Antibody targeting PD-L1 and application

Abstract

The invention discloses a PD-L1 targeting antibody and an application of the PD-L1 targeting antibody. The PD-L1 targeting antibody has the advantage of high affinity. The invention also discloses application of the PD-L1 targeting antibody and / or the nucleic acid molecule for coding the antibody in preparation of anti-tumor drugs. According to the invention, the antibody targeting PD-L1 and the antibody targeting bFGF are connected, and the obtained bispecific double-chain antibody targeting PD-L1 and bFGF has the capability of specifically binding PD-L1 and bFGF, can target PD-L1 so as to block PD-L1 / PD-1 binding, and has a dual inhibition effect on liver cancer cells. Therefore, the bispecific double-chain antibody for dual targeting of PD-L1 and bFGF can be used for preparing antitumor drugs.

Description

Technical Field

[0001] The present invention belongs to the field of antibodies, and particularly relates to an antibody targeting PD-L1 and its application. Background Art

[0002] Programmed cell death ligand 1 (PD-L1) is a transmembrane protein that is highly expressed on tumor cells and can bind to programmed cell death receptor 1 (PD-1) on T cells, thereby inhibiting T cell activation and negatively regulating the adaptive immune response. This interaction ultimately causes the tumor to escape the surveillance of the immune system and has an adverse effect on the patient's prognosis. Therefore, anti-PD-L1 antibodies are also an anti-tumor drug.

[0003] Although anti-PD-L1 antibodies have achieved considerable success in clinical trials, the response rate for solid cancers is only 20-30%, and the overall response rate is relatively low, which may be partly due to their poor localization and permeability in solid tumors. Since monoclonal antibodies are large molecules, their distribution in tumor blood vessels may be poor, and limited permeability leads to uneven distribution, thus affecting the therapeutic effect. The use of small molecule antibody formats may be more suitable for tumor treatment in the above situation. Fab antibodies, single-chain antibodies (scFv) and double-chain antibodies (diabody) are all small molecule antibodies, with simpler preparation methods than other genetically engineered antibodies and weaker immunogenicity. Due to their small molecular weight (25-50kD), they are easier to pass through the blood vessel wall and enter the tissue to exert their efficacy than monoclonal antibodies (150kD), so they are more suitable for tumor treatment. Disulfide bond-stabilized Diabody

[0004] Disulfide-stabilized Diabody (ds-Diabody) is an antibody with enhanced stability formed by shortening the connecting peptide and covalently bonding the light and heavy chain variable regions between the single chains on the basis of single-chain antibodies, and then introducing a disulfide bond between VH44 and VL100. It has greater potential as an anti-tumor drug.

[0005] bFGF (basic fibroblast growth factor) is a 155-amino acid polypeptide originally isolated from the brain and pituitary gland, used as a growth factor for fibroblasts. In the tumor microenvironment, bFGF has a similar effect to vascular endothelial growth factor (VEGF), and the two work synergistically, not only promoting tumor cell proliferation and angiogenesis, but also promoting tumor cell migration and metastasis.

[0006] In recent years, significant progress has been made in the field of tumor immunotherapy, which has improved the survival rate of patients. However, due to the complexity of the pathogenesis of tumor diseases, immunotherapy targeting a single target alone often cannot effectively eliminate target cells, resulting in poor response to treatment or drug resistance in some patients. In order to solve this problem, the research and development of bispecific antibodies (BsAb) has been promoted. BsAb is prepared by cell fusion, recombinant DNA technology and protein engineering, and has a unique dual binding ability, which can specifically bind to two different antigens or different epitopes of the same antigen simultaneously or sequentially.

[0007] An increasing number of studies have shown that the combination of anti-angiogenic therapy and immune checkpoint blockade can significantly improve the inhibitory ability of various cancers. PD-1 blockade can sensitize tumors to anti-angiogenic therapy and prolong its efficacy in metastatic breast cancer, pancreatic neuroendocrine tumors, and melanoma models. Anti-angiogenic therapy can improve the treatment of immune checkpoint inhibitors because the formation of high endothelial venules in tumors promotes the treatment of immune checkpoint inhibitors, exerting effects such as cytotoxic T cell (CTL) infiltration, activation, and tumor clearance. Therefore, there is a two-way connection and synergy between anti-angiogenic drugs and immunotherapy, and the development of new therapeutic drugs that can simultaneously inhibit angiogenesis and block immune checkpoints is a more reasonable and effective cancer treatment method. Summary of the invention

[0008] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an antibody targeting PD-L1.

[0009] Another object of the present invention is to provide the use of the above-mentioned antibody targeting PD-L1.

[0010] Another object of the present invention is to provide a bispecific, double-chain antibody targeting PD-L1 and bFGF, which contains the above-mentioned antibody targeting PD-L1.

[0011] Another object of the present invention is to provide a method for preparing and using the above-mentioned bispecific double-chain antibody of PD-L1 and bFGF.

[0012] The purpose of the present invention is achieved through the following technical solutions:

[0013] An antibody targeting PD-L1, comprising a light chain and a heavy chain; wherein,

[0014] The amino acid sequences of the three CDRs on the light chain are as follows: CDR1 is SLRSYY, CDR2 is GKN, and CDR3 is NSRDAVLDWV;

[0015] The amino acid sequences of the three CDRs on the heavy chain are as follows: CDR1 is GGSISSYY, CDR2 is IKQDESTK, and CDR3 is ARVWWPGRAALSDY.

[0016] The amino acid sequence of the heavy chain is preferably as shown in SEQ ID NO.1.

[0017] The sequence of the heavy chain encoding nucleic acid is preferably as shown in SEQ ID NO.2.

[0018] The amino acid sequence of the light chain is preferably as shown in SEQ ID NO.3.

[0019] The sequence of the light chain encoding nucleic acid is preferably as shown in SEQ ID NO.4.

[0020] The above-mentioned antibody targeting PD-L1 is a disulfide bond-stabilized anti-PD-L1 humanized double-chain antibody, and its amino acid sequence is preferably as shown in SEQ ID NO.5.

[0021] A nucleic acid molecule encoding the above-mentioned antibody targeting PD-L1; its nucleic acid sequence is preferably as shown in SEQ ID NO.6.

[0022] Use of the above-mentioned antibody targeting PD-L1 in the preparation of anti-tumor drugs.

[0023] The tumor is preferably liver cancer, lung cancer, breast cancer, melanoma, lymphoma and the like.

[0024] A bispecific diabody targeting PD-L1 and bFGF, wherein an antibody targeting PD-L1 and an antibody targeting bFGF are connected by a connecting peptide; the diabody contains 6 CDRs of an antibody targeting PD-L1 and 6 CDRs of an antibody targeting bFGF; wherein,

[0025] The amino acid sequences of the six CDRs of the antibody targeting PD-L1 are as follows: CDR1 of the light chain is SLRSYY, CDR2 of the light chain is GKN, CDR3 of the light chain is NSRDAVLDWV, CDR1 of the heavy chain is GGSISSYY, CDR2 of the heavy chain is IKQDESTK, and CDR3 of the heavy chain is ARVWWPGRAALSDY;

[0026] The amino acid sequences of the six CDRs of the antibody targeting bFGF are as follows: CDR1 of the light chain is SSDVGGYNY, CDR2 of the light chain is DVS, CDR3 of the light chain is SSYTSSSTVV, CDR1 of the heavy chain is GFTFSSYE, CDR2 of the heavy chain is ISSSGSTI, and CDR3 of the heavy chain is ARELTGDWGAFDIW.

