Use of a sensitizer of a parpi in the treatment of malignant tumors

Abstract

The application provides an application of a sensitizer of PARPi in treatment of malignant tumors, and particularly relates to the field of biological medicine technology.The application proves for the first time that TRMT10A is crucial for the recruitment of BRCA1 to DNA damage sites, thereby promoting HR repair.A loss of TRMT10A inhibits HR repair, making tumor cells more sensitive to PARPi.It is revealed that the expression of TRMT10A is up-regulated in mCRPC and is regulated by ubiquitin-specific peptidase 10 (USP10).Spautin-1 significantly leads to the lack of TRMT10A and makes tumors sensitive to PARPi in patient-derived xenografts (PDX) and cell-derived xenografts (CDX).Our research reveals the important role of the ATM-TRMT10A-BRCA1 axis in PARP inhibitor sensitization and provides a new perspective for exploring synthetic lethality.This mechanism can be therapeutically utilized through the combination of PARPi and Spautin-1, which may benefit a wider range of non-BRCA malignant tumor patients and has important clinical significance.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of tumor treatment, and particularly relates to application of a PARPi sensitizer in treatment of malignant tumors. BACKGROUND

[0002] Metastatic castration-resistant prostate cancer (mCRPC) is a deadly disease, which is known for its aggressiveness and resistance to androgen antagonistic therapy. Poly (ADP-ribose) polymerase (PARP) inhibitors (PARPi) are particularly effective in cells with homologous recombination (HR) defects, such as cells lacking BRCA1 / 2. However, the utility of PARPi monotherapy is significantly limited, and only 10-15% of BRCA1 / 2-mutated mCRPC patients can obtain clinical benefits. Therefore, it is urgent to develop innovative treatment strategies for non-BRCA-mutated mCRPC patients. SUMMARY

[0003] The present application aims to overcome the above-mentioned defects and deficiencies in the prior art, and provides application of a PARPi sensitizer in treatment of malignant tumors.

[0004] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions.

[0005] The present application discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises a ubiquitin-specific peptidase 10 inhibitor and a PARP inhibitor.

[0006] Further, the ubiquitin-specific peptidase 10 inhibitor is Spautin-1, and the PARP inhibitor is olaparib.

[0007] The present application also discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises a TRMT10A inhibitor and a PARP inhibitor.

[0008] Further, the TRMT10A inhibitor is shRNA, the shRNA nucleotide sequence is shown in SEQ ID No. 1-2, and the PARP inhibitor is olaparib.

[0009] The present application also discloses an olaparib sensitizer, characterized in that it comprises a TRMT10A inhibitor and a ubiquitin-specific peptidase 10.

[0010] Further, the TRMT10A inhibitor is shRNA, and the ubiquitin-specific peptidase 10 inhibitor is Spautin-1.

[0011] The application also discloses application of the drug composition or the sensitizer in preparation of a drug for treating a malignant tumor.

[0012] The application also discloses application of Spautin-1 in preparation of a drug for treating a malignant tumor.

[0013] Further, the drug also comprises olaparib.

[0014] The application also discloses application of a reagent for detecting the expression level of TRMT10A in preparation of a product for auxiliary diagnosis of a malignant tumor.

[0015] The application first clarifies the key role of the ATM-TRMT10A-BRCA1 axis in mediating HR repair and enhancing the efficacy of PARPi in mCRPC. A large number of experiments prove that TRMT10A is crucial for the recruitment of BRCA1 to DNA damage sites, thereby promoting HR repair. The deletion of TRMT10A inhibits HR repair, making tumor cells more sensitive to PARPi. It is revealed that the expression of TRMT10A is up-regulated in mCRPC and is regulated by ubiquitin-specific peptidase 10 (USP10). Spautin-1 (a small molecule inhibitor of USP10) significantly leads to the lack of TRMT10A and makes tumors sensitive to PARPi in patient-derived xenografts (PDX) and cell-derived xenografts (CDX). Our research reveals the important role of the ATM-TRMT10A-BRCA1 axis in PARP inhibitor sensitization and provides a new perspective for exploring synthetic lethality. This mechanism can be therapeutically utilized through the combination of PARPi and Spautin-1, which can benefit a wider range of non-BRCA mCRPC patients.

[0016] Compared with the prior art, the application has the following beneficial effects.

