is less, and only the indirect ELISA using a small amount of recombinant PCV3 Cap protein is reported. At present, there is no detection method or product of PCV3 antigen in the market.
[0005] In view of the fact that no commercial PCV3 vaccine is available at present, it is urgent to establish the corresponding pathogen monitoring and evaluation method, comprehensively carry out the systematic monitoring and risk assessment of PCV3, timely master the epidemic situation and scientifically research and judge the trend, and effectively prevent and control the outbreak and prevalence of the epidemic. SUMMARY
[0006] In order to make up for the deficiency of the prior art, the purpose of the present application is to provide a porcine circovirus type 3 antibody detection kit and a preparation method and application thereof.
[0007] Therefore, the application discloses an anti-proliferative porcine circovirus type 3 Cap protein monoclonal antibody, which is a monoclonal antibody P3.
[0008] In another aspect, the application further discloses a product for detecting a porcine circovirus type 3 antibody, which comprises the monoclonal antibody P3.
[0009] Preferably, the product further comprises a porcine circovirus type 3 Cap protein and a matched detection reagent.
[0010] Preferably, the amino acid sequence of the porcine circovirus type 3 Cap protein is shown in SEQ ID NO. 1, and the codon-optimized nucleotide sequence is shown in SEQ ID NO. 2.
[0011] In another aspect, the application further discloses a porcine circovirus type 3 antibody detection kit, which comprises the monoclonal antibody P3 and a porcine circovirus type 3 Cap protein and a matched detection reagent.
[0012] Preferably, the coating concentration of the porcine circovirus type 3 Cap protein is 1 μg / mL.
[0013] Preferably, the matched detection reagent of the kit comprises a sample diluent, a 25x concentrated washing solution, a substrate solution, a termination solution, a positive control and a negative control.
[0014] In another aspect, the application further discloses an application of the monoclonal antibody P3 in preparing a porcine circovirus type 3 antibody detection kit.
[0015] The monoclonal antibody P3 prepared by the application has good specificity and sensitivity, and is suitable for preparing different porcine circovirus type 3 diagnostic reagents, such as colloidal gold, ELISA and other detection kits. Meanwhile, the porcine circovirus type 3 Cap protein prepared by the application has good specificity and expression amount, and is suitable for the preparation of porcine circovirus type 3 diagnostic reagents or the development of subunit vaccines.
[0016] The porcine circovirus type 3 antibody detection kit prepared by the application is suitable for detecting porcine circovirus type 3 antibodies in pig serum, has strong specificity, high sensitivity, good stability, fast detection speed, and can be used for early screening of porcine circovirus type 3 antibodies, immune evaluation (when there is a vaccine) and epidemiological investigation. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1SDS-PAGE detection results of recombinant PCV3 Cap protein.
[0018] Figure 2 Western blot detection results of recombinant PCV3 Cap protein.
[0019] Figure 3 SDS-PAGE detection results of monoclonal antibody P3.
[0020] Figure 4 Western blot detection results of monoclonal antibody P3 on PCV3 Cap protein and PCV2 Cap protein. DETAILED DESCRIPTION
[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0022] Unless specifically noted, the reagents, methods, and apparatuses employed in the present application are those conventional in the art. Unless specifically noted, the reagents and materials used in the following examples are commercially available.
[0023] Example 1: Preparation and detection of recombinant PCV3 Cap protein
[0024] 1. Preparation of porcine circovirus type 3 Cap protein
[0025] The primer was designed to amplify the Cap fragment from the existing recombinant vector containing Cap (the amino acid sequence of PCV3 Cap protein is shown as SEQ ID NO. 1, and the codon-optimized nucleotide sequence is shown as SEQ ID NO. 2), and the target fragment was recovered. The recovered target fragment was amplified using primers with enzyme cutting sites, and the amplified product was recovered again and stored for later use.
[0026] Upstream primer: GCTCTAGAATGCGACATCGAGCAATCTTTC
[0027] Downstream primer: CCGGAATTCTTAATGGTGATGGTGATGATGGAG
[0028] The Cap gene was inserted into the corresponding enzyme cutting sites of the pFastBac vector using a BamHI and EcoRI double enzyme cutting reaction to construct a recombinant vector pFastBac-PCV3-Cap. The E. coli DH5a strain was transformed, and single colonies were picked for PCR verification and sequencing to confirm the insertion of the Cap gene.
