Compositions and methods for treating and preventing amyotrophic lateral sclerosis

Abstract

Dosing regimens of SOD1 targeting antisense oligonucleotides and salts thereof are provided. These dosing regimens are useful for treating a subject suffering from or at risk of developing amyotrophic lateral sclerosis.

Description

[0001] This application is a divisional application based on a patent application with an application date of December 12, 2019, a priority date of December 14, 2018, an application number of 201980080996.2, and an invention name of "Compositions and methods for treating and preventing amyotrophic lateral sclerosis".

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of priority to U.S. Provisional Application No. 62 / 779,916 filed on December 14, 2018, U.S. Provisional Application No. 62 / 807,603 filed on February 19, 2019, and U.S. Provisional Application No. 62 / 840,879 filed on April 30, 2019, the contents of all of which are incorporated herein by reference in their entirety. Technical Field

[0004] The present application generally relates to a dosage regimen for clinical use of antisense oligonucleotides or salts thereof that reduce the expression of superoxide dismutase 1 (SOD1) in human subjects in need, such as adults with amyotrophic lateral sclerosis (ALS) with confirmed human SOD1 gene mutations. Such methods are suitable for treating, preventing or improving ALS by inhibiting the expression of SOD1. Background Art

[0005] Soluble SOD1 enzyme (also known as Cu / Zn superoxide dismutase) is one of the superoxide dismutases, which protects against oxidative damage to biomolecules by catalyzing the dismutation of superoxide to hydrogen peroxide (H2O2) (Fridovich, Annu. Rev. Biochem., 64:97-112 (1995)). Superoxide anion (O 2- ) is a potentially harmful cellular byproduct produced primarily by errors in oxidative phosphorylation in mitochondria (Turrens, J. Physiol., 552:335-344 (2003)).

[0006] Amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) is a devastating progressive neurodegenerative disease that affects up to 30,000 Americans at any given time. Mutations in the SOD1 gene are associated with a dominantly inherited form of ALS, a disease characterized by selective degeneration of upper and lower motor neurons (Rowland, N. Engl. J. Med., 2001, 344: 1688-1700 (2001)). There is a close genetic linkage between familial ALS and missense mutations in the SOD1 gene (Rosen, Nature, 362: 59-62 (1993)).

[0007] It is believed that the toxicity of mutant SOD1 results from an initial misfolding (gain of function) that reduces nuclear protection against active enzymes (loss of function in the nucleus), a process that may be involved in the pathogenesis of ALS (Sau, Hum. Mol. Genet., 16: 1604-1618 (2007)). The progressive degeneration of motor neurons in ALS eventually leads to motor neuron death. When motor neurons die, the brain loses the ability to initiate and control muscle movement. With voluntary muscle movements progressively affected, patients in the more advanced stages of the disease may become completely paralyzed.

[0008] There is currently a lack of acceptable options for treating such neurodegenerative diseases. Therefore, it is an object of this invention to provide methods for treating such diseases. Summary of the invention

[0009] The present disclosure relates, in part, to dosing regimens for antisense oligonucleotides that reduce expression of superoxide dismutase 1 (SOD1) and the use of such antisense oligonucleotides or salts thereof to inhibit expression of SOD1 and treat, prevent or ameliorate ALS in human subjects having mutations in the SOD1 gene.

[0010] In a first aspect, the present disclosure relates to a method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the human superoxide dismutase 1 (SOD1) gene in a human subject in need thereof. The method involves administering (e.g., by intrathecal administration) a pharmaceutical composition to a human subject in an amount sufficient to deliver about 100 mg or 100 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0011] In a second aspect, the present disclosure relates to a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in a human SOD1 gene in a human subject in need thereof. The method involves administering (e.g., intrathecally) a pharmaceutical composition to a human subject in an amount sufficient to deliver about 60 mg or 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0012] In a third aspect, the present disclosure relates to a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in a human SOD1 gene in a human subject in need thereof. The method involves administering (e.g., intrathecally) a pharmaceutical composition to a human subject in an amount sufficient to deliver about 40 mg or 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0013] In a fourth aspect, the present disclosure relates to a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in a human SOD1 gene in a human subject in need thereof. The method involves administering (e.g., intrathecally) a pharmaceutical composition to a human subject in an amount sufficient to deliver about 20 mg or 20 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0014] In a fifth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition to a human subject by intrathecal administration in an amount sufficient to deliver about 100 mg or 100 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0015] In a sixth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition to a human subject by intrathecal administration in an amount sufficient to deliver about 60 mg or 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0016] In a seventh aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition to a human subject by intrathecal administration in an amount sufficient to deliver about 40 mg or 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0017] In an eighth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition to a human subject by intrathecal administration in an amount sufficient to deliver about 20 mg or 20 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide is CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0018] In some embodiments of the above aspects, the mutation in the SOD1 gene is A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S591, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, or G147R. In one embodiment, the mutation in the SOD1 gene is A4V. In another embodiment, the mutation in the SOD1 gene is H46R. In yet another embodiment, the mutation in the SOD1 gene is G93S.

[0019] In some embodiments, mutations in the human SOD1 gene are identified by genetic testing.

[0020] In certain embodiments, the above methods further involve identifying mutations in the human SOD1 gene by genetic testing.

[0021] In some embodiments, the pharmaceutical composition is administered to a human subject at least five times (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 times) over the course of four months.

[0022] In certain embodiments, one or more loading doses of the pharmaceutical composition are administered to a human subject, followed by one or more maintenance doses. In some cases, three loading doses are administered, wherein the second loading dose is administered about two weeks after the first loading dose or two weeks thereafter, and the third loading dose is administered about two weeks after the second loading dose or two weeks thereafter (e.g., loading doses are administered on the 1st day, the 15th day, and the 29th day). In some cases, maintenance doses are administered about every 4 weeks or 4 weeks starting 4 weeks after the third loading dose (e.g., for 1 month, 2 months, three months, four months, five months, six months, seven months, eight months, nine months, ten months).