[0017] The application first proposes that the deletion of TRMT10A inhibits HR repair, making tumor cells more sensitive to PARPi. In the case of non-mutation of BRCA1, the combination of PARPi and Spautin-1 is more superior than single PARPi treatment. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1Expression of TRMT10A in prostate cancer patients. (A) Expression level of TRMT10A in cancer and adjacent normal tissues of prostate cancer patients from TCGA database. (B) TRMT10A level in different pathological tumor stages of prostate cancer patients from TCGA database. (C) RNA expression level of TRMT10A in different stages of prostate cancer progression from GEO database. (D) Expression of TRMT10A in castration-resistant PCa patients from GEO database. (E-F) Immunohistochemical analysis of TRMT10A expression in 54 metastatic prostate cancer patient tissues. (G) Analysis of the relationship between increased TRMT10A level and overall survival (OS) of patients. (H) Correlation analysis of TRMT10A with HRR genes BRCA1, BRCA2, RAD51, and PALB2 in prostate cancer tumor tissues. (I) Correlation analysis of TRMT10A level with olaparib drug sensitivity AUC in DepMap database. (J) Comparison of the change trend of BRCA1 and BRCA2 with the level of TRMT10A gene after olaparib intervention in GSE189186.

[0019] Figure 2 TRMT10A is up-regulated in mCRPC patients. (A) TRMT10A mRNA level in paired prostate cancer samples and normal adjacent tissues from TCGA database. (B) TRMT10A IHC scores of non-malignant and malignant specimens of 54 metastatic prostate cancer patients. (C) TRMT10A IHC scores of different Gleason scores in 54 metastatic prostate cancer patients. (D) Mutation frequency of TRMT10A and other 14 known HRR genes in SU2C / PCF 2019 cohort of mCRPC patients from cobioportal database. (E) Mutation frequency of TRMT10A in 5 prostate cancer cohorts from cobioportal database. Data are represented as median and minimum-maximum range (B-C), P values are indicated, **** P<0.0001, *** P<0.001, *P<0.05. Statistical significance was determined using two-tailed unpaired t-test (A-C).

[0020] Figure 3Knocking down TRMT10A inhibits BRCA1 recruitment to DNA damage sites. (A-B) Knocking down TRMT10A inhibits DNA damage clearance. Control or TRMT10A knockout U20S cells were treated without or with IR (2 Gy), harvested at indicated time points, stained with γ-H2AX antibody (red), and nuclei were stained with DAPI (blue). Representative images of γ-H2AX foci at different time points are shown in (A). Quantification of foci number per nucleus is shown in (B). (C) Schematic of DR-GFP / EJ5-GFP reporter system. (D) Relative DNA repair efficiency of control or TRMT10A knockdown cells. (E-F) TRMT10A knockdown sensitizes U20S cells to PARP inhibitor. U20S cells were infected with lentivirus expressing control shrna (shControl) or TRMT10A shrna. Western blot shows knockdown efficiency (E). Cells were treated with different doses of olaparib, and cell survival rate was analyzed 14 days after olaparib treatment (F). (G) Schematic of key DNA repair factors recruitment to DNA damage sites. (H-O) Control and TRMT10A knockdown were treated with IR (1 Gy). Cells were fixed 1 h later, and immunostaining was performed with indicated antibodies. Representative images and quantification of foci number are shown for γ-H2AX (H-I), 53BP1 (J-K), BRCA1 (L-M), and RAD51 (N-O), respectively. (P) Schematic showing that TRMT10A regulates DNA repair at BRCA1 level.

[0021] Figure 4TRMT10A deficiency increases sensitivity to PARP inhibitors. (AB) Sensitivity analysis of olaparib in different prostate cancer cells (22Rv1, DU145, and PC-3). Western blot analysis of TRMT10A protein expression levels in 22Rv1, DU145, and PC-3 cells (A). Olaparib treatment of 22Rv1, DU145, and PC-3 cells for 14 days was performed, and cell viability was analyzed by colony formation assay (B). (CH) TRMT10A knockdown increases cell sensitivity to olaparib. 22Rv1, DU145, and C4-2 cells infected with shrna-expressing lentiviruses were treated with different doses of olaparib, and cell viability of 22Rv1 (CD), DU145 (EF), and C4-2 (GH) cells was analyzed. (IJ) TRMT10A overexpression decreases cell sensitivity to olaparib. PC-3 cells were treated with olaparib expression vector and TRMT10A WT for 14 days. Western blot analysis of TRMT10A overexpression (I), counting of surviving colonies, and analysis of cell viability (J). (KN) TRMT10A affects the sensitivity of PARPi in the CDX model. DU145 cells (7 × 10⁻⁶) were knocked down with either control or TRMT10A. 6 (Subcutaneous injection into the right side of BALB / c nude mice. When the tumor volume reaches 150 mm) 3 Participants were randomly assigned to groups and received drug-loaded olaparib (50 mg / kg) for 5 consecutive days each week. Tumor volume was examined every 5 days, and tumors were harvested for comparison at 45 days (K). Growth curves (L), tumor weight (M), and tumor photographs (N) are displayed (N=5 per group). Data are expressed as mean ± SEM (B, D, F, H, J, L, M), and P-values ​​are used to indicate statistical significance. ****P<0.0001, **P<0.01, P<0.05. Two-tailed unpaired t-tests (B, D, F, H, J, L, M) were used to determine statistical significance. The experiment was independently repeated 3 times, and the results were similar; representative experimental data are shown in Figures A, C, E, G, and I.