[0027] The amino acid sequence of the bispecific double-chain antibody targeting PD-L1 and bFGF is preferably as shown in SEQ ID NO.8.

[0028] A product, selected from any of the following:

[0029] 1) A nucleic acid molecule encoding the above-mentioned bispecific double-chain antibody targeting PD-L1 and bFGF; the nucleotide sequence thereof is preferably as shown in SEQ ID NO.9;

[0030] 2) A recombinant expression vector containing the nucleic acid molecule described in 1);

[0031] 3) A recombinant expression cell containing the nucleic acid molecule described in 1) or the recombinant expression vector described in 2).

[0032] The vector framework of the recombinant expression vector includes a prokaryotic expression plasmid and a eukaryotic expression plasmid; preferably a eukaryotic expression plasmid; more preferably a yeast expression plasmid; most preferably a pPICZα series plasmid; further preferably a pPICZαA plasmid.

[0033] The method for preparing the recombinant expression vector comprises the following steps: cloning the above nucleic acid molecule into a vector frame to obtain the recombinant expression vector.

[0034] The starting cells of the recombinant expression cells include prokaryotic expression cells and eukaryotic expression cells; preferably eukaryotic expression cells; more preferably yeast expression cells; most preferably Pichia pastoris expression cells; further preferably GS115.

[0035] The above-mentioned recombinant expression cell is preferably prepared by the following steps: transferring the above-mentioned nucleic acid molecule or the above-mentioned recombinant expression vector into a starting cell to obtain a recombinant expression cell.

[0036] The method for preparing the above-mentioned bispecific double-chain antibody targeting PD-L1 and bFGF can be prepared by a chemical synthesis method or by a genetic engineering method; preferably, it is prepared by a genetic engineering method; more preferably, it includes the following steps: culturing the recombinant expression cells, inducing expression, and purifying to obtain a bispecific double-chain antibody targeting PD-L1 and bFGF.

[0037] The use of the above-mentioned bispecific double-chain antibody targeting PD-L1 and bFGF in the preparation of anti-tumor drugs.

[0038] The tumor is preferably liver cancer, lung cancer, breast cancer, melanoma, lymphoma and the like.

[0039] Compared with the prior art, the present invention has the following advantages and effects:

[0040] (1) The present invention screened an antibody targeting PD-L1 with high affinity.

[0041] (2) The present invention connects an antibody targeting PD-L1 and an antibody targeting bFGF to obtain a bispecific double-chain antibody that dually targets PD-L1 and bFGF. The antibody has the ability to specifically bind to PD-L1 and bFGF in vitro, can target PD-L1 and thus block PD-L1 / PD-1 binding, and has a dual inhibitory effect on liver cancer cells.

[0042] (3) The present invention successfully used the Pichia eukaryotic expression system to efficiently express a bispecific diabody antibody that dual-targets PD-L1 and bFGF through codon optimization and expression condition screening. Moreover, using the recombinant vector for expression, 17.6 mg of antibody can be obtained per 1 L of fermentation broth in shake flask culture. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the Phage-ELISA test result after screening the phage antibody mutation library using PD-L1 as the antigen.

[0044] Figure 2 This is a graph showing the results of relative affinity determination of phage antibody mutants using the NH4SCN elution method.

[0045] Figure 3 It is a gel electrophoresis result diagram of constructing dual-targeting antibody gene fragments; wherein, lane M is a nucleic acid molecular weight standard; lanes 1 and 2 are anti-PD-L1 light chain variable region + Linker gene fragments obtained by PCR amplification; lanes 3 and 4 are anti-PD-L1 heavy chain variable region + Linker gene fragments obtained by PCR amplification; lanes 5 and 6 are anti-bFGF light chain variable region + Linker gene fragments obtained by PCR amplification; lanes 7 and 8 are anti-bFGF heavy chain variable region + Linker gene fragments obtained by PCR amplification.

[0046] Figure 4 This is a result diagram of using colony PCR to identify the pPICZαA-bispecific diabody recombinant vector transformed into Pichia pastoris GS115; wherein, lane M is a nucleic acid molecular weight standard; lane P is a PCR amplification of the gene fragment of GS115-pPICZαA empty vector; lane '-' is a PCR amplification of the gene fragment of the pPICZαA empty vector; lane '+' is a PCR amplification of the gene fragment of the pPICZαA-bispecific diabody recombinant plasmid vector; lanes 1-45 are PCR amplification of the gene fragment of the pPICZαA-bispecificdiabody transformant.

[0047] Figure 5This is a Western blot result of the yeast expression supernatant of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody after reducing gel electrophoresis SDS-PAGE; among them, lane K1 is the yeast expression supernatant of the pPICZαA empty vector; lanes 1-40 are the yeast expression supernatants of pPICZαA-bispecific diabody antibodies of different transformants.

[0048] Figure 6 The figure is the SDS-PAGE gel electrophoresis result of the expressed dual-targeting antibody after purification by Ni SepharoseTM 6×Fast Flow; wherein lane M is the protein molecular weight standard; lanes 1-9 are: sample, 25, 50, 75, 100, 150, 300, 500mM imidazole elution components, and NaOH elution components, respectively.

[0049] Figure 7 It is an indirect ELISA to detect the activity of dual-targeting PD-L1 and bFGF bispecific Diabody antibody binding to antigen PD-L1.

[0050] Figure 8 This is an indirect ELISA to detect the activity of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody binding to the antigen bFGF.

[0051] Fig. 9 This is an immunofluorescence identification of the binding of anti-PD-L1 Diabody and bispecific diabody antibodies to human liver cancer cells HepG2; DiI is a cell membrane red staining reagent that stains the cell membrane of liver cancer cells, showing red fluorescence; FITC is a fluorescent secondary antibody that binds to anti-PD-L1 ds-Diabody or bispecific diabody protein, showing green fluorescence; Merge is a combined imaging of DiI and FITC, showing that the two prepared antibody proteins (fluorescent secondary antibody green) are localized on the cell membrane of liver cancer cells (red).

[0052] Fig.10 This is a diagram showing the results of detecting the dual-targeting PD-L1 and bFGF bispecific Diabody antibodies in a T cell and liver cancer cell co-culture system.

[0053] Fig.11 This is the result of using the CCK8 method to detect the effect of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the proliferation of liver cancer HepG2 and SK-HEP1 cells.

[0054] Fig.12This is a graph showing the results of a plate cloning experiment to detect the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the cloning ability of liver cancer HepG2 and SK-HEP1 cells.