[0023] In certain embodiments, three loading doses of the pharmaceutical composition are administered to a human subject, followed by at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) maintenance dose. In some cases, three loading doses are administered about two weeks apart or two weeks apart. In some cases, three loading doses are administered about 14 days apart or 14 days apart. In some cases, one or more maintenance doses are administered starting about 4 weeks or 4 weeks after the third loading dose. In some cases, one or more maintenance doses are administered monthly starting one month after the third loading dose. In some cases, one or more maintenance doses are administered every 28 days starting 28 days after the third loading dose.

[0024] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0025] (i) a first loading dose of a pharmaceutical composition;

[0026] (ii) a second loading dose of the pharmaceutical composition administered 14 days after the first loading dose;

[0027] (iii) a third loading dose of the pharmaceutical composition administered 28 days after the first loading dose; and

[0028] (iv) a first maintenance dose of the pharmaceutical composition administered 28 days or 1 month after the third loading dose.

[0029] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0030] (i) a first loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide;

[0031] (ii) a second loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the second loading dose is administered 14 days after the first loading dose;

[0032] (iii) a third loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the third loading dose is administered 28 days after the first loading dose; and

[0033] (iv) a first maintenance dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the first maintenance dose is administered 28 days after the third loading dose.

[0034] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0035] (i) a first loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide;

[0036] (ii) a second loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the second loading dose is administered 14 days after the first loading dose;

[0037] (iii) a third loading dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the third loading dose is administered 28 days after the first loading dose; and

[0038] (iv) a first maintenance dose in an amount sufficient to deliver a 100 mg fixed dose of the antisense oligonucleotide, wherein the first maintenance dose is administered 1 month after the third loading dose.

[0039] In a ninth aspect, the present disclosure provides a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in the SOD1 gene in a human subject in need thereof. The method involves administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0040]

[0041] And wherein the antisense oligonucleotide or its salt is administered with a dosage equivalent to 100 mg of antisense oligonucleotide. 105.9 mg of Compound A (i.e., the nineteen sodium salt of ISIS 666853) is equivalent to 100 mg of antisense oligonucleotide. The pharmaceutical composition administered may comprise antisense oligonucleotide, one or more salts of antisense oligonucleotide, or a mixture thereof.

[0042] In a tenth aspect, the present disclosure provides a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in the SOD1 gene in a human subject in need thereof. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to the human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0043]

[0044] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 60 mg of antisense oligonucleotide. 63.5 mg of Compound A is equivalent to 60 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0045] In an eleventh aspect, the present disclosure provides a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in the SOD1 gene in a human subject in need thereof. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to the human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0046]

[0047] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 40 mg of antisense oligonucleotide. 42.3 mg of Compound A is equivalent to 40 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0048] In a twelfth aspect, the present disclosure provides a method for treating or preventing amyotrophic lateral sclerosis associated with a mutation in the SOD1 gene in a human subject in need thereof. The method involves administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0049]

[0050] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 20 mg of antisense oligonucleotide. 21.2 mg of Compound A is equivalent to 20 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0051] In a thirteenth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to the human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0052]

[0053] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 100 mg of the antisense oligonucleotide. 105.9 mg of Compound A is equivalent to 100 mg of the antisense oligonucleotide. The administered pharmaceutical composition may comprise the antisense oligonucleotide, one or more salts of the antisense oligonucleotide, or a mixture thereof.

[0054] In a fourteenth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to the human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0055]

[0056] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 60 mg of antisense oligonucleotide. 63.5 mg of Compound A is equivalent to 60 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0057] In a fifteenth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to a human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0058]

[0059] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 40 mg of antisense oligonucleotide. 42.3 mg of Compound A is equivalent to 40 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0060] In a sixteenth aspect, the present disclosure provides a method of reducing human SOD1 protein synthesis or human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof to the human subject by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0061]

[0062] And wherein the antisense oligonucleotide or its salt is administered at a dose equivalent to 20 mg of antisense oligonucleotide. 21.2 mg of Compound A is equivalent to 20 mg of antisense oligonucleotide. The administered pharmaceutical composition may comprise an antisense oligonucleotide, one or more salts of an antisense oligonucleotide, or a mixture thereof.

[0063] In some embodiments, a salt of an antisense oligonucleotide is administered to a human subject. In some embodiments, the salt is a sodium salt. In some embodiments, the salt of an antisense oligonucleotide has the following structure:

[0064]

[0065] In some embodiments of the above aspects, the mutation in the SOD1 gene is A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S591, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, or G147R. In one embodiment, the mutation in the SOD1 gene is A4V. In another embodiment, the mutation in the SOD1 gene is H46R. In yet another embodiment, the mutation in the SOD1 gene is G93S.

[0066] In some embodiments, mutations in the human SOD1 gene are identified by genetic testing.

[0067] In certain embodiments, the above methods further involve identifying mutations in the human SOD1 gene by genetic testing.

[0068] In some embodiments, the pharmaceutical composition is administered to the human subject at least five times over the course of four months.

[0069] In certain embodiments, one or more loading doses of the pharmaceutical composition are administered to a human subject, followed by one or more maintenance doses. In some cases, three loading doses are administered, with loading doses spaced two weeks apart, e.g., day 1, day 15, and day 29. In some cases, maintenance doses are administered every 4 weeks starting 4 weeks after the third loading dose (e.g., for 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months).

[0070] In certain embodiments, three loading doses of the pharmaceutical composition are administered to a human subject, followed by at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) maintenance dose. In some cases, three loading doses are administered two weeks apart. In some cases, three loading doses are administered 14 days apart. In some cases, one or more maintenance doses are administered every 4 weeks starting 4 weeks after the third loading dose. In some cases, one or more maintenance doses are administered every month starting one month after the third loading dose. In some cases, one or more maintenance doses are administered every 28 days starting 28 days after the third loading dose.

[0071] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0072] (i) a first loading dose of a pharmaceutical composition;

[0073] (ii) a second loading dose of the pharmaceutical composition administered 14 days after the first loading dose;

[0074] (iii) a third loading dose of the pharmaceutical composition administered 28 days after the first loading dose; and

[0075] (iv) a first maintenance dose of the pharmaceutical composition administered 28 days or 1 month after the third loading dose.