[0022] Figure 5 TRMT10A gene knockout increases sensitivity to PARPis in the body. (A)-(D) Figure 4Samples in N were IHC detected with indicated antibodies. Representative images of H&E, Ki-67, Caspase-3 and γ-H2AX staining are shown in (A). Scale bar, 50 μm in 400x field. Quantification of Ki-67 (B), Caspase-3 (C) and γ-H2AX (D) staining is shown in the graph, respectively. Statistical analysis was performed using Student’s t test. (E) Body weight curve of DU145 CDX model shows no significant difference between control and TRMT10A knockout CDX models. Data are shown as mean ± SEM (B-E), P values are indicated, ****P < 0.0001, ***P < 0.001. ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t test (B-E).

[0023] Figure 6 Spautin-1 treatment leads to TRMT10A degradation and HR inhibition. (A) Western blot after Spautin-1 (0, 4 and 8 μΜ) treatment of C4-2 cells for 48 h. (B-G) C4-2 cells were treated with Spautin-1 (0, 4 and 8 μΜ) for 48 h, then immunofluorescence was performed after IR 1 Gy irradiation. Representative images and quantification data of γ-H2AX (B-C), BRCA1 (D-E) and RAD51 (F-G) foci. (H) C4-2 cells were treated with different concentrations of Olaparib and Spautin-1 for 10 d. Colony formation number was counted and survival rate was calculated. (I) Relative DNA repair efficiency after Spautin-1 treatment at different doses for 24 h. (J-M) Representative images of H&E, Ki-67, Cleaved Caspase-3 and γ-H2AX staining are shown in (J). Quantification of Ki-67 (K), Cleaved Caspase-3 (L) and γ-H2AX (M) is shown in the graph, respectively. (N) Body weight curve of CDX22Rv1 shows no significant difference among 4 treatments. Mean number of cells was calculated (C, E, G), 100+ cells in 3 biological replicates. Scale bar, 10 μm. Data are shown as mean ± SEM (C, E, G, H, I, K, L, M, N), P values are indicated, ****P < 0.0001. **P < 0.01, *P < 0.05, ns for no significant change. Statistical significance was determined by two-tailed unpaired t test (C, E, G, H, I, K, L, M, N). Figure 7 n antibodies. Representative images of H&E, Ki-67, Cleaved Caspase-3 and γ-H2AX staining are shown in (J). Quantification of Ki-67 (K), Cleaved Caspase-3 (L) and γ-H2AX (M) is shown in the graph, respectively. (N) Body weight curve of CDX22Rv1 shows no significant difference among 4 treatments. Mean number of cells was calculated (C, E, G), 100+ cells in 3 biological replicates. Scale bar, 10 µm. Data are shown as mean ± SEM (C, E, G, H, I, K, L, M, N), P values are indicated, ****P < 0.0001. **P < 0.01, *P < 0.05, ns for no significant change. Statistical significance was determined by two-tailed unpaired t test (C, E, G, H, I, K, L, M, N).

[0024] Figure 7Treatment with the USP10 inhibitor Spautin-1 resulted in TRMT10A degradation and HR inhibition. (A) Spautin-1 (0 μM, 4 μM, and 8 μM) was applied to 22Rv1 cells for 48 hours. Cells were extracted and Western blotted with the specified antibody. (B) Relative DNA repair efficiency of HEK293T cells after treatment with different doses of Spautin-1 for 24 hours. (CH) 22Rv1 cells were treated with Spautin-1 (0 μM, 4 μM, and 8 μM) for 48 hours and exposed to IR 1 Gy. After 1 h, cells were fixed and immunofluorescence was performed. Representative images and quantitative data of γ-H2AX (CD), BRCA1 (EF), and RAD51 (GH) focal counts. (IJ) 22Rv1 cells were treated with different concentrations of olaparib and Spautin-1 for 10 days, and colony formation was counted. Viability (I) and inhibition rate (J) were calculated. (K~N)Spautin-1 increased the sensitivity of PARPi in 22Rv1-derived cdx models. 22Rv1 cells (1×10⁻⁶) were used. 7 Subcutaneous injection into the right side of BALB / c nude mice. When the tumor volume reached 150 mm... 3 Participants were randomly assigned to groups and received a combination of drug-loaded (50 mg / kg), olaparib (50 mg / kg), and spautin-1 (8 mg / kg) for 5 consecutive days per week. Tumor volume was examined every 3 days, and tumors were harvested on day 29 (K). Growth curves (L), tumor weight (M), and tumor photographs (N) were displayed (N=5 per group). Data are expressed as mean ± SEM (B, D, F, H, I, J, L, M), with P values ​​indicating statistical significance. ****P<0.0001, **P<0.01, *P<0.05, ns indicates no significant change. Two-tailed unpaired t-tests (B, D, F, H, I, J, L, M) were used to determine statistical significance. The experiment was independently repeated three times, with similar results; representative experimental data are shown in Figures A-J. The mean number of cells per cell (D, F, H) was calculated, with more than 100 cells in each of the three biological replicates. Scale bar: 10 µm.