[0055] Fig.13 This is the result of the Transwell experiment detecting the effect of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the migration ability of liver cancer cells HepG2 and SK-HEP1 cells.

[0056] Fig.14 This is the result of Transwell experiment detecting the effect of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the invasion ability of liver cancer HepG2 and SK-HEP1 cells.

[0057] Fig.15 This is the result of Western-Blot detection of the effect of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on EMT-related signaling pathways in liver cancer HepG2 and SK-HEP1 cells. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.

[0059] In addition to the known culture medium, the other components of the culture medium are as follows:

[0060] 2×YT-G: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mL of 20% glucose. 2×YT-ATG: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mL of 20% glucose, 20 mg of ampicillin, and 2 mg of tetracycline. 2×YT-ATK: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mg of ampicillin, 2 mg of tetracycline, and 2 mg of kanamycin.

[0061] Example 1

[0062] Screening of phage antibody mutation library targeting PD-L1 and screening of anti-PD-L1 Fab antibodies:

[0063] (1) Rescue and titration of phage antibody mutation library targeting PD-L1:

[0064] An appropriate amount of Fab antibody mutant library bacterial solution was inoculated in 2×YT-ATG liquid culture medium (preserved after five rounds of solid phase screening by the inventor team in the early stage, and operated according to the invention patent application Example 1 of the patent application number 202211576619.8 and the invention name "A high-affinity anti-PD-L1 human antibody and its application"), and after culturing to the logarithmic growth phase, a helper phage VCSM13 with an infection multiplicity of 20 was added, and the cells were respectively incubated in a 37°C water bath for 30 minutes and shaken at 37°C and 100rpm for 30 minutes. Then the cells were precipitated by centrifugation at 4000g for 20 minutes, and the cells were resuspended with an equal volume of 2×YT-ATK liquid culture medium and shaken overnight at 30°C. The next day, the overnight culture solution was collected and centrifuged at 4°C and 10,000 g for 20 min. The supernatant was transferred to a clean sterile centrifuge tube, and 1 / 5 volume of PEG8000 / NaCl solution (200 g PEG8000 powder and 146.1 g NaCl were stirred and dissolved in 800 mL of ddH2O, fixed to 1 L, autoclaved for 20 min and stored at 4°C for later use) was added and concentrated on ice for 1 hour. The concentrated bacterial solution was centrifuged at 4°C and 10,000 g for 20 min, the supernatant was discarded, the phage precipitate was resuspended with 1 mL PBS, and filtered through a 0.22 μm filter, and dispensed into sterile centrifuge tubes on ice and stored at 4°C.

[0065] The concentrated phage antibody library was diluted by the doubling dilution method, and the Escherichia coli XL1-Blue in the logarithmic growth phase was infected, and 2×YT plates containing ampicillin were coated. The rescued phage antibody library was titrated to determine the library capacity of the phage antibody library.

[0066] (2) Solid-phase screening of phage antibody mutation library targeting PD-L1:

[0067] First, PD-L1 (Jinan Protein Technology Co., Ltd.) was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer, pH 9.6, and coated on an ELISA plate at 4°C overnight. The next day, 200 μL of 5% (w / v) skim milk powder prepared with PBS (0.01 M, pH 7.4) containing 0.05% (v / v) Tween 20 was added and blocked at 37°C for 2 h. The blocking solution was discarded and 100 μL of phage antibody library (about 10 13 CFU), incubate at 37℃ for 2h, discard the residual phage antibody solution, wash 5 times with PBST (10 times in the second round, and more than 20 times thereafter). Add 100μL Gly-HCL eluent (glycine-hydrochloric acid buffer, 0.1mol / L, pH 2.2) to each well and incubate at room temperature for 10min, with sufficient blowing during the period. Then immediately add 6μL 2M Tris solution, mix gently, and neutralize the eluted phage antibody.

[0068] The collected phage antibody eluate was added to 2 mL of E. coli XL1-Blue in the logarithmic growth phase, and incubated at 37°C for 30 min to allow the phage antibody to fully infect the E. coli. 100 μL of the diluted solution was applied to a 2×YT-Amp (100 μg / mL ampicillin concentration) plate to determine the phage antibody library capacity, and the rest was applied to a 2×YT-ATG plate. The next day, the solution was collected using 2×YT-G liquid culture medium. After the bacterial solution concentration was determined, 50% glycerol was added to obtain the screened phage antibody bacterial library.

[0069] (3) Preparation of phage antibodies and detection of anti-PD-L1 specificity:

[0070] From the selected culture plate, randomly pick colonies and culture them in 2×YT-ATG culture medium at 37°C overnight. The next day, take 20μL of bacteria to 400μL 2×YT-ATG medium, culture at 37°C until the logarithmic growth phase, and add helper virus VCSM13. First stand at 37°C for 30 minutes, then shake culture at 37°C for 30 minutes at 100rpm. After centrifugation at 4000g for 10 minutes, resuspend the bacterial pellet with an equal volume of 2×YT-ATK liquid culture medium, and collect the supernatant after culturing at 30°C overnight.

[0071] Perform ELISA testing according to the following procedure: dilute the antigen (i.e., PD-L1) to 10 μg / mL, coat the ELISA plate with 100 μL of the diluted antigen, and discard the liquid in the wells after coating overnight at 4°C. Add 200 μL of 5% skim milk powder prepared with PBS (0.01M, pH 7.4) containing 0.05% Tween 20 to block, then add the prepared phage antibody, incubate at 37°C for 2 hours, wash 5 times with PBST, add 1:10000 diluted HRP-anti-M13 mouse monoclonal antibody (Sino Biological) for reaction, add TMB substrate for color development after washing, and read the A450 value. The results are as follows Figure 1 As shown, some clones have high absorbance values, while others have low absorbance values. Then, 10 clones with higher A450 values ​​were selected for sequencing.

[0072] (4) Determination of relative affinity of positive phage antibodies:

[0073] According to the sequencing results, clones with repeated sequences were removed, and the remaining 8 clones were subjected to relative affinity determination. The specific steps are as follows:

[0074] The positive phage antibodies after sequencing analysis were prepared in large quantities using the same method as above.

[0075] The antigen (i.e., PD-L1) was diluted to 1 μg / mL, and 100 μL of the diluted antigen was used to coat the ELISA plate. After coating overnight at 4°C, the liquid in the wells was discarded. 200 μL of 5% skim milk powder prepared with PBS (0.01M, pH 7.4) containing 0.05% Tween 20 was added for blocking, and then the prepared positive phage antibody was added. Each clone was repeated in 8 wells, incubated at 37°C for 2h, and washed 5 times with PBST. Then 100 μL of different concentrations of NH4SCN (0, 1, 2, 3, 4, 5, 6, 7 mol / L) was added to each well and incubated at room temperature for 15 minutes. After washing with PBST 5 times, a 1:10000 diluted HRP-anti-M13 mouse monoclonal antibody (Sino-Bio) was added for reaction. After washing, TMB substrate was added for color development, and the A450 value was read. The test results are as follows: Figure 2 As shown, it can be seen that the relative affinity of the antibody prepared by the screened clone (mut25, relative affinity of 3.85) is increased by 6 times compared with the original strain fab48 (i.e., the parent Fab antibody (NC) in CN202211576619.8, with a relative affinity of 0.64).