[0029] The pFastBac-PCV3-Cap was transformed into DH10Bac competent cells for transposition to insert the Cap gene into the baculovirus vector Bacmid. After transformation, white single colonies were picked, Bacmid plasmid DNA was extracted, and PCR was used to identify the correct insertion of the Cap gene. Bacmid with successful insertion of the Cap gene was used for subsequent insect cell transfection.
[0030] Sf9 cells were inoculated in culture flasks to a cell density of 80-90% confluence. The extracted recombinant Bacmid DNA was transfected into Sf9 cells using transfection reagent, with 5-10 μg of Bacmid and 3-5 μL of transfection reagent added per 1 mL of culture medium. After 48-72 hours, the cytopathic effect (CPE) was observed, such as cell shrinkage, granulation, etc., indicating successful virus proliferation. The culture supernatant was collected, centrifuged to remove cell debris, and the supernatant was the primary baculovirus (P1). A small amount of P1 virus supernatant was inoculated into fresh Sf9 cells, and the culture was continued for 72 hours, and the P2 virus was collected. This process was repeated 2-3 times to amplify to a high-titer virus solution (P3), and the virus titer was determined using a virus titration method, with an ideal titer of 10^7-10^9 PFU / mL.
[0031] The high-titer P3 virus supernatant was used to infect Sf9 cells at an MOI of 2. The cytopathic effect (CPE) was observed within 48-72 hours after infection, and significant lesions usually indicated high expression of the protein. The cells were collected and centrifuged at 1500 rpm for 5 minutes, and the supernatant was collected. The target PCV3-Cap protein was purified by cation exchange, and after sterilization with a 220 nm filter membrane, it was temporarily stored at 4°C for later use.
[0032] 2. Detection of PCV3-Cap protein
[0033] SDS-PAGE electrophoresis and Western Blot identification: The purified PCV3 Cap was prepared for sample, and 12% SDS-PAGE gel electrophoresis was performed, followed by Coomassie blue staining, decolorization, and the results are shown in Figure 1 Western Blot identification was performed using PCV3 positive serum, and the results are shown in Figure 2 .
[0034] The results show that the recombinant PCV3 Cap protein is identified by SDS-PAGE and Western blot, and the purity of the SDS-PAGE is greater than 95%, and the concentration is 0.68 mg / mL, and the expression amount after purification can reach 0.5 g / L or more. It is proved that the PCV3 Cap protein prepared by the application has good specificity and good expression amount, and is suitable for large-scale application.
[0035] Example 2: Preparation and testing of anti-PCV3 Cap protein monoclonal antibody
[0036] 1. Preparation of anti-PCV3 Cap protein monoclonal antibody
[0037] The recombinant PCV3 Cap protein prepared in Example 1 is immunized to BALB / c mice according to the dosage of 100 μg per mouse for the first time, and 50 μg per mouse for the second to fourth times. During the immunization process, the Freund's adjuvant is mixed with the antigen at a mass ratio of 1:1. The Freund's complete adjuvant is used for the first time, and the Freund's incomplete adjuvant is used for the subsequent booster immunization. The immunization is carried out by subcutaneous multi-point injection of mice, and the interval between each immunization is 2 weeks. From the third immunization, blood samples are collected from the mouse orbit on the 7th day after each immunization to prepare serum for subsequent evaluation and analysis. On the 7th day after the completion of the fourth immunization, blood samples are collected from the mouse orbit again, and the supernatant is taken after centrifugation for subsequent analysis.
[0038] The serum of the immunized mouse is detected by indirect ELISA, and the spleen of the mouse with the highest titer is aseptically removed, and the B lymphocytes are separated and fused with sp2 / 0 myeloma cells. The hybridoma cell strain capable of producing antibodies is obtained by HAT medium screening. According to the ELISA detection results of the serum of the immunized mouse, the spleen of the mouse with the highest titer is finally selected for cell fusion, and 85 positive hybridoma cell strains are obtained by primary screening after fusion. The positive hybridoma cell culture supernatant is further screened by indirect ELISA to obtain 10 positive hybridoma cell strains with high titer for monoclonal expansion. Finally, one hybridoma cell with the highest titer is selected to prepare ascites by intraperitoneal injection of mice, and the antibody in the ascites is affinity purified.