[0076] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0077] (i) a first loading dose equivalent to 100 mg of antisense oligonucleotide;

[0078] (ii) a second loading dose equivalent to 100 mg of the antisense oligonucleotide, wherein the second loading dose is administered 14 days after the first loading dose;

[0079] (iii) a third loading dose equivalent to 100 mg of the antisense oligonucleotide, wherein the third loading dose is administered 28 days after the first loading dose; and

[0080] (iv) a first maintenance dose equivalent to 100 mg of the antisense oligonucleotide, wherein the first maintenance dose is administered 28 days after the third loading dose.

[0081] In certain embodiments, a loading dose and a maintenance dose of a pharmaceutical composition are administered to a human subject as follows:

[0082] (i) a first loading dose equivalent to 100 mg of antisense oligonucleotide;

[0083] (ii) a second loading dose equivalent to 100 mg of the antisense oligonucleotide, wherein the second loading dose is administered 14 days after the first loading dose;

[0084] (iii) a third loading dose equivalent to 100 mg of the antisense oligonucleotide, wherein the third loading dose is administered 28 days after the first loading dose; and

[0085] (iv) a first maintenance dose equivalent to 100 mg of the antisense oligonucleotide, wherein the first maintenance dose is administered 1 month after the third loading dose.

[0086] In another aspect, the present disclosure relates to a syringe or pump comprising a sterile formulation of an antisense oligonucleotide. The syringe or pump is suitable for intrathecal administration of the antisense oligonucleotide at a fixed dose of 20 mg, 40 mg, 60 mg or 100 mg. The nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO: 1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is 5-methylcytosine.

[0087] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar to or equivalent to those described herein can be used for implementation or testing of the present invention, exemplary methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present application, including definitions, shall prevail. Materials, methods and examples are merely illustrative and are not intended to be restrictive.

[0088] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 is a graphical depiction of the average disease duration (years from symptom onset) in patients with different human SOD1 mutations.

[0090] Figure 2Depicted are the dose-dependent increases in cerebrospinal fluid (CSF) concentrations of Compound A observed in the multiple ascending dose (MAD) cohort. The top line represents the 100 mg dose; the bottom two lines represent the 60 mg and 40 mg doses; and the bottom line represents the 20 mg dose.

[0091] Figure 3 Depicted is the dose-dependent decrease in CSF SOD1 concentrations observed in the MAD group. On study day 85, the top circle corresponds to 20 mg; the next circle corresponds to placebo; the next circle corresponds to 60 mg; the next circle corresponds to 40 mg; and the bottom circle corresponds to 100 mg Compound A.

[0092] Figure 4A is a graph of the LS mean change from baseline in the Amyotrophic Lateral Sclerosis Functional Rating Scale-Revised (ALFSFRS-R) in patients in the MAD cohort. On study day 85, the top circle corresponds to 40 mg Compound A; the next circle corresponds to 100 mg Compound A; the next circle corresponds to 60 mg Compound A; the next circle corresponds to 20 mg Compound A; and the bottom circle corresponds to placebo.

[0093] Figure 4B is a graph of the LS mean change (90% CI) from baseline in percent predicted slow vital capacity (SVC) in patients in the MAD group. On study day 85, the top circle corresponds to 60 mg Compound A; the next circle corresponds to 40 mg Compound A; the next circle corresponds to 100 mg Compound A; the next circle corresponds to 20 mg Compound A; and the bottom circle corresponds to placebo.

[0094] Figure 4C is a graph of the LS mean change (90% CI) from baseline in the total million points on the handheld dynamometer (HHD) in patients in the MAD group. On study day 92, the top circle corresponds to 40 mg Compound A; the next circle corresponds to 100 mg Compound A; the next circle corresponds to 60 mg Compound A; the next circle corresponds to 20 mg Compound A; and the bottom circle corresponds to placebo.

[0095] Figure 5 Graphed are the changes in ALSFRS-R, SVC, HHD million scores, and CSF SOD1 levels from baseline to Day 85 in patients with rapidly progressing mutations who received placebo or 100 mg of Compound A.

[0096] Figure 6Graphed are the changes in ALSFRS-R, SVC, HHD million scores, and CSF SOD1 levels from baseline to Day 85 in patients with slowly progressive mutations who received placebo or 100 mg of Compound A.

[0097] Figure 7 Depicted is the effect of 100 mg Compound A treatment on pNFH levels from baseline to Day 85 in patients with rapidly progressing SOD1 mutations.

[0098] Figure 8 Depicted are the effects of 100 mg Compound A treatment on pNFH levels from baseline to Day 85 in patients with slowly progressive SOD1 mutations. DETAILED DESCRIPTION

[0099] The present disclosure relates to a dosing regimen of an antisense oligonucleotide or a salt thereof that reduces the expression of superoxide dismutase 1 (SOD1) and the use of such antisense oligonucleotide or a salt thereof for treating, preventing or ameliorating amyotrophic lateral sclerosis (ALS) in adults with a human SOD1 gene mutation.

[0100] definition

[0101] "2'-O-methoxyethyl" (also 2'-MOE and 2'-OCH2CH2-OCH3 and MOE) refers to an O-methoxy-ethyl modification of the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0102] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety.

[0103] "5-methylcytosine" means cytosine modified with a methyl group attached to the 5' position. 5-Methylcytosine is a modified nucleobase.

[0104] "Phosphorothioate linkage" means a linkage between nucleosides in which the phosphodiester linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0105] "About" in the context of an amount of a substance means + / - 10% of the indicated value. Thus, about 100 mg of antisense oligonucleotide includes 90 mg to 110 mg of antisense oligonucleotide. In the context of a time unit, such as about 10 days or about 1 week, "about" means + / - 3 days.

[0106] "Intrathecal or IT" means administration into the cerebrospinal fluid beneath the arachnoid membrane covering the brain and spinal cord.

[0107] "Loading dose" means the dose administered at the start of administration and during the dosing period to achieve a steady-state concentration of the drug (eg, antisense oligonucleotide).

[0108] "Maintenance dose" means the dose administered during the dosing period after a steady-state concentration of drug (eg, antisense oligonucleotide) has been achieved.