[0076] The sequence of mut25 is as follows:

[0077] The gene sequence encoding the heavy chain variable region (VH) of the anti-PD-L1 Fab antibody (SEQ ID NO.2) is as follows:

[0078] GAGGTGCAGCTGCTCGAGTCTGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCGGGGAAGGGACTGGAGTGGGTGGCCAACATAAAGCAAGATGAAAGTACGAAAAACTATGT GGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGTTTGGTGGCCGGGCCGGGCCGCCCTGAGCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA.

[0079] The gene sequence encoding the light chain variable region (VL) of the anti-PD-L1 Fab antibody (SEQ ID NO.4) is as follows:

[0080] CAGGACCCTGTTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGG ATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACGCCGTCCTCGACTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTA.

[0081] Example 2

[0082] The disulfide bond-stabilized anti-PD-L1 humanized double-chain antibody of the present invention is based on the VL gene and VH gene fragments encoding the anti-PD-L1 Fab antibody prepared in Example 1, and covalent disulfide bonds are introduced into the antibody VL and VH (the glycine at position 95 of the light chain and the glycine at position 44 of the heavy chain are mutated into cysteine), and a gene fragment encoding a connecting peptide (amino acid sequence of GGGGS) is used to construct a VL-GGGGS-VH gene fragment (length of 684 bp), and the two expressed VL-GGGGS-VH (molecular weight of 52.14KD) molecules are covalently connected by disulfide bonds to form a disulfide bond-stabilized The double-chain antibody was prepared by analyzing the codon usage frequency (CAI value, which is positively correlated with the expression level of the exogenous gene in the host. It is generally believed that CAI between 0.8 and 1.0 can increase the expression level of the exogenous protein in the host bacteria P. pastoris) corresponding to the gene sequence. The gene sequence was optimized using the codon online optimization website to increase the codon usage frequency and adjust the GC content at the same time, increasing the CAI value of the sequence from 0.61 to 0.97, and adjusting the GC content from 58% to 41%.

[0083] The optimized gene nucleotide sequence of the anti-PD-L1 humanized double-chain antibody (SEQ ID NO.6) is as follows:

[0084] .

[0085] The disulfide bond-stabilized anti-bFGF humanized double-chain antibody of the present invention is based on the antibody gene sequence obtained by the inventor's team in the early stage as a template, and the codon optimization and GC content adjustment are also performed to increase the CAI value of the sequence from 0.63 to 0.96, and adjust the GC content from 54% to 44%:

[0086] The optimized gene nucleotide sequence of the anti-bFGF humanized double-chain antibody (SEQ ID NO.7) is as follows:

[0087] .

[0088] Using the optimized anti-PD-L1 ds-Diabody sequence and anti-bFGF ds-Diabody sequence as templates, the VL and VH of the two antibodies were amplified separately by PCR, and a linker with three repeating units (GGGGS) was introduced at the 5' end of the VL of anti-bFGF and the 3' end of the VH. The sequences were connected in the order of PL-Linker, Linker-BH-(G4S), (G4S)-BL-Linker, and Linker-PH by homologous recombination.

[0089] The nucleotide sequence of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody gene (SEQ ID NO.9) is as follows:

[0090]

[0091] The method for constructing the dual-targeting PD-L1 and bFGF bispecific Diabody antibody gene of the present invention comprises the following steps:

[0092] PCR amplification of four gene fragments: anti-PD-L light chain variable region + Linker (PL-Linker), Linker + anti-bFGF antibody heavy chain variable region (Linker-BH), anti-PD-L heavy chain variable region + Linker (BL-Linker), and anti-PD-L light chain variable region + Linker (Linker-PH):

[0093] Reaction 1): Design primers:

[0094] Primer 1: 5′-AGAGAGGCTGAAGCTGAATTCCAAGATCCAG-3′;

[0095] Primer 2: 5′-AGAACCACCACCACCCAAAACAGTCAACTT-3′.

[0096] Reaction system ① is: 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), 2 μL each of primer 1 and primer 2 (10 μmol / L), 2 μL of pPICZαA-anti-PD-L1 ds-Diabody recombinant vector (synthesized by Beijing Qingke Biotechnology Co., Ltd., with the nucleic acid sequence as shown in SEQ ID NO.6 inserted into the EcoR I and Not I restriction sites on the pPICZαA vector), and 19 μL of sterile deionized water; the total volume is 50 μL.

[0097] The PCR amplification program was as follows: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 65°C annealing for 20 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, gel recovery and purification to obtain the recombinant fragment of PL-Linker.

[0098] Reaction 2): Design primers:

[0099] Primer 3: 5′-GGTGGTGGGTGGTTCTGAGGTTCAATTGTTG-3′;

[0100] Primer 4: 5′-TGTTCTAGAAAGCTGGCGGCCGCATTATGGTGATGATGATG-3′.

[0101] Reaction system ② is: 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), 2 μL each of primer 3 and primer 4 (10 μmol / L), 2 μL of pPICZαA-anti-PD-L1 ds-Diabody recombinant vector, and 19 μL of sterile deionized water; the total volume is 50 μL.

[0102] The PCR amplification procedure is:

[0103] Pre-denaturation at 98°C for 3 min; 30 cycles of denaturation at 98°C for 10 s, annealing at 65°C for 20 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, gel recovery and purification to obtain the recombinant fragment of Linker-PH.

[0104] Reaction 3): Design primers:

[0105] Primer 5: 5′-AGAGAGGCTGAAGCTGAATTCCAATCCGTT-3′;

[0106] Primer 6: 5′-AGAACCACCACCACCCAACACTGTCAATTT-3′.

[0107] Reaction system ③ is:

[0108] 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), 2 μL each of primer 5 and primer 6 (10 μmol / L), 2 μL of pPICZαA-anti-bFGF ds-Diabody recombinant vector (synthesized by Beijing Qingke Biotechnology Co., Ltd., with the nucleic acid sequence as shown in SEQ ID NO.7 inserted into the EcoR I and Not I restriction sites on the pPICZαA vector), and 19 μL of sterile deionized water; the total volume is 50 μL.

[0109] The PCR amplification program is:

[0110] Pre-denaturation at 98°C for 3 min; 30 cycles of denaturation at 98°C for 10 s, annealing at 65°C for 20 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, gel recovery and purification to obtain the recombinant fragment of (G4S)-BL-Linker.

[0111] Reaction 4): Design primers:

[0112] Primer 7: 5′-GGTGGTGGTGGTTCTCAAGTCCAACTGCAAG-3′;

[0113] Primer 8: 5′-CAGATCCTCTTCTGAGATGAGTTTTTGTTCTGAACTAACGGTAAC-3′.