[0025] Figure 8PARPi and Spautin-1 in combination inhibit tumor growth in mCRPC PDX. (AB) PDX models from 4 mCRPC patients. Tumor tissues from PDX generation 1 or 2 (p1 or p2) were collected for TRMT10A and USP10 IHC detection. PDX#546 and #1092, which highly expressed TRMT10A, were selected for further experiments. P3 NOD SCID mice were treated intraperitoneally with drug-loaded olaparib, spautin-1, and PARPi. (A) Schematic diagram. (B) Expression of TRMT10A and USP10 in 4 IHC PDX models. (CE) Freshly excised PDX#546 tumor tissue was subcutaneously transplanted into 5-week-old male NOD SCID mice. When the tumor volume reached 150 mm², the tumor growth was inhibited. 3 Participants were randomly assigned to groups and treated with the drug-loaded steroid, olaparib (50 mg / kg), and spautin-1 (8 mg / kg) for 5 consecutive days per week (see (A)). Tumor volume was examined every 3 days, and tumors were removed on day 29 for comparison. Growth curves (C), tumor weight (D), and tumor photographs (E) are shown (n=5 per group). PDX#1092 (FH) was treated as PDX#546 in (CE). Tumor volume was examined every 3 days, and tumors were removed on day 29 for comparison. Growth curves (C), tumor weight (D), and tumor photographs (E) are shown (n=5 per group). Data are expressed as mean ± SEM (CD, FG). For P-values, ***P<0.001. **P<0.01, *P<0.05, were statistically significant according to a two-tailed unpaired t-test (CD, FG).

[0026] Figure 9 The combined use of PARPi and Spautin-1 synergistically inhibits tumor growth in mCRPC PDX. (A)-(D) Figure 8 Samples in E were subjected to IHC detection using the specified antibody. Representative images of H&E, Ki-67, cleaved Caspase-3, and γ-H2AX (A) are shown, along with quantifications of Ki-67 (B), cleaved Caspase-3 (C), and γ-H2AX (D) staining. (E) Collection Figure 8 Tumor samples in E were subjected to Western blotting using the specified antibody. (F) Body mass curves for PDX#546 showed no significant difference among the four treatment methods. (GJ) Tumor samples were subjected to Western blotting using the specified antibody. Figure 8 Samples in H were subjected to IHC staining. Representative images (G) of H&E, Ki-67, lysed Caspase-3, and γ-H2AX staining are shown, along with quantifications of Ki-67 (H), lysed Caspase-3 (I), and γ-H2AX (J) staining. (K) Collection Figure 8Tumor samples in H were subjected to Western blotting with indicated antibodies. (L) Body weight curve of PDX#1092 showed no significant difference between these four treatment methods. Data are presented as mean ± SEM (B-D, F, H-J, L), P values are indicated, ***P < 0.001. **P < 0.01, *P < 0.05, ns indicates no significant change. Statistical significance was determined by two-tailed unpaired t test (B-D, F, H-J, L). DETAILED DESCRIPTION

[0027] The application will be further described in the following detailed description with reference to the drawings. However, the above-mentioned subject matter of the application should not be limited to the following examples. Any technology achieved based on the content of the application falls within the scope of the application.

[0028] Unless otherwise specified, the reagents and materials used in the application are commercially available.

[0029] I. Reagents

[0030] Chemical reagents such as olaparib (MCE, HY-10162), cycloheximide (CHX, MCE, HY-12320), MG132 (MCE, HY-13259), spautin-1 (TargetMol, T1937) were purchased from the indicated suppliers. The TRMT10A antibody (1:1000) for Western Blot was purchased from Proteintech (17294-1-AP). Other antibodies were used at the indicated dilutions: USP10 (CST, #5553, 1:1000), GAPDH (Proteintech, 60004-1-Ig), FLAG (Sigma, F1804, 1:1000), HA (CST, #3724, 1:1000), KU55933 (Sigma, SML1109, 1:1000), Cleaved-caspase3 (CST, #9664, 1:1000), Cleaved PARP (CST, #9541, 1:1000), γ-H2AX (Sigma, 05-636, 1:1000), Ki-67 (abcam, ab15580, 1:1000).