[0109] A "fixed dose" refers to a predetermined amount of an antisense oligonucleotide (eg, 20 mg, 40 mg, 60 mg, 100 mg) intended to achieve a desired therapeutic concentration (eg, steady-state concentration) or effect in a subject.

[0110] Amyotrophic lateral sclerosis

[0111] Amyotrophic lateral sclerosis (ALS) is a rare neurodegenerative disease caused by the loss of motor neurons in the cortex, brainstem and spinal cord. Patients suffer from progressive loss of muscle mass, strength and function of bulbar, respiratory and voluntary muscles. Decline is inevitable, and death usually due to respiratory failure occurs on average 2 to 5 years after diagnosis. Although most patients suffer from sporadic ALS, a smaller proportion of patients (about 2%) suffer from hereditary or familial forms of ALS caused by multiple mutations in superoxide dismutase 1 (SOD1). Since it was first discovered in 1993, more than 180 SOD1 mutations have been reported to cause this form of ALS (called SOD1 ALS). Amyotrophic lateral sclerosis online gene database (ALSoD). Institute of Psychiatry, Psychology & Neuroscience. Published in 2015; Rosen, Nature, 364 (6435): 362 (1993). Disease progression is variable for individual mutations, with survival less than 15 months in the most severe mutations. Although the mechanism by which mutations cause SOD1 ALS is unknown, compelling data suggest that toxic gain of function rather than loss of SOD1 activity is responsible for initiating the cascade of events that leads to motor neuron death (Bruijn et al., Science, 281(5384):1851-4 (1998)).

[0112] The approved treatment for ALS is riluzole and edaravone (Radicava TM ). Riluzole provided a modest increase in survival (2 to 3 months) without demonstrating improvement in strength or disability. Edaravone mitigated functional decline as measured by the Amyotrophic Lateral Sclerosis Functional Rating Scale-Revised (ALSFRS-R). The effect of edaravone on survival is unknown. There is no available SOD1-specific ALS treatment.

[0113] Superoxide dismutase 1

[0114] Superoxide dismutase [Cu-Zn], also known as superoxide dismutase 1 (SOD1), is an enzyme encoded by the SOD1 gene located on chromosome 21 in humans.

[0115] SOD1 is a 32 kDa homodimer that forms a β-barrel and contains an intramolecular disulfide bond and a binuclear Cu / Zn site in each subunit. This Cu / Zn site retains copper and zinc ions and is responsible for catalyzing the dismutation of superoxide to hydrogen peroxide and dioxygen.

[0116] SOD1 is one of three superoxide dismutases responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic and mitochondrial intermembrane space protein that acts as a homodimer to convert naturally occurring but harmful superoxide radicals into molecular oxygen and hydrogen peroxide. Hydrogen peroxide can then be broken down by another enzyme called catalase.

[0117] At least 180 mutations in the SOD1 gene are associated with familial ALS (Conwit RA, J Neurol Sci., .251(1-2):1-2(2006); Al-Chalabi A, Leigh PN, Curr. Opin. in Neurol., 13(4):397-405(2000); Redler RL, Dokholyan NV, Progress in Molecular Biology and Translational Science, 107:215-62(2012)). However, wild-type SOD1 has also been implicated in a large proportion of sporadic ALS cases representing 90% of ALS patients under conditions of cellular stress. The most frequent mutation in human SOD1 is A4V in the United States; H46R in Japan; and G93S in Iceland. Other well-known human SOD1 mutations include: A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S591, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, and G147R. There is significant heterogeneity in the duration of disease based on SOD1 mutations (see Figure 1). Almost all known ALS-causing SOD1 mutations act in a dominant manner; a single mutant copy of the SOD1 gene is sufficient to cause the disease.

[0118] The amino acid sequence of human SOD1 can be found as UniProt P00441 and GENBANK Accession No. NP_000445, and is provided below:

[0119]

[0120] The nucleotide sequence encoding human SOD1 is provided as GENBANK Accession No. NM_000454.4, and is also provided as follows (the region recognized by the antisense oligonucleotides of the present disclosure is underlined):

[0121]

[0122] ISIS 666853

[0123] ISIS 666853 is a 5-10-5MOE gapmer having the sequence (from 5' to 3') CAGGATACATTTCTACAG CT (SEQ ID NO: 1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is 5-methylcytosine. ISIS 666853 is described by the following chemical notation: mCes AeoGes Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; where,

[0124] A = adenine,

[0125] mC=5-methylcytosine,

[0126] G=guanine,

[0127] T = thymine,

[0128] e=2'-O-methoxyethyl ribose modified sugar,

[0129] d = 2'-deoxyribose,

[0130] s = phosphorothioate internucleoside linkage, and

[0131] o = phosphodiester internucleoside linkage.

[0132] The ISIS 666853 sequence can also be abbreviated as follows:

[0133] 5'- Me CA P＝O GG P＝O A TA Me CATTT Me CTA Me C P＝O AG P＝O Me C Me U -3'

[0134] Underlined residues are 2'-MOE nucleosides. The P=O annotation reflects the position of the phosphodiester bond.

[0135] ISIS 666853 is depicted by the following chemical structure:

[0136]

[0137] It will be appreciated that in solution, the antisense oligonucleotides may exist in free acid form, salt form, or a mixture thereof.

[0138] ISIS 666853, nonadecasodium salt ("Compound A")

[0139] Compound A is the undecanoate sodium salt of ISIS 666853, an antisense oligonucleotide inhibitor of SOD1 messenger ribonucleic acid (mRNA) that reduces SOD1 protein levels in subjects with SOD1 ALS. Reduction of SOD1 mRNA and subsequently reduction of toxic SOD1 protein may provide a therapeutic benefit to subjects with SOD1 ALS.

[0140] The structure of Compound A is provided below:

[0141]

[0142] The molecular formula of compound A is: C 230 H 298 N 72 Na 19 O 123 P 19 S 15, its molecular weight = 7545.59amu.