[0114] Reaction system ④ is: 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), 2 μL each of primer 7 and primer 8 (10 μmol / L), 2 μL of pPICZαA-anti-bFGF ds-Diabody recombinant vector, and 19 μL of sterile deionized water; the total volume is 50 μL.

[0115] The PCR amplification program was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 65°C annealing for 20 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, gel recovery and purification to obtain the recombinant fragment of Linker-BH-(G4S).

[0116] The agarose gel electrophoresis results of the fragments constructed above are as follows Figure 3 shown.

[0117] (II) Construction of recombinant expression vector pPICZαA-bispecific diabody (abbreviated as pPICZαA-Bispecificdiabody)

[0118] ① The expression vector pPICZαA was double-digested with EcoRⅠ and NotⅠ restriction endonucleases respectively.

[0119] Enzyme digestion system (50 μL): pPICZαA fragment 1 μg, 10×Buffer H 5 μL, BSA 5 μL, NotⅠ(4~12U / μL) 2 μL, EcoRI(8~20U / μL) 2 μL, add deionized water to a final volume of 50 μL. Digest at 37℃ for 8 h, and the digestion reaction product was subjected to 1.5% agarose gel electrophoresis, gel recovery and purification to obtain expression vector pPICZαA with EcoRI and NotⅠ restriction enzyme sites.

[0120] ② Through homologous recombination, the sequences were connected to the double-enzyme-cut expression vector pPICZαA in the order of PL-Linker, Linker-BH-(G4S), (G4S)-BL-Linker, and Linker-PH.

[0121] Reaction system (10 μL): 5×CE II Buffer 2 μL, Exnase II 1 μL (Beijing Qingke Biotechnology Co., Ltd.), PL-Linker 1 μL, Linker-BH-(G4S) 1 μL, (G4S)-BL-Linker 1 μL, Linker-PH 1 μL, sterile deionized water 3 μL, total volume 10 μL.

[0122] The reaction was carried out at 37°C for 30 min. The recombinant reaction product was transformed into E. coli DH5α competent cells and inoculated on a low-salt (NaCl content: 3.75 mg / mL) LB agarose plate containing 25 μg / mL Zeocin+ overnight. A single colony was randomly picked for PCR amplification of the bacterial solution to preliminarily identify the construction of the recombinant expression vector. The results are as follows Figure 4 As shown, it shows that the recombinant expression vector pPICZαA-bispecific diabody was successfully constructed.

[0123] (III) Expression of dual-targeting antibodies and Western-Blot identification

[0124] (1) Transformation of Pichia pastoris GS115 with the recombinant expression vector pPICZαA-bispecific diabody

[0125] First, streak the Pichia GS115 stored at -80℃ on a YPD plate, invert and culture at 28℃ for 2-3 days until a white round single colony grows. Then select a well-separated single colony of Pichia inoculated in 5mL of YPD liquid medium and activate it overnight at 29℃ and 230rpm. The next day, take 1mL of the overnight culture solution and inoculate it into 100mL of YPD liquid medium, and culture it at 29℃ and 230rpm until the logarithmic growth phase of Pichia, that is, the OD600 value is 1.0-1.3. Place the yeast solution in a 50mL centrifuge tube, centrifuge at 4℃ and 4000rpm for 5min to collect the bacteria, discard the supernatant, and absorb the residual liquid. Add 40mL of pre-cooled sterile water to resuspend, wash the bacteria, centrifuge at 4℃ and 4000rpm for 5min, discard the supernatant; and repeat this step once. Add 10 mL of pre-cooled sterile water to wash the cells, centrifuge at 4°C, 4000 rpm for 5 min, and discard the supernatant. Add 10 mL of pre-cooled 1 M sorbitol to resuspend the cells, centrifuge at 4°C, 4000 rpm for 5 min, and discard the supernatant. Finally, add 200 μL of ice-cold 1 M sorbitol to resuspend the cells, and dispense on ice, 80 μL per tube, which is the GS115 competent cells, ready for use.

[0126] The recombinant expression vector pPICZαA-bispecific diabody with the correct sequence was inoculated into a low-salt LB medium containing 25 μg / mL Zeocin, and cultured at 37°C with shaking at 230 rpm for 16 h. The recombinant plasmid pPICZαA-bispecific diabody was extracted using a plasmid mini-extraction kit. The recombinant plasmid was linearized with restriction endonuclease SacⅠ. The enzyme digestion system was as follows: 40 μL of recombinant expression vector pPICZαA-bispecific diabody, 2 μL of SacⅠ restriction enzyme, 5 μL of 10×H Buffer, and deionized water was added to a total volume of 50 μL. The enzyme digestion was performed at 37°C overnight, and the linearized pPICZαA-bispecific diabody plasmid was subjected to 1.5% agarose gel electrophoresis, and the completely linearized plasmid band was excised and recovered.

[0127] The linearized recombinant plasmid was transformed into Pichia pastoris competent cells by electroporation (electroporation instrument parameters: voltage 1.5kV, capacitance 25μF, resistance 400Ω). Immediately after electroporation, 900μL of pre-cooled 1M sorbitol was added to resuspend the cells, and the transformed bacterial solution was transferred to a sterile and clean 1.5mL centrifuge tube, incubated at 28℃ for 2h, and finally 300μL of bacterial solution was spread on a YPD plate containing 250μg / mL Zeocin, and cultured at 28℃ for 3-4d until transformants appeared. Select fast-growing transformants and use a sterilized pipette tip to spot them on a YPD plate containing 0.5μg / mL Zeocin, culture until new transformants appear, and repeat the operation to spot them on YPD plates with a bleomycin concentration of 700μg / mL and 1mg / mL Zeocin in turn.

[0128] White transformants with good growth were selected, and colony PCR was performed using primers D-P1: 5'-GAATTCCA AGATCCAGTTGT-3' and D-P2: 5'-GCGGCCGCATGGTGATGATG-3' to identify positive transformants. The results showed that 41 transformants were able to amplify the target band, indicating that they were all positive transformants.

[0129] (2) Expression of dual-targeting antibodies, Western-Blot and ELISA identification

[0130] The 41 transformants identified as positive were inoculated into test tubes containing 5 mL of YPD liquid medium and cultured overnight at 29°C and 230 rpm. The next day, the overnight bacterial solution was inoculated into a test tube containing 3 mL of BMGY medium at a ratio of 1:100, and cultured at 29°C and 230 rpm until the OD600 value was equal to 4-6. 5 mL of BMMY medium was added to the test tube and cultured at 29°C and 230 rpm. Methanol was added to the culture medium at a final concentration of 1% every 24 hours and cultured continuously for 96 hours. Finally, the bacterial solution was collected into a 15 mL centrifuge tube, centrifuged at 4°C and 8000 rpm for 10 minutes, and the induced expression supernatant was collected.