[0031] II. Methods

[0032] 1. HR and NHEJ experiments

[0033] DR-GFP / EJ5-GFP reporter system was used to detect the efficiency of HR and NHEJ repair. HEK293T cells stably expressing shRNA were plated at 3x10 5Cells were seeded at a density of 1 x 105cells per well in a six-well plate. After 24 hours, cells were transfected with 500 ng of DR-GFP or 500 ng of EJ5-GFP plasmid, 150 ng of mCherry and 500 ng of I-Scel, and 1.0 μΐ, of Lipofectamine 2000 per well. After 48 hours, cells were collected and analyzed by flow cytometric fluorescence-activated cell sorting (FACS). At least 30,000 cells were counted and the experiment was repeated three times.

[0034] shTRMT10A#1 : TTGATCACTTGATGGTATTAA (SEQ ID No. 1).

[0035] shTRMT10A#2: GAGGAGGAATATAGCAGAAAT (SEQ ID No. 2).

[0036] 2. Immunofluorescence quantification.

[0037] U2OS cells were seeded in 24-well plates 24 hours before IR treatment (1 Gy). For staining, cells were washed twice with PBS and fixed with 4% PFA for 10 minutes at room temperature in 0.5% Triton-X-100 solution. Then, cells were blocked with 5% goat serum for 1 hour and incubated with specific antibodies overnight at 4°C. After three washes with TBST, cells were incubated with secondary antibodies for 1 hour at room temperature. After three washes with TBST, cells were incubated with DAPI for 1 minute. After washing with PBS, cells were observed under a microscope. IRIF was quantified by Image-J software. To standardize the counts and densities, 10 fields were randomly selected for each cell line, and each group contained more than 100 cells.

[0038] 3. Co-immunoprecipitation (Co-IP).

[0039] For co-immunoprecipitation experiments, HEK293T cells were transiently transfected with FLAG-tagged TRMT10A or HA-tagged BRCA1 plasmids. Transfected cells were lysed with NETN buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl, and 0.5% Nonidet P-40) containing 50 mM β-glycerophosphate, 10 mM NaF, and aprotinin. After incubation on ice for 20 minutes, whole-cell lysates were centrifuged at 12,000 g for 30 minutes, and the soluble fraction was incubated with HA / FLAG for 2-4 hours at 4°C. Then, the lysates were washed at least six times with NETN buffer, boiled in 1x SDS buffer for 5 minutes, and subjected to Western Blot analysis.

[0040] 4. Western Blot.

[0041] Cells were collected and lysed in pre-chilled NP-40 lysis buffer (50 mM tris, 150 mM NaCl and 1.0% NP-40, pH 8.0). Protein concentration was determined by BCA protein quantification kit. Protein samples were electrophoresed in 6.0%~12.0% SDS-PAGE gels and then transferred to PVDF membranes. Then, the membranes were blocked with 5% milk and incubated with the indicated antibodies overnight at 4°C. After incubation with secondary antibodies for 1 hour at room temperature, protein bands were detected by chemiluminescence.

[0042] 5. Cell colony formation assay.

[0043] Cells were seeded in six-well plates at a density of 1000-2000 cells / well in triplicate. For drug sensitivity detection, cells were exposed to the indicated concentrations of olaparib / spautin-1. After 10~14 days, the clonal cells were fixed and stained with crystal violet. Cells were counted and analyzed.

[0044] 6. Irradiation.

[0045] Cells were irradiated with 1 Gy and 2 Gy for immunofluorescence detection, and 10 Gy for Western Blot and co-immunoprecipitation detection, respectively. Usually, cells were collected 1 hour after irradiation for subsequent related experiments.

[0046] 7. CDX tumor model.

[0047] Animal experiments were approved by the Animal Experimental Ethics Committee of Cancer Hospital, Chinese Academy of Medical Sciences. DU145, shCtrl and shTRMT10A were injected subcutaneously into the abdomen of 4-week-old BALB / c nude male mice. 22Rv1 cells were injected subcutaneously into the abdomen of 4-week-old BALB / c nude male mice. The above-mentioned CDX tumor model mice were given control or olaparib (50 mg / kg) or spautin-1 (8 mg / kg) or combination therapy, 5 days a week. Mice were monitored for tumor growth and overall health. After the end of treatment, mice were euthanized and tumor weight was measured.

[0048] 8. Patient-derived xenografts (PDXs).