[0143] Compound A is complementary to a portion of the 3' untranslated region (3'UTR) of the mRNA of human SOD1 and is bound by Watson Crick base pairing. The hybridization (binding) of compound A with homologous mRNA causes RNase-H1-mediated degradation of the mRNA of SOD1, and thereby reduces the amount of SOD1 protein synthesis. RNase H is a widely expressed enzyme (nuclease) that recognizes deoxyribonucleic acid-ribonucleic acid (DNA-RNA) heteroduplexes and cleaves the RNA strand of the duplex. By binding to the 3'-UTR region of SOD1 mRNA, compound A selectively targets RNase H1 to SOD1 mRNA and promotes the cleavage of SOD1 mRNA, so that the expression of both wild-type and mutant variants of SOD1 is reduced.

[0144] Compound A significantly increased the median survival of SOD1 G93A transgenic mice (Mantel-Cox, p<0.01).Compound A also resulted in a dose-dependent protection of neuromuscular function as measured by compound muscle action potentials in SOD1 G93A transgenic mice.

[0145] Conjugated antisense oligonucleotides

[0146] Antisense oligonucleotides of the present disclosure can be covalently linked to one or more parts or conjugates that enhance the activity, cellular distribution or cellular uptake of the antisense oligonucleotides obtained. Typical conjugated groups include cholesterol moieties and lipid moieties. Other conjugated groups include carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin and dyes. Antisense oligonucleotides can also be modified to have one or more stabilizing groups, which are generally attached to one or both ends of the antisense oligonucleotide to enhance properties such as nuclease stability. Cap structures are included in the stabilizing groups. These end modifications protect antisense oligonucleotides with terminal nucleic acids from exonuclease degradation, and can help deliver and / or locate in cells. Caps can be present at 5' ends (5' caps) or 3' ends (3' caps), or can be present at both ends. Cap structures are well known in the art and include, for example, reverse deoxy abasic caps. Other 3' and 5' stabilizing groups that can be used to cap one or both ends of an antisense oligonucleotide to confer nuclease stability include those disclosed in WO 03 / 004602.

[0147] Compositions and methods for formulating pharmaceutical compositions

[0148] The antisense oligonucleotides or salts thereof disclosed herein can be mixed with pharmaceutically acceptable active or inert substances for preparing pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on many criteria, including but not limited to the route of administration, the extent of the disease or the dose to be administered.

[0149] Antisense oligonucleotides or salts thereof targeting SOD1 nucleic acids can be used in pharmaceutical compositions by combining the antisense oligonucleotides or salts thereof with suitable pharmaceutically acceptable diluents or carriers. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a diluent suitable for use in compositions delivered parenterally. Therefore, in one embodiment, a pharmaceutical composition comprising an antisense oligonucleotide or salt thereof targeting SOD1 nucleic acids and a pharmaceutically acceptable diluent is used in the methods described herein.

[0150] The antisense oligonucleotides described herein, or salts thereof, can be formulated as pharmaceutical compositions for intrathecal administration to a subject.

[0151] The pharmaceutical composition comprising the antisense oligonucleotide of the present disclosure encompasses any pharmaceutically acceptable salt, ester or salt of such ester, or any other oligonucleotide that can (directly or indirectly) provide a biologically active metabolite or its residue after administration to an animal including a human being. Therefore, for example, the present disclosure also relates to pharmaceutically acceptable salts and other bioequivalents of antisense oligonucleotides. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0152] Treatment

[0153] The present disclosure relates to methods of treating or preventing amyotrophic lateral sclerosis associated with mutations in the human SOD1 gene in a human subject in need thereof. The method involves administering a fixed dose of an antisense oligonucleotide to a human subject by intrathecal administration, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO: 1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is 5-methylcytosine. In some cases, the fixed dose of the antisense oligonucleotide is about 100 mg or 100 mg. In other cases, the fixed dose of the antisense oligonucleotide is about 60 mg or 60 mg. In other cases, the fixed dose of the antisense oligonucleotide is about 40 mg or 40 mg. In some other cases, the fixed dose of the antisense oligonucleotide is about 20 mg or 20 mg. In some cases, the fixed dose of the sodium salt of the antisense oligonucleotide is about 105.9 mg or 105.9 mg. In other cases, the fixed dose of the sodium salt of the antisense oligonucleotide is about 63.5 mg or 63.5 mg. In other cases, the fixed dose of the sodium salt of the antisense oligonucleotide is about 42.3 mg or 42.3 mg. In some other cases, the fixed dose of the sodium salt of the antisense oligonucleotide is about 21.2 mg or 21.2 mg.

[0154] Also provided are methods of reducing synthesis of human SOD1 protein in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a fixed dose of an antisense oligonucleotide to a human subject by intrathecal administration, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO: 1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is 5-methylcytosine. In some cases, the fixed dose of antisense oligonucleotide is about 100mg or 100mg. In other cases, the fixed dose of antisense oligonucleotide is about 60mg or 60mg. In other cases, the fixed dose of antisense oligonucleotide is about 40mg or 40mg. In some other cases, the fixed dose of antisense oligonucleotide is about 20mg or 20mg.

[0155] Also provided are methods of reducing human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis. The method involves administering a fixed dose of an antisense oligonucleotide to a human subject by intrathecal administration, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO: 1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is 5-methylcytosine. In some cases, the fixed dose of antisense oligonucleotide is about 100mg or 100mg. In other cases, the fixed dose of antisense oligonucleotide is about 60mg or 60mg. In other cases, the fixed dose of antisense oligonucleotide is about 40mg or 40mg. In some other cases, the fixed dose of antisense oligonucleotide is about 20mg or 20mg.

[0156] Also provided are methods of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the SOD1 gene in a human subject in need thereof, wherein the method entails administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0157] In some cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 100mg or 100mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 60mg or 60mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 40mg or 40mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 20mg or 20mg antisense oligonucleotide.

[0158] Also provided are methods of reducing human SOD1 protein synthesis in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis, wherein the method entails administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure: In some cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 100mg or 100mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 60mg or 60mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 40mg or 40mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 20mg or 20mg antisense oligonucleotide.

[0159] Also provided are methods of reducing human SOD1 mRNA levels in a human subject having a mutation in the human SOD1 gene associated with amyotrophic lateral sclerosis, wherein the method entails administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure: In some cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 100mg or 100mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 60mg or 60mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 40mg or 40mg antisense oligonucleotide. In other cases, antisense oligonucleotide or its salt is applied with a dosage equivalent to about 20mg or 20mg antisense oligonucleotide.