[0039] The selected hybridoma cell strain is cultured in large scale according to 1×10 7 The hybridoma cell strain is cultured in large scale according to 1×10
[0040] 2. Test of anti-PCV3 Cap protein monoclonal antibody
[0041] (1) The monoclonal antibody P3 was subjected to SDS-PAGE, and the results are shown in Figure 3 , and the purity of the SDS-PAGE was more than 95%.
[0042] (2) The monoclonal antibody P3 was used to detect the PCV3 Cap protein prepared in Example 1 and the PCV2 Cap protein (prepared by the research unit) by Western blot, and the results showed that the monoclonal antibody had no specific binding with the PCV2 Cap protein, indicating that the monoclonal antibody had good specificity, as shown in Figure 4
[0043] (3) The monoclonal antibody P3 of different dilutions (the antibody concentration was adjusted to 1 mg / mL before dilution) was detected by indirect ELISA method, and when the monoclonal antibody P3 was diluted to 10 7 , the OD450nm value was still 0.6, indicating that the monoclonal antibody P3 had good activity.
[0044] (4) The monoclonal antibody was labeled with HRP by using the classic sodium periodate method or the commercially available HRP labeling kit, and the labeling titer was determined by direct ELISA method (coated with recombinant PCV3 Cap protein, the coating amount was 1 μg / ml) (OD value ≥ 1.0 was positive), and the result was 1:20000. It is indicated that the HRP labeling is successful, the labeling efficiency is high, and it meets the needs of the development of the kit.
[0045] (5) The total RNA was extracted by lysing the hybridoma cells, and after detection, the RNA was reverse transcribed into cDNA using RACE technology; the heavy chain and light chain variable region sequences were obtained by PCR amplification; the target fragments were connected to the vector using ligase, and the connection products were transformed into E. coli competent cells, and then single colonies were picked for sequencing; finally, the monoclonal antibody gene variable region sequence was obtained by analyzing and annotating the sequencing results, as shown in Table 1. The amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody P3 are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.
[0046] Table 1 Amino acid sequence information table of monoclonal antibody P3 variable region
[0047]
[0048] Example 3: Preparation of porcine circovirus type 3 antibody detection kit
[0049] A porcine circovirus type 3 Cap protein antibody detection kit was established using the porcine circovirus type 3 Cap protein prepared in Example 1 and the anti-PCV3 Cap protein monoclonal antibody (monoclonal antibody P3) prepared in Example 2 for the detection of serum antibodies of porcine circovirus type 3.
[0050] 1. Preparation of the kit
[0051] 1.1 Preparation of the enzyme-labeled plate: the porcine circovirus type 3 Cap protein was diluted to 1 μg / mL with a coating buffer (0.05 M pH 9.6 sodium carbonate solution), added to the enzyme-labeled plate, 100 μL / well, 4°C overnight (12-14 hours); removed, discarded the liquid in the well, washed with washing buffer for 3 times, and patted dry; added blocking buffer (PBST solution containing 2% BSA), 200 μL / well, 37°C incubated for 2 hours.
[0052] 1.2 Positive control: the prepared porcine circovirus type 3 Cap protein was emulsified with ISA 201 adjuvant to prepare a vaccine (100 μg / mL) for immunizing healthy susceptible 21-day-old piglets (CSFV, FMDV, PRV, PCV3, PCV2, PRRSV antibodies and antigens were all negative), and the piglets were given the second and third immunization at 14 days and 28 days after the first immunization, respectively, 2 ml / each / time, and blood was collected 7 days after the third immunization, and detected by indirect ELISA method, and pigs with titer higher than 1:10000 were selected for serum preparation. The carotid artery of the experimental pig meeting the conditions was bled, centrifuged at 3000 r / min for 10 minutes, and the supernatant was taken. The supernatant was mixed and filtered through a 0.22 μm filter membrane to remove bacteria. Quantitative packaging, which is the positive control.