[0131] The induced expression supernatant was concentrated by TCA. 1 mL of the induced expression supernatant was placed in a 1.5 mL centrifuge tube, 100 μL of 100% TCA was added, and the mixture was placed at -20°C for precipitation overnight. Centrifuge at 12000g for 10 min and discard the supernatant. Then 1 mL of anhydrous ethanol was added, the mixture was resuspended and mixed, and the mixture was centrifuged at 4°C and 12000g for 10 min, and the supernatant was discarded; and the process was repeated once to ensure that TCA was completely removed. Finally, the protein precipitate was dried at room temperature for 30 min to evaporate the ethanol, and then re-dissolved with 50 μL ddH2O, and 5× Loading Buffer was added and mixed, and the mixture was boiled in boiling water for 10 min and stored at -20°C for later use.

[0132] Take 25 μL of the concentrated sample and perform molecular cloning. After reducing SDS-PAGE, perform Western-Blot identification. The results are as follows: Figure 5 As shown, after reducing SDS-PAGE, there is a protein band near the molecular weight of 60 kDa, indicating that the dual-targeting construction is successful.

[0133] (IV) Research on the separation and purification conditions of dual-targeting antibodies.

[0134] (1) Study on the concentration of saturated ammonium sulfate precipitation

[0135] The yeast expression supernatant was centrifuged at 4°C and 8500rpm for 10min, and the supernatant was collected and dispensed into 5mL EP tubes at 2mL per tube. Different amounts of pH=8.0 saturated ammonium sulfate solution were added to it, so that the final concentration of saturated ammonium sulfate solution was 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, and 60%. It was placed at 4°C for 48h to wait for the precipitation to fully precipitate. The protein precipitate was collected by centrifugation at 4°C. 20μL PBS was added to dissolve the precipitate, and then 5× loading buffer was added. After boiling in boiling water for 10min, SDS-PAGE was performed for identification.

[0136] (2) Study on the nickel ion affinity chromatography purification conditions of dual-targeting antibodies

[0137] Add a saturated ammonium sulfate solution with a pH value of 8.0 to the supernatant collected by centrifugation to a final concentration of 50%, and place it at 4°C for 36 to 48 hours. Collect the protein precipitate by centrifugation at 4°C, and dissolve it by adding a PBS buffer with a pH value of 7.4. Heat the dialysis bag for activation and leak detection, add the protein solution, and dialyze it at 4°C with PBS. Change the buffer every 2.5 hours and repeat 3 times. Centrifuge the dialyzed liquid at 4°C to collect the supernatant, and filter it with a 0.45μm filter membrane to prevent clogging of the nickel column. Wash the nickel column with deionized water and a PBS buffer with an imidazole concentration of 25mM. Use a 500mM imidazole solution to adjust the imidazole concentration in the sample solution to 25mM, then load the sample, and collect the protein solution corresponding to the peak in the process. Next, wash the unbound proteins with PBS containing 25mM imidazole, elute the impurities with PBS containing 50mM imidazole and 75mM imidazole, elute the target protein with PBS containing 100mM imidazole and 150mM imidazole, elute the remaining residual proteins with PBS containing 300mM imidazole and 500mM imidazole, and collect the peak solutions of each process. Add 5× loading buffer to the collected peak solutions, perform SDS-PAGE identification, and analyze the column flow. The results are as follows: Figure 6 As shown in the figure, 25mM imidazole can elute most of the impurities, and the target protein in the sample is successfully attached to the column. When the imidazole concentration is 50mM, a small amount of the target protein has been eluted, and 75mM and 100mM can elute most of the target protein. 300mM imidazole did not elute the protein, indicating that under the condition of 150mM imidazole, all the target proteins have been eluted. Subsequent purification conditions can use 25mM imidazole to elute impurities and 100mM imidazole to elute the target protein.

[0138] Example 3

[0139] The following is a test of the relevant biological activity of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody prepared according to the above method. The test method and results are as follows:

[0140] (A) Indirect ELISA was used to detect the binding activity of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody with antigens PD-L1 and bFGF.

[0141] Recombinant human PD-L1 (Jinan Protein Technology Co., Ltd.) was diluted to 1 μg / mL with 0.05 mol / L carbonate buffer, pH 9.6, and 100 μL per well was coated on the ELISA plate. After incubation at 37°C for 3 h, the liquid in the wells was discarded and the plates were washed three times with PBST (PBS containing 0.015 mol / L, pH 7.4, 0.05% Tween-20 by volume). After blocking with 5% skim milk-PBST by mass percentage, a certain concentration of the dual-targeted antibody prepared in Example 2 and ds-Diabody against PD-L1 were added at 100 μL / well, incubated at 37° C. for 1 h, washed 3 times with PBST, and then 100 μL of anti-His-tag mouse monoclonal antibody (Mingyan Bio) diluted at 1:5000 was added to each well, incubated at 37° C. for 1 h, washed 3 times with PBS-T, and 100 μL of HRP-labeled goat anti-mouse polyclonal antibody (Beijing Solebold Technology Co., Ltd.) diluted at 1:5000 was added to each well, incubated at 37° C. for 0.5 h, washed 5 times with PBST, and then TMB was added for color development, and the A450 value was measured. PBS was used as a negative control in the experiment.

[0142] The results are as follows Figure 7 As shown, compared with anti-PD-L1 ds-Diabody, dual targeting can still specifically bind to the antigen PD-L1 better and still has good affinity.

[0143] Recombinant human bFGF (Beijing Abcam Biopharmaceutical Technology Co., Ltd.) was diluted to 1 μg / mL with 0.05 mol / L carbonate buffer, pH 9.6, and 100 μL per well was coated on the ELISA plate. After incubation at 37°C for 3 h, the liquid in the wells was discarded and the plates were washed three times with PBST (PBS containing 0.015 mol / L, pH 7.4, 0.05% Tween-20 by volume). After blocking with 5% skim milk-PBST by mass percentage, a certain concentration of the dual-targeted antibody prepared in Example 2 and ds-Diabody against bFGF were added at 100 μL / well, incubated at 37°C for 1 h, washed 3 times with PBST, and then 100 μL of anti-His-tag mouse monoclonal antibody (Mingyan Bio) diluted at 1:5000 was added to each well, incubated at 37°C for 1 h, washed 3 times with PBS-T, and 100 μL of HRP-labeled goat anti-mouse polyclonal antibody (Beijing Solebow Technology Co., Ltd.) diluted at 1:5000 was added to each well, incubated at 37°C for 0.5 h, washed 5 times with PBST, and then TMB was added for color development, and the A450 value was measured. PBS was used as a negative control in the experiment.

[0144] The results are as follows Figure 8 As shown, compared with the anti-bFGF ds-Diabody, the dual-targeting can still specifically bind to the antigen bFGF better and still has good affinity.