[0160] In some cases, a fixed dose of an antisense oligonucleotide or a salt thereof described above is administered to a human subject once a week, once every two weeks, once every three weeks, or once every four weeks.

[0161] In some cases, antisense oligonucleotides described herein are applied to human subjects as a part of pharmaceutical composition. In certain embodiments, pharmaceutical composition is applied to human subjects with the amount of antisense oligonucleotides that are enough to deliver about 20mg fixed dose (that is, being equivalent to about 20mg). In certain embodiments, pharmaceutical composition is applied to human subjects with the amount of antisense oligonucleotides that are enough to deliver about 40mg fixed dose. In certain embodiments, pharmaceutical composition is applied to human subjects with the amount of antisense oligonucleotides that are enough to deliver about 60mg fixed dose. In certain embodiments, pharmaceutical composition is applied to human subjects with the amount of antisense oligonucleotides that are enough to deliver about 100mg fixed dose.

[0162] In certain embodiments, the antisense oligonucleotide or its salt of the above-mentioned fixed dose is administered as one or more loading doses. In some embodiments, the antisense oligonucleotide of the above-mentioned fixed dose is administered as one or more maintenance doses. In some cases, the antisense oligonucleotide of the above-mentioned fixed dose is administered as one or more loading doses and followed by one or more maintenance doses. One or more loading doses may be administered, for example, weekly, every two weeks, every three weeks, or every four weeks. After the last loading dose, one or more maintenance doses may be administered, for example, weekly, every two weeks, every three weeks, or every four weeks. In some cases, one or more maintenance doses are administered every month.

[0163] In certain embodiments, three loading doses of an antisense oligonucleotide or a salt thereof are administered to a human subject, followed by at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more) maintenance dose. In some cases, three loading doses are administered two weeks apart. In some cases, three loading doses are administered 14 days apart. In some cases, one or more maintenance doses are administered 4 weeks after the third loading dose. In some cases, one or more maintenance doses are administered monthly after the third loading dose. In some cases, one or more maintenance doses are administered every 28 days after the third loading dose.

[0164] The mutation in SOD1 can be any mutation in the human SOD1 gene that is associated with ALS. In some cases, the mutation is a slowly progressive ALS disease mutation. In other cases, the mutation is a rapidly progressive ALS disease mutation. In some cases, the mutation in the human SOD1 gene is one or more of the following: A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S59I, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, or G147R. In one specific embodiment, the human subject has an A4V mutation in the human SOD1 gene. In another specific embodiment, the human subject has an H46R mutation in the human SOD1 gene. In yet another specific embodiment, the human subject has a G93S mutation in the human SOD1 gene.

[0165] In some cases, genetic testing is done to identify mutations in the SOD1 gene.

[0166] In some cases, the methods described above involve identifying a mutation in the SOD1 gene through genetic testing.

[0167] In certain embodiments, the administration of a therapeutically effective amount of an antisense oligonucleotide or a salt thereof (e.g., Compound A) to a human subject is accompanied by monitoring the SOD1 level in the human subject to determine the response of the human subject to the administration of the antisense oligonucleotide or a salt thereof. The response of the human subject to the administration of the antisense oligonucleotide or a salt thereof can be used by a physician to determine the amount and duration of therapeutic intervention. In certain embodiments, the human SOD1 level in the CSF is monitored. In certain embodiments, the human SOD1 level in the plasma is monitored.

[0168] In certain embodiments, the administration of antisense oligonucleotides or salts thereof (e.g., Compound A) reduces SOD1 protein expression. In certain embodiments, the administration of antisense oligonucleotides or salts thereof (e.g., Compound A) reduces SOD1 protein expression by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%, or a range defined by any two of these values. In certain embodiments, the reduction of SOD1 protein expression is a reduction in CSF. In certain embodiments, the reduction of SOD1 protein expression is a reduction in plasma.

[0169] In certain embodiments, the administration of antisense oligonucleotides or salts thereof (e.g., Compound A) improves motor function and respiration in human subjects. In certain embodiments, the administration of antisense oligonucleotides or salts thereof improves motor function and respiration by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%, or a range defined by any two of these values.

[0170] In certain embodiments, a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof (eg, Compound A) is used in the preparation of a medicament for treating a human subject suffering from or susceptible to ALS (eg, a human subject having a mutation in SOD1 associated with ALS).

[0171] Delivery device

[0172] In certain embodiments, antisense oligonucleotides or their salts (e.g., Compound A) are administered to human subjects using a syringe for intrathecal delivery. In another embodiment, antisense oligonucleotides or their salts (e.g., Compound A) are administered to human subjects using a pump for intrathecal delivery. Therefore, the disclosure also provides a pump or syringe of a sterile preparation comprising antisense oligonucleotides or their salts (e.g., Compound A). A syringe or pump may be suitable for intrathecal administration of antisense oligonucleotides or their salts. In some cases, a syringe or pump delivers one or more fixed doses (e.g., about 20mg or 20mg, about 40mg or 40mg, about 60mg or 60mg, or about 100mg or 100mg) of antisense oligonucleotides. The disclosure also provides a pump or syringe of a sterile preparation comprising a pharmaceutical composition containing antisense oligonucleotides or their salts (e.g., Compound A). A syringe or pump may be suitable for intrathecal administration of a pharmaceutical composition. In some cases, a syringe or pump delivers a pharmaceutical composition of an antisense oligonucleotide at one or more fixed doses (e.g., about 20 mg or 20 mg, about 40 mg or 40 mg, about 60 mg or 60 mg, or about 100 mg or 100 mg). In a specific embodiment, a pump or syringe comprises a sterile formulation of an antisense oligonucleotide or a salt thereof, wherein the syringe or pump is suitable for intrathecal administration of an antisense oligonucleotide or a salt thereof (e.g., Compound A) at a fixed dose of 20 mg, 40 mg, 60 mg, or 100 mg antisense oligonucleotide.

[0173] Determination

[0174] RNA Isolation

[0175] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. RNA is prepared using methods well known in the art, such as using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocol.