[0053] 1.3 Negative control: healthy susceptible 21-day-old piglets (CSFV, FMDV, PRV, PCV3, PCV2, PRRSV antibodies and antigens were negative) were screened, and the carotid artery was bled, centrifuged at 3000 r / min for 10 minutes, and the supernatant was taken. The supernatant was mixed and filtered through a 0.22 μm filter membrane to remove bacteria. Quantitative packaging, which is the negative control.
[0054] 1.4 Preparation of sample diluent: 0.1% preservative ProClin 300 (V / V) and 2% BSA (m / V) were added to 1×PBST to give a final concentration, mixed well, filtered through a 0.22 μm filter membrane to remove bacteria, and quantitatively packaged.
[0055] 1.5 Preparation of 25× concentrated washing solution: 0.1% preservative ProClin 300 (V / V) was added to 25×PBST solution to give a final concentration, mixed well, filtered through a 0.22 μm filter membrane to remove bacteria, and quantitatively packaged.
[0056] 1.6 Preparation of enzyme-labeled antibody: dilute the HRP-labeled anti-PCV3 Cap protein monoclonal antibody (monoclonal antibody P3) 10,000 times with the sample diluent to obtain the enzyme-labeled antibody.
[0057] 1.7 Preparation of substrate solution: a single-component TMB developing solution from Beijing Solabio Biotechnology Co., Ltd. or other general developing solution is quantitatively divided.
[0058] 1.8 Preparation of termination solution: a prepared 2M H2SO4 is quantitatively divided.
[0059] 1.9 Assembly of kit: the kit is assembled according to Table 2.
[0060] Table 2 Kit assembly
[0061] Name Quantity Antigen-coated plates 2 plates (192 wells / box) Positive control 1 mL / tube Negative control 1 mL / tube Sample diluent 12 mL / vial 25x concentrated wash solution 30 mL / vial Enzyme conjugate 25 mL / vial Substrate solution 25 mL / vial Stop solution 12 mL / vial Instructions 1
[0062] 2 Detection of kit
[0063] 2.1 Sample addition: add 50 μL of sample diluent to each well, and then add 50 μL of positive control, negative control and serum to be tested to the corresponding wells, and shake to mix. Incubate at 37°C for 60 minutes.
[0064] 2.2 Washing: after incubation, remove the liquid in the wells, add 300 μL of washing solution per well, and wash 3-5 times, and then pat dry.
[0065] 2.3 Enzyme-labeled antibody incubation: add 100 μL of enzyme-labeled antibody per well, and incubate at 37°C for 30 minutes.
[0066] 2.4 Washing: after incubation, remove the liquid in the wells, add 300 μL of washing solution per well, and wash 3-5 times, and then pat dry.
[0067] 2.5 Color development: add 100 μL of substrate solution per well, and incubate at 37°C for 10 minutes in the dark.
[0068] 2.6 Termination: add 50 μL of termination solution per well, and mix gently to ensure uniformity.
[0069] 2.7 Reading: after adding the termination solution, immediately place the coated plate in the enzyme label reader, and read the OD 450nm value.
[0070] 2.8 S / N value calculation: calculate the S / N value according to the following calculation formula.
[0071]
[0072] 2.9 Judgment
[0073] 2.9.1 Test established condition: OD450nm reading of each well of negative control should be greater than 1.0 and the maximum difference between wells should be <0.3, OD450nm reading of each well of positive control should be <0.3.
[0074] 2.9.2 When S / N value is greater than 0.5, it is judged as negative; when S / N value is less than or equal to 0.5, it is judged as positive.
[0075] 3 Kit performance verification: three batches of kits were continuously produced according to the above method, batch numbers were 241001, 241002 and 241003, and the three batches of kits were used for performance verification.
[0076] 3.1 Property inspection
[0077] The outer packaging of the kit is clean, undamaged, the label should comply with the relevant national regulations, the inner packaging is undamaged, without cracks, without leakage, the product name, batch number, storage condition and expiration date are clear. Among them:
[0078] The antigen-coated plate (96-well plate) is sealed in an aluminum foil bag, the surface is smooth, without cracks, the bottom of the coated plate is clean, transparent and without foreign matter, and the loading capacity is 2 pieces per box.
[0079] The positive control is colorless or light yellow clear liquid, the loading capacity is 1 mL per tube, 1 tube per box.
[0080] The negative control is colorless or light yellow clear liquid, the loading capacity is 1 mL per tube, 1 tube per box.