[0049] The collection of prostate cancer specimens was approved by the Institutional Review Board of the People's Hospital of Nanchang University (NO. 2021012). A total of four patient tumor samples (#546, #1092, #1102, #1267) were collected. Freshly resected tumor tissues (2x2x2 mm 3Subcutaneously injected into 5-week-old male NOD SCID mice. The mice were monitored for tumor growth every three days, and when the tumor diameter reached 2 cm, the tumor was aseptically collected and re-implanted into new mice. The original tumor mice were referred to as “0 generation” (P0). The #546, #1092 PDX models were used in the P3 generation. When the tumor reached 150 mm 3 When the tumor reached 150 mm 2 .

[0050] 9. Bioinformatics analysis.

[0051] TRMT10A gene expression in prostate cancer and the corresponding clinical information were from The Cancer Genome Atlas (TCGA) project (https: / / portal.gdc.cancer.gov). Differentially expressed TRMT10A counts in prostate and prostate cancer tissues were from GEO database with accession numbers GSE6099 and GSE28680, respectively. In addition, CRISPR-Cas9 gene knockout screening PARPi response gene dataset was also obtained from GSE189186. Differential expression analysis was performed using unpaired Student’s t-test. Olaparib drug sensitivity AUC and TRMT10A mRNA expression in a series of cell lines were downloaded from DepMap database (https: / / depmap.org / portal / ).

[0052] 10. Graph generation and statistical analysis.

[0053] Cell survival and detection data were expressed as the mean ± S.E.M of triplicate experiments, and CDXs and PDXs xenograft research data were expressed as the mean ± S.E.M of 5 mice. These statistical analyses were performed using GraphPad Prism version 9.4. Differences between two groups were analyzed using unpaired Student’s t-test. Kaplan-Meier curves of OS were plotted according to TRMT10A IHC staining scores, and analyzed using the Log-rank test.

[0054] II. Experimental results.

[0055] 1. TRMT10A is significantly up-regulated in de-prostate cancer patients and is associated with response to poly (ADP-ribose) polymerase inhibitors (PARPi).

[0056] This study was approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University (approval number: K202311-45) and informed consent was obtained from all patients. A total of 54 cases of prostate cancer and 30 cases of corresponding non-cancerous tissues adjacent to cancer were paraffin-embedded specimens from metastatic prostate cancer patients. Immunohistochemistry (including IHC): incubation with antibodies (TRMT10A 1:200 dilution; USP10 1:200 dilution; Ki67 1:1000 dilution; cleaved Caspase-3 1:2000 dilution; γ-H2AX 1:2000 dilution) by standard immunohistochemical-chemical procedure. IHC staining scores were calculated according to the percentage of positive cells and staining intensity, and the scores were evaluated by two independent experts under the same conditions. Staining intensity is defined as follows: negative = 0: no staining detected; weak = 1: slight staining, barely visible; intermediate = 2: moderate staining, clearly visible; strong = 3: obvious strong staining. The proportion of positive cells is defined as follows: <5% = 0; 5-25% = 1; 26-50% = 2; 51-75% = 3; 76-100% = 4. Final score = staining area score x staining intensity score.

[0057] As shown in Figure 1 , by analyzing the TCGA database, it was found that the expression of TRMT10A in the tumor of prostate cancer patients was higher than that in normal tissues ( Figure 1 A). Similar results were also observed in paired samples ( Figure 2 A). In addition, we compared the TRMT10A levels of patients with different pathological tumor stages, and found that the expression of TRMT10A increased with the increase of the severity of tumor stage in prostate cancer patients ( Figure 1 B). We also studied the TRMT10A RNA profile in the GEO database. As shown in Figure 1 C, in the data set GSE6099, the TRMT10A level of metastatic prostate cancer patients was significantly increased. Importantly, we found from the GEO database that the expression of TRMT10A in castration-resistant PCa patients was significantly increased ( Figure 1 D). The above experiments showed that TRMT10A was highly expressed in advanced prostate cancer.

[0058] We detected the TRMT10A protein level of 54 patients by immunohistochemical method (IHC). TRMT10A was mainly in the nucleus, and the expression in malignant tissues was higher than that in non-malignant tissues ( Figure 1 C~F, Figure 2 B). In addition, patients with Gleason score of 8-10 had stronger TRMT10A staining than patients with Gleason score of 6-7 ( Figure 2C). Patients with elevated TRMT10A levels had significantly shorter overall survival (OS) (P=0.0017) Figure 1 G, P=0.014). In addition, genomic alteration analysis showed that TRMT10A was mutated in mCRPC patients with mutation rates ranging from 1.22% to 5.26% in multiple cohorts (P=0.0002) Figure 2 D-E). Taken together, these data suggest that TRMT10A expression is associated with more aggressive clinical features and worse prognostic outcomes in prostate cancer patients.