[0176] Analysis of target levels or inhibition of expression

[0177] SOD1 nucleic acid levels or inhibition of expression can be determined in a variety of ways known in the art. For example, target nucleic acid levels can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently achieved using the commercially available ABI PRISM 7600, 7700, or 7900 sequence detection systems available from PE-Applied Biosystems, Foster City, CA, and used according to the manufacturer's instructions.

[0178] Quantitative real-time PCR analysis of target RNA levels

[0179] Quantification of SOD1 RNA levels can be achieved by quantitative real-time PCR using an ABI PRISM 7600, 7700 or 7900 sequence detection system (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

[0180] Prior to real-time PCR, the isolated RNA was subjected to a reverse transcriptase (RT) reaction to generate complementary DNA (cDNA), which was then used as a substrate for real-time PCR amplification. RT and real-time PCR reactions were performed sequentially in the same sample well. RT and real-time PCR reagents were obtained from Invitrogen (Carlsbad, CA). RT real-time PCR reactions were performed by methods well known to those skilled in the art.

[0181] The expression level of cyclophilin A is used as a constant expression gene, or the amount of gene (or RNA) target obtained by real-time PCR is normalized by quantitative total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). The expression of cyclophilin A is quantified by real-time PCR by simultaneous, multitasking or independent operation with the target. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invitrogen, Inc. Eugene, OR). The method of RNA quantification by RIBOGREEN is taught in Jones, LJ et al. (Analytical Biochemistry, 1998, 265, 368-374). CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

[0182] Probes and primers are designed to hybridize to SOD1 nucleic acid.Methods of designing real-time PCR probes and primers are well known in the art and may include the use of software such as PRIMER EXPRESS software (Applied Biosystems, Foster City, CA).

[0183] Analysis of protein levels

[0184] Antisense inhibition of SOD1 nucleic acids can be assessed by measuring SOD1 protein levels. Protein levels of SOD1 can be assessed or quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry, or fluorescence activated cell sorting (FACS). Antibodies to the target can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody production methods well known in the art. Antibodies suitable for detecting human SOD1 are commercially available.

[0185] Testing for SOD1 mutations

[0186] One potential genetic cause for ALS is one or more mutations in the human SOD1 gene. Thus, identification of subjects suffering from or susceptible to ALS can be performed by genetic testing of the subject's SOD1 gene using assays known in the art, such as gene sequencing. At least 180 mutations in human SOD1 are known in the art to be associated with ALS.

[0187] Analysis of the subject's susceptibility to ALS disease can also be performed by analyzing the subject's family history of ALS. Family history analysis can include a three-generation pedigree documenting ALS, review of medical records, and autopsy studies of family members, as well as identification of an autosomal dominant pattern of SOD1 mutations.

[0188] The following examples should not be construed as limiting the scope of the present invention in any way.

[0189] Example

[0190] Example 1: Experimental Design

[0191] Compound A is under study in an ongoing clinical trial. The trial involves randomized, placebo-controlled, single ascending dose (SAD) and multiple ascending dose (MAD) studies in SOD1 ALS patients. In the MAD part, participants receive 5 doses of the study drug over approximately 3 months. Fifty participants are randomized (3:1 per group) to receive 20 mg, 40 mg, 60 mg or 100 mg of Compound A, or placebo. Between 1 and 4, the Compound A-treated participants in each group have a priori documented SOD1 mutations (mainly A4V) that are rapidly progressive.

[0192] Example 2: Security Profile

[0193] In the trial, 66 of 70 patients (94%) experienced at least 1 adverse event (AE), most of which were graded as mild or moderate. The most common AEs occurring in ≥3 participants receiving Compound A were headache (n=16), procedural pain (n=14), and post-lumbar puncture syndrome (n=13). Seven patients experienced serious adverse events (SAEs), 3 of which were fatal. No SAEs were reported in the highest dose group (Compound A 100 mg). Six subjects had SAEs that were assessed as unrelated to Compound A and felt to be related to ALS or comorbidities. All fatal events were assessed as unrelated. One patient had SAEs of increased CSF leukocytes and increased CSF protein that were assessed to be associated with Compound A. Regardless of continued dosing of Compound A, those laboratory abnormalities resolved and the patient completed the study. No serious adverse events were reported at the highest dose of 100 mg tested.

[0194] Example 3: Pharmacokinetics and Pharmacodynamics

[0195] In the SAD (not shown) and MAD groups ( Figure 2 ) observed a dose-dependent increase in Compound A plasma (not shown) and CSF concentrations. The plasma concentrations of Compound A measured on Day 1 and Day 85 were proportional to the dose, while the exposure of Compound A in CSF showed a less than dose-proportional response. A decrease in CSF SOD1 concentration from baseline was observed at the 40 mg multiple dose level and higher levels (i.e., 60 mg and 100 mg), which increased with dose, with a maximum average decrease of 36% (1.02% in the 100 mg multiple dose group). Figure 3 ). A decrease in CSF SOD1 from baseline was observed in all participants in the 100 mg dose group. The maximum SOD1 decrease was observed at or immediately after the last dose, indicating that continuous administration of more than 5 doses may cause further decreases. Modeling based on preclinical data suggests that Compound A 100 mg effectively reduces SOD1 levels in the spinal cord by >99% and in the cortex by about 25-30%.

[0196] Example 4: Clinical Observation

[0197] Efficacy was assessed at multiple time points on several scales including the Amyotrophic Lateral Sclerosis Functional Rating Scale-Revised (ALFSFRS-R), Slow Vital Capacity (SVC), and Handheld Dynamometer (HHD) scales. In all cohorts, the Compound A-treated groups had higher, i.e., better scores ( Figures 4A to 4CThe mean change in ALSFRS-R score from baseline to Day 85 for Compound A-treated participants in the 100 mg dose group (N=10) was -1.1 vs. -5.6 for placebo-treated participants (N=12); a difference of 4.4 points. In participants with known rapidly progressive SOD1 mutations, such as A4V, significant differences were observed between Compound A-treated participants and placebo-treated participants in the 100 mg dose group. In these rapidly progressive participants, the mean difference in the change in ALSFRS-R from baseline to Day 85 was nearly 10 points ( Figure 5 ). In rapid progress ( Figure 5 ) and non-rapidly progressing participants ( Figure 6 ), the treatment effect appeared consistent across multiple clinical scales and CSF SOD1 reduction. As a frame of reference, the ALSFRS-R difference at 6 months in the pivotal trial of edaravone in ALS was 2.5 points.