[0081] The sample diluent is colorless or light yellow clear liquid, the loading capacity is 12 mL per bottle, 1 bottle per box.
[0082] The 25x concentrated washing solution is colorless clear liquid, with crystallization at low temperature, the loading capacity is 30 mL per bottle, 1 bottle per box.
[0083] The enzyme-labeled antibody is colorless or light yellow clear liquid, the loading capacity is 25 mL per bottle, 1 bottle per box.
[0084] The substrate solution is colorless or light blue clear liquid, the loading capacity is 25 mL per bottle, 1 bottle per box.
[0085] The stop solution is colorless clear liquid, the loading capacity is 12 mL per bottle, 1 bottle per box.
[0086] 3.2 Sterile test The positive and negative controls, sample diluent, 25x concentrated washing solution and enzyme-labeled antibody in the kit were subjected to sterile test according to the current Appendix of Chinese Veterinary Pharmacopoeia, and the results are shown in Table 3.
[0087] Table 3 Sterile test results of five batches of kits
[0088] Lot 241001 Lot 241002 Lot 241003 Lot Positive control Sterile growth Sterile growth Sterile growth Negative control Sterile growth Sterile growth Sterile growth Sample diluent Sterile growth Sterile growth Sterile growth 25x concentrated wash solution Sterile growth Sterile growth Sterile growth Enzyme conjugate Sterile growth Sterile growth Sterile growth
[0089] 3.3 Sensitivity verification: Three batches of kits were used to detect the prepared positive serum in gradient, and the lowest detection gradient could reach 3200 times, indicating that the sensitivity of the kit was good. The specific data are shown in Table 4.
[0090] Table 4 Sensitivity detection results (S / N value)
[0091] Sample 241001 Lot 241002 Lot 241003 Lot Negative control OD450 1.356 1.384 1.412 Positive control OD450 0.065 0.071 0.068 1:100 0.064 0.061 0.059 1:200 0.071 0.067 0.068 1:400 0.102 0.098 0.099 1:800 0.163 0.164 0.168 1:1600 0.278 0.287 0.281 1:3200 0.435 0.432 0.426 1:6400 0.654 0.674 0.689
[0092] 3.4 Specificity verification: Three batches of kits were used to detect 7 specific quality control sera from pigs, and the results were all negative, indicating that the specificity of the kit was good. The specific data are shown in Table 5.
[0093] Table 5 Specificity detection results
[0094]
[0095] 3.5 Reproducibility verification: The batch-to-batch and batch-to-batch coefficients of variation of the positive serum and negative serum of three batches of kits were all less than 10%, indicating that the reproducibility of the kit was good. See Tables 6 and 7 for details.
[0096] Table 6 Reproducibility detection results (within batch)
[0097]
[0098]
[0099] Table 7 Reproducibility detection results (between batches)
[0100]
[0101] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods, and are all included in the protection scope of the present application.
Claims
1. An anti-swine circovirus type 3 Cap protein monoclonal antibody, characterized in that, The anti-PCV3 Cap protein monoclonal antibody is monoclonal antibody P3, wherein the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody P3 are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.
2. A product for detecting porcine circovirus type 3 antibody, characterized by, The product comprises the monoclonal antibody P3 of claim 1.
3. The product of claim 2, wherein, The product further comprises the PCV3 Cap protein and the matched detection reagent.
4. The product of claim 2, wherein, The amino acid sequence of the PCV3 Cap protein is shown in SEQ ID NO. 1, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.
2.
5. A porcine circovirus type 3 antibody detection kit, characterized by, The kit comprises the monoclonal antibody P3 of claim 1 and the PCV3 Cap protein and the matched detection reagent.
6. The kit of claim 5, wherein The coating concentration of the PCV3 Cap protein is 1 μg / mL.
7. The kit of claim 5, wherein The matched detection reagent of the kit comprises a sample diluent, a 25x concentrated washing solution, a substrate solution, a stop solution, a positive control and a negative control.
8. Use of the monoclonal antibody P3 of claim 1 in the preparation of a PCV3 antibody detection reagent.
Citation Information
Patent Citations
Porcine circovirus bivalent genetic engineering vaccine
CN109053896A
Monoclonal antibody and application thereof in detection kit
CN115819567A