[0059] We found that TRMT10A was positively correlated with HRR genes such as BRCA1, BRCA2, RAD51, PALB2, etc. in tumor tissues (P=0.0002) Figure 1 H). In addition, we noticed that in the DepMap database, the level of TRMT10A was negatively correlated with olaparib drug sensitivity AUC (r=-0.471, P=0.042) Figure 1 I). In addition, whole genome CRISPR-Cas9 knockout of exon 32 showed that the level of TRMT10A gene was significantly reduced after olaparib intervention, which was consistent with the trend of BRCA1 and BRCA2 in GSE189186 (P=0.0002) Figure 1 J). Taken together, these data preliminarily suggest that TRMT10A expression may be related to PARPi response.

[0060] 2. Knocking down TRMT10A affects the recruitment of BRCA1 and HR repair.

[0061] Given that TRMT10A leads to susceptibility to PARPis, we hypothesized that TRMT10A might regulate PARPis sensitivity by affecting DNA repair processes. To assess this hypothesis, we first assessed the dynamic clearance of γ-H2AX after irradiation (IR) in cells. γ-H2AX in control cells almost disappeared 8 hours after IR, while γ-H2AX in TRMT10A knockout cells still persisted 8 hours after IR (P=0.0002) Figure 3 A-B). Notably, the amount of γ-H2AX after IR was not affected by TRMT10A knockout (P=0.0002) Figure 3 A-B). These results suggest that TRMT10A knockout impairs DSB repair. In addition, we established stable TRMT10A knockout cell lines and used the DR-GFP / EJ5-GFP reporter system to assess DSB repair (P=0.0002) Figure 3 C). Knocking out TRMT10A significantly inhibited HR repair, but not NHEJ (P=0.0002) Figure 3 D). In addition, knocking out TRMT10A enhanced their response to PARPi (P=0.0002) Figure 3 E-F). In summary, the above experiments suggest that TRMT10A regulates HR repair.

[0062] The HR repair process involves the recruitment of several important factors at DNA damage sites, including MDC1, RNF8, RNF168, BRCA1, and RAD51. Figure 3 G). We investigated whether TRMT10A knockout in U2OS cells affects the recruitment of key HR proteins at DNA damage sites. No significant changes were observed in the formation of γ-H2AX and 53BP1 in either control or knockout cells. Figure 3 HK). Notably, in TRMT10A knockout cells, the formation of BRCA1 and RAD51 was significantly reduced ( Figure 3 LO). The above experiments show that TRMT10A regulates HR at the BRCA1 level ( Figure 3 P).

[0063] 3. TRMT10A affects the sensitivity of prostate cancer to PARP inhibitors.

[0064] To verify the relationship between TRMT10A and PARPi response, we examined TRMT10A levels and PARPi sensitivity in different prostate cancer cell lines. We observed that PC-3 and DU145 cells, with lower TRMT10A expression compared to 22Rv1, were more sensitive to olaparib. Figure 4 AB). Furthermore, knockout of TRMT10A in the 22Rv1, DU145, and C4-2 cell lines enhanced cellular responsiveness to PARPi olaparib treatment. Figure 4 CH). Conversely, overexpression of TRMT10A in PC-3 cells reduces cellular sensitivity to PAPRi olaparib. Figure 4 IJ). To further demonstrate this in vivo, we subcutaneously injected DU145 cells expressing shCtrl or shTRMT10A into BALB / c nude mice to generate xenograft tumors (IJ). Figure 4 K). After treatment with olaparib, tumor growth was significantly delayed in the TRMT10A-deficient group compared to the control group. Figure 4 LN). Immunohistochemical analysis showed that the Ki-67 level in the TRMT10A gene knockout group was significantly lower than that in the control group, while the levels of Caspase-3 and γ-H2AX were higher than those in the control group. Figure 5 AD indicates enhanced antitumor activity. Notably, there was no significant change in body weight among the groups ( Figure 5 E). These data indicate that, both in vitro and in vivo, a lack of TRMT10A sensitizes prostate cancer cells to olaparib.

[0065] 4. USP10 inhibitor Spautin-1 causes TRMT10A degradation and HR repair.