[0145] (II) Immunofluorescence staining to detect the localization of antibody protein in HEPG2

[0146] Add 1 mL of DMEM medium containing 10% FBS and dual antibodies (0.1 kU / mL penicillin, 0.1 mg / mL streptomycin) to a 20 mm laser confocal culture dish, take 100 μL of the digested transfected cell suspension and add it to the dish, shake well, and culture at 37°C, 5% CO2 for 6 hours to allow the cells to adhere to the wall. Wash the cells twice with PBS, no antibody was added to the blank control group, and 100 μg / mL of anti-PD-L1ds-Diabody and bispecific diabody were added to the experimental group, respectively, and cultured for 5 hours. Prepare the cell membrane red staining reagent working solution in a light-proof environment; add 1 mL of working solution to each dish after washing with PBS, and incubate at 37°C, 5% CO2 for 5 minutes; add 1 mL of 4% paraformaldehyde to each dish after washing with PBS for fixation, and incubate at room temperature for 1 hour; add 1 mL of anti-HIS mouse monoclonal antibody diluted 1:1000 with antibody diluent to each dish after washing with PBS, put it in a 4-degree shaker and shake it slowly, and incubate overnight; after completing the recovery of the primary antibody, wash the cells thoroughly with PBS, and then add 1 mL of fluorescent secondary antibody Goat Anti-Mouse IgG H&L / AF488 diluted 1:1000 with antibody diluent. Then incubate at room temperature for two hours to ensure that the fluorescent secondary antibody is fully combined with the sample. After the recovery of the secondary antibody, wash the sample three times with PBS, each washing time is 5 minutes. After washing, add 1 mL of PBS to infiltrate the cells, and pay attention to placing the culture dish in the dark to prepare for subsequent observation. Use a laser confocal microscope to observe the fluorescence of liver cancer cells under light-proof conditions. The cell membrane was observed under the conditions of excitation light of 549 nm and emission light of 565 nm; the antibody protein was observed under the conditions of excitation light of 488 nm and emission light of 515 nm.

[0147] The results are as follows Fig. 9 As shown, the Merge fluorescence composite image shows that except for the blank control group, which did not show green fluorescence on the surface of liver cancer cells, the experimental groups were able to capture green fluorescence, proving that the prepared antibody protein can bind to the cell membrane surface of liver cancer cells. This experiment proved that both anti-PD-L1 ds-Diabody and bispecific diabody can bind to the PD-L1 ligand on the surface of tumor cells and have biological activity.

[0148] (III) T cell co-culture to detect the activity of dual-targeting antibodies binding to PD-L1

[0149] Tumor cells were expressed at 2×10 5The cells were inoculated at a density of 10 cells / well in a 6-well plate and cultured. After adherence, the cells were transfected with lipo2000 and PLVX-OE-PD-L1 (PLVX-OE-PD-L1 was obtained by inserting the nucleotide sequence 873nt in NCBI accession number CCDS6464.1 between Xho I and BamH I in the pLVX-Puro vector). Jurkat cells were activated with phytohemagglutinin (PHA) (PHA dosage was 1 μg / mL) for 48 hours. Activated Jurkat cells (2×10 6 Cells / well) were added to tumor cells (liver cancer cells HepG2 and SK-Hep-1, respectively), and anti-PD-L1 ds-Diabody and bispecific diabody were added at a final concentration of 200 μg / mL, respectively, and co-cultured at 37°C, 5% CO2 for 48 hours. After aspirating the supernatant, the cells were washed twice with PBS, and 1 mL of 4% paraformaldehyde was added to each well to fix the cells at room temperature for 1 hour. 1 mL of 0.1% crystal violet staining solution was added to each well, and the OD was measured on a multifunctional microplate reader after staining at room temperature for 30 minutes. 570 The absorbance was measured and statistical analysis was performed.

[0150] The results are as follows Fig.10 As shown, compared with the negative control group without antibody, the survival rate of liver cancer cells in the antibody groups of the two cells was significantly reduced, indicating that the prepared antibodies can bind to PD-L1 on the surface of liver cancer cells and block its binding with PD-1 on the surface of T cells.

[0151] (IV) CCK8 experiment to detect the effect of dual-targeting antibody binding on the proliferation ability of liver cancer cells

[0152] The cell density was adjusted to 4 × 10 3 100 cells / well were plated in a 96-well plate and cultured for 24 hours. After the cells adhered, they were switched to low-serum culture medium (DMEM culture medium with 1% serum content) for starvation treatment for 12 hours. Anti-bFGF ds-Diabody and bispecific diabody with final concentrations of 6.25, 12.5, 25, 50, 100, and 200 μg / mL, as well as negative control PBS were added according to the grouping. The culture medium used in each group contained 10 ng / mL of bFGF. After 48 hours, the old culture medium was aspirated, CCK8 solution was added, and the culture was continued for about 1 to 4 hours, and the OD 450 Absorbance value. Calculate cell proliferation inhibition rate according to the formula = 100% × (OD 450 Negative control - OD 450 Experimental group) / (OD 450 Negative control - OD 450 blank group).

[0153] The results are as follows Fig.11 As shown, the bispecific diabody still maintains a better ability to inhibit the proliferation of liver cancer cells compared to anti-bFGF ds-Diabody.

[0154] (V) Plate cloning experiment to detect the effect of dual-targeting antibody binding on the proliferation ability of liver cancer cells

[0155] The cell density was adjusted to 2 × 10 4 Each well was plated in a six-well plate, and anti-bFGF ds-Diabody, bispecific diabody and an equal volume of PBS were added to the six-well plate at a final concentration of 200 μg / mL for culture. The culture medium used in each group contained 10 ng / mL of bFGF. The culture was terminated when there were about 50 cells in each clone. The cells were fixed with paraformaldehyde, stained with crystal violet dye, washed with PBS, and then inverted at room temperature to dry. The six-well plate was placed on a shadowless lamp for photography, and the clones were counted using Image J software.

[0156] The results are as follows Fig.12 As shown in the figure, compared with the control group, both anti-bFGF ds-Diabody and bispecific diabody can significantly inhibit the cloning ability of the two liver cancer cells. In addition, the difference analysis of the cloning rate in the two antibody experiments found that there was no significant difference between the experimental results of the two antibodies at the same concentration in the two cells, indicating that the bispecific diabody still maintains a good ability to inhibit the proliferation of liver cancer cells compared with anti-bFGF ds-Diabody.

[0157] (VII) Transwell migration assay to detect the effect of dual-targeting antibody binding on the migration ability of liver cancer cells

[0158] After starvation for 12 h, the cell density was adjusted to 2 × 10 5 / mL. Anti-bFGF ds-Diabody, bispecific diabody and an equal volume of PBS were added to a 24-well plate at a final concentration of 200μg / mL. The culture medium used in each group was DMEM culture medium containing 10ng / mL bFGF. 100μL of cell suspension was added to the upper chamber, and then placed in a 24-well plate with tweezers. After 48h of culture, the chamber was removed and washed with PBS. Fix with paraformaldehyde, stain with crystal violet dye, and then wash with PBS. Use a cotton swab to wipe off the cells that have not migrated out of the chamber, take a picture in a cell imager, and analyze with ImageJ. Enter the formula: migration rate = (number of migrated cells in the experimental group / number of migrated cells in the control group) × 100% for calculation.