[0066] Given that TRMT10A is regulated by USP10, we further detected whether USP10 inhibitor (Spautin-1) would cause TRMT10A degradation. To this end, we treated 22Rv1 and C4-2 cells with different concentrations of Spautin-1 for 48 hours. We observed a significant decrease in TRMT10A protein levels, indicating that TRMT10A was inhibited by Spautin-1 Figure 7 A, Figure 6 A). We then evaluated the effect of USP10 inhibition on DNA repair processes. Under Spautin-1 treatment, HR repair efficiency was significantly reduced Figure 7 B). In addition, the formation of BRCA1 and RAD51 was significantly reduced in cells treated with Spautin-1, while γ-H2AX was not affected Figure 7 C-H, Figure 6 B-G). These results collectively indicate that Spautin-1 can pharmacologically promote TRMT10A degradation and inhibit HR repair. Since Spautin-1 inhibits HR repair, we hypothesized that Spautin-1 treatment might increase the sensitivity of cells to PARPi. To verify this, we treated 22Rv1 and C4-2 cells with different concentrations of olaparib and Spautin-1 and detected the colony formation efficiency. As shown in Figure 7 I-J and Figure 6 H-I, the colony formation rate in the combined treatment group was significantly reduced compared with the control group. The above experiments confirmed the synergistic effect of olaparib and Spautin-1 in improving cancer treatment.

[0067] To further demonstrate the synergistic effect of olaparib and Spautin-1 in vivo, we subcutaneously injected 22Rv1 cells into BALB / c nude mice to produce xenograft tumors Figure 7 K). By treating mice with vector, olaparib, Spautin-1 and combined therapy, we confirmed that the tumor growth in the combined therapy group was greatly delayed compared with the olaparib monotherapy group Figure 7 L-N). As shown in Figure 7 J-M, the level of Ki67 was significantly decreased in the combined treatment group, but the expression of Caspase-3 and γ-H2AX was increased.

[0068] 5. Patient-derived tumor xenografts (PDXs) are crucial preclinical models for evaluating drug response and efficacy. Therefore, we evaluated the synergistic effect of olaparib and spautin-1 on PDX models with elevated TRMT10A expression derived from four patients with metastatic castration-resistant prostate cancer (mCRPC). Figure 8 A). Specifically, we selected PDX models #546 and #1092, which have high levels of TRMT10A and USP10 expression, for further investigation. Figure 8 B). In the PDX#546 model, the combination of olaparib and Spautin-1 significantly inhibited tumor growth and reduced tumor weight compared to olaparib alone. Figure 8 CE). Immunohistochemical analysis showed that the Ki-67 level in the combination therapy group was significantly lower than that in the olaparib monotherapy group, while the levels of cleaved Caspase-3 and γ-H2AX were higher in the combination therapy group than in the olaparib monotherapy group. Figure 9 AD). Western blot analysis of tumor tissue also showed elevated levels of cleaved Caspase-3, cleaved PARP, and γ-H2AX in the combination therapy group. Figure 9 E). These results indicate that the combination therapy enhanced antitumor activity. Notably, there was no significant change in body weight between the groups, suggesting good tolerability of the combination therapy. Figure 9 F). These effects were replicated in the PDX#1092 model, where the combination therapy reduced tumor volume by 42.9% compared to olaparib alone. Figure 8 FH). Further immunohistochemical and Western blot assessments showed similar enhancing effects on apoptosis and DNA damage markers. Figure 9 GK), with no significant weight difference between groups ( Figure 9 In summary, the combination of olaparib and spautin-1 significantly enhanced the anti-tumor effect, validating the potential of this combination therapy.

[0069] In summary, this invention discloses for the first time that TRMT10A expression is upregulated in mCRPC, and that targeting USP10 with Spautin-1 can inhibit TRMT10A expression, inducing homologous recombination defect (HRD). The combined use of PARPi and Spautin-1 effectively delays tumor growth in patient-derived xenograft (PDX) and cell-derived xenograft (CDX) models.

[0070] The above merely illustrates the preferred embodiments of the present application, and is not used to limit the patent scope of the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. The use of a pharmaceutical composition of Spautin-1 and olaparib in the preparation of a medicament for the treatment of castration-resistant prostate cancer.

2. The use of a combination of a TRMT10A inhibitor and a PARP inhibitor in the preparation of a medicament for treating castration-resistant prostate cancer, characterized in that, The TRMT10A inhibitor is shRNA; the shRNA nucleotide sequence is shown in SEQ ID No. 1~2; the PARP inhibitor is olaparib.

3. An olaparib sensitizer, characterized in that, The invention comprises an inhibitor of TRMT10A and ubiquitin-specific peptidase 10; the inhibitor of TRMT10A is shRNA; the nucleotide sequence of the shRNA is shown in SEQ ID No. 1~2; the inhibitor of ubiquitin-specific peptidase 10 is Spautin-1.

4. The use of the sensitizer according to claim 3 in the preparation of a medicament for treating castration-resistant prostate cancer.

5. Application of TRMT10A expression level detection reagent in the preparation of products for auxiliary diagnosis of castration-resistant prostate cancer.

Images