[0159] The results are as follows Fig.13 The experiment showed that both anti-bFGF ds-Diabody and bispecific diabody could inhibit the migration of liver cancer cells. In addition, the difference analysis of the migration rate in the two antibody experiments showed that there was no significant difference in the migration rate between the two antibody treatment groups in the two cells, indicating that the bispecific diabody still maintained a good ability to inhibit the migration of liver cancer cells compared with anti-bFGF ds-Diabody.

[0160] (VIII) Transwell invasion assay to detect the effect of dual-targeting antibody binding on the invasion ability of liver cancer cells

[0161] The consumables used in the experiment were pre-cooled at -20°C, and Matrigel was placed at 4°C to melt. Dilute Matrigel with pre-cooled DMEM culture medium at a volume ratio of 8:1 on ice, add 100μL Matrigel to the chamber, let it stand at 37°C for 2 hours, discard the unsolidified part, add 100μL serum-free culture medium, and discard the residual liquid after 30 minutes. Add anti-bFGF ds-Diabody, bispecific diabody with a final concentration of 200μg / mL, and an equal volume of PBS to a 24-well plate containing 1mL of complete culture medium. The culture medium used in each group contained 10ng / mL of bFGF. The cells that had been starved for 12 hours were adjusted to a cell density of 3×10 4 / chamber, and then put the chamber into a 24-well plate. After 48 hours of culture, take out the chamber, gently wipe the cells and Matrigel on the inner membrane of the upper chamber with a cotton swab, and wash with PBS. Fix with paraformaldehyde, stain with crystal violet dye, and then wash with PBS. Take pictures under an upright microscope, cell invasion rate = (number of invasive cells in the experimental group / number of invasive cells in the control group) × 100%.

[0162] The results are as follows Fig.14 , indicating that both anti-bFGF ds-Diabody and bispecific diabody can inhibit the invasion of liver cancer cells. In addition, the difference analysis of the invasion rates in the two antibody experiments found that there was no significant difference in the invasion rates between the two antibody treatment groups in the two cells, indicating that bispecific diabody still maintains a good ability to inhibit the invasion of liver cancer cells compared with anti-bFGF ds-Diabody.

[0163] (VIII) Western Blot experiment to detect the effect of dual targeting on the expression level of proliferation and migration-related proteins in liver cancer cells

[0164] Adjust the cell density to 3 × 10 cells / mL using complete medium.5 / mL were plated in six-well plates and cultured for 24h. Starvation treatment was performed with low serum medium. After 12h, 200μg / mL of anti-bFGF ds-Diabody and bispecific diabody were added to the corresponding wells. The culture medium used in each group contained 10ng / mL of bFGF and continued to be cultured for 24h. After digestion, the cell pellet was collected by centrifugation, washed with PBS, and an appropriate amount of cell lysis buffer was added to react on ice for 15min. After centrifugation at 4℃, the supernatant was collected and the protein concentration was detected using the BCA method. Sample preparation was performed by adding loading buffer to the sample. Western Blot was used to detect the levels of p-AKT and p-MAPK related to proliferation, and the changes in the levels of E-cad and N-cad related to EMT were detected.

[0165] The experimental results are as follows Fig.15 As shown, it was verified that both anti-bFGF ds-Diabody and bispecific diabody can inhibit the proliferation and migration of liver cancer cells at the protein level. It was found that in both cells, bispecific diabody still maintained a good ability to inhibit the proliferation and migration of liver cancer cells compared with anti-bFGF ds-Diabody.

[0166] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An antibody targeting PD-L1, comprising a light chain and a heavy chain; characterized in that: The amino acid sequences of the three CDRs on the light chain are as follows: CDR1 is SLRSYY, CDR2 is GKN, and CDR3 is NSRDAVLDWV; The amino acid sequences of the three CDRs on the heavy chain are as follows: CDR1 is GGSISSYY, CDR2 is IKQDESTK, and CDR3 is ARVWWPGRAALSDY.

2. The antibody targeting PD-L1 according to claim 1, characterized in that: The amino acid sequence of the heavy chain is shown in SEQ ID NO.1; The amino acid sequence of the light chain is shown in SEQ ID NO.

3.

3. The antibody targeting PD-L1 according to claim 2, characterized in that: The sequence of the heavy chain encoding nucleic acid is shown in SEQ ID NO.2; The sequence of the light chain encoding nucleic acid is shown in SEQ ID NO.

4.

4. The antibody targeting PD-L1 according to claim 1, characterized in that: The antibody targeting PD-L1 is a disulfide bond-stabilized humanized anti-PD-L1 double-chain antibody, and its amino acid sequence is further shown in SEQ ID NO.

5.

5. A nucleic acid molecule, characterized in that: The nucleic acid molecule is a nucleic acid encoding the antibody targeting PD-L1 as described in any one of claims 1 to 4; its nucleic acid sequence is further shown in SEQ ID NO.

6.

6. Use of the antibody targeting PD-L1 according to any one of claims 1 to 4 or the nucleic acid molecule according to claim 5 in the preparation of an anti-tumor drug.

7. A bispecific double-chain antibody targeting PD-L1 and bFGF, characterized in that: A protein obtained by connecting the antibody targeting PD-L1 and the antibody targeting bFGF according to any one of claims 1 to 4 with or without a connecting peptide; comprising 6 CDRs of the antibody targeting PD-L1 and 6 CDRs of the antibody targeting bFGF; wherein, The amino acid sequences of the six CDRs of the antibody targeting PD-L1 are as follows: CDR1 of the light chain is SLRSYY, CDR2 of the light chain is GKN, CDR3 of the light chain is NSRDAVLDWV, CDR1 of the heavy chain is GGSISSYY, CDR2 of the heavy chain is IKQDESTK, and CDR3 of the heavy chain is ARVWWPGRAALSDY; The amino acid sequences of the six CDRs of the antibody targeting bFGF are as follows: CDR1 of the light chain is SSDVGGYNY, CDR2 of the light chain is DVS, CDR3 of the light chain is SSYTSSSTVV, CDR1 of the heavy chain is GFTFSSYE, CDR2 of the heavy chain is ISSSGSTI, and CDR3 of the heavy chain is ARELTGDWGAFDIW.

8. The bispecific diabody targeting PD-L1 and bFGF according to claim 7, characterized in that: The amino acid sequence of the bispecific double-chain antibody targeting PD-L1 and bFGF is shown in SEQ ID NO.

8.

9. A product, characterized in that: The product is selected from any one of the following: 1) A nucleic acid molecule encoding the bispecific double-chain antibody targeting PD-L1 and bFGF according to claim 7 or 8; the nucleotide sequence of which is further shown in SEQ ID NO.9; 2) A recombinant expression vector containing the nucleic acid molecule described in 1); 3) A recombinant expression cell containing the nucleic acid molecule described in 1) or the recombinant expression vector described in 2).

10. Use of the bispecific double-chain antibody targeting PD-L1 and bFGF according to claim 7 or 8 in the preparation of anti-tumor drugs.

Images