[0198] In summary, the trial has demonstrated that Compound A is a safe and effective treatment for subjects with SOD1 ALS. This is supported most strongly by the results in subjects with rapidly progressing mutation subtypes (mainly A4V) treated with Compound A, especially in the 100 mg dose group, where rapid decline in the absence of effective treatment would be expected. As noted above, efficacy was assessed on several scales including the Amyotrophic Lateral Sclerosis Functional Rating Scale-Revised (ALSFRS-R), Slow Vital Capacity (SVC), and Handheld Dynamometer (HHD) at multiple time points. The results showed that each of the 3 clinical functional endpoints in the Compound A 100 mg dose group was much less declining than the placebo group.

[0199] Example 5: CSF phosphorylated neurofilament heavy chain (pNFH) levels

[0200] In patients with rapidly progressive SOD1 mutations, treatment with Compound A resulted in reduced CSF pNFH levels and slower clinical decline compared with placebo. Figure 8 ) compared with patients with rapidly progressive SOD1 mutations ( Figure 7 ) observed a large difference in pNFH levels between the Compound A 100 mg and placebo groups on Day 85.

[0201] Other Implementations

[0202] While the invention has been described in conjunction with specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the appended claims.

[0203] The present application further relates to the following embodiments:

[0204] 1. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 100 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0205] 2. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0206] 3. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0207] 4. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 20 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0208] 5. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 100 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0209] 6. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0210] 7. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0211] 8. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 20 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0212] 9. The method of any one of embodiments 1 to 8, wherein the mutation in the SOD1 gene is A4V.

[0213] 10. The method of any one of embodiments 1 to 8, wherein the mutation in the SOD1 gene is A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S59I, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, or G147R.

[0214] 11. The method of any one of embodiments 1 to 10, wherein the mutation in the SOD1 gene is identified by genetic testing.

[0215] 12. The method of any one of embodiments 1 to 10, comprising identifying the mutation in the SOD1 gene by genetic testing.

[0216] 13. The method of any one of embodiments 1 to 12, wherein the pharmaceutical composition is administered to the human subject at least 5 times over the course of four months.

[0217] 14. The method of any one of embodiments 1 to 13, wherein a loading dose of the pharmaceutical composition is administered to the human subject, followed by a maintenance dose of the pharmaceutical composition.

[0218] 15. The method of embodiment 14, wherein three loading doses are administered to the human subject, and wherein the loading doses are administered two weeks apart.

[0219] 16. The method of embodiment 14, wherein the maintenance dose is administered every 4 weeks starting 4 weeks after the third loading dose.

[0220] 17. The method of embodiment 14, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0221] (i) a first loading dose of the pharmaceutical composition;

[0222] (ii) a second loading dose of the pharmaceutical composition administered 14 days after the first loading dose;

[0223] (iii) a third loading dose of the pharmaceutical composition administered 28 days after the first loading dose; and

[0224] (iv) a first maintenance dose of the pharmaceutical composition administered 28 days or 1 month after the third loading dose.

[0225] 18. The method of embodiment 14, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0226] (i) a first loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of the antisense oligonucleotide;

[0227] (ii) a second loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said second loading dose is administered 14 days after said first loading dose;

[0228] (iii) a third loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said third loading dose is administered 28 days after said first loading dose; and

[0229] (iv) a first maintenance dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said first maintenance dose is administered 28 days after said third loading dose.

[0230] 19. The method of embodiment 14, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0231] (i) a first loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of the antisense oligonucleotide;

[0232] (ii) a second loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said second loading dose is administered 14 days after said first loading dose;

[0233] (iii) a third loading dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said third loading dose is administered 28 days after said first loading dose; and

[0234] (iv) a first maintenance dose in an amount sufficient to deliver a fixed dose of about 100 mg of said antisense oligonucleotide, wherein said first maintenance dose is administered 1 month after said third loading dose.

[0235] 20. A syringe or pump comprising a sterile formulation of an antisense oligonucleotide, wherein the syringe or pump is suitable for intrathecal administration of the antisense oligonucleotide at a fixed dose of about 20 mg, about 40 mg, about 60 mg, or about 100 mg, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

[0236] 21. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0237]

[0238] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 100 mg of the antisense oligonucleotide.

[0239] 22. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0240]

[0241] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 60 mg of the antisense oligonucleotide.

[0242] 23. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0243]

[0244] and wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 40 mg of the antisense oligonucleotide.

[0245] 24. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof by intrathecal administration, wherein the antisense oligonucleotide has the following structure:

[0246]

[0247] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 20 mg of the antisense oligonucleotide.

[0248] 25. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof, wherein the antisense oligonucleotide has the following structure:

[0249]

[0250] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 100 mg of the antisense oligonucleotide.

[0251] 26. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof, wherein the antisense oligonucleotide has the following structure:

[0252]

[0253] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 60 mg of the antisense oligonucleotide.

[0254] 27. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof, wherein the antisense oligonucleotide has the following structure:

[0255]

[0256] and wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 40 mg of the antisense oligonucleotide.

[0257] 28. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject by intrathecal administration a pharmaceutical composition comprising an antisense oligonucleotide or a salt thereof, wherein the antisense oligonucleotide has the following structure:

[0258]

[0259] And wherein the antisense oligonucleotide or a salt thereof is administered at a dose equivalent to about 20 mg of the antisense oligonucleotide.

[0260] 29. The method of any one of embodiments 21 to 28, wherein the mutation in the SOD1 gene is A4V.

[0261] 30. The method of any one of embodiments 21 to 28, wherein the mutation in the SOD1 gene is A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S59I, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R, or G147R.

[0262] 31. The method of any one of embodiments 21 to 30, wherein the mutation in the SOD1 gene is identified by genetic testing.

[0263] 32. The method of any one of embodiments 21 to 30, comprising identifying the mutation in the SOD1 gene by genetic testing.

[0264] 33. The method of any one of embodiments 21 to 32, wherein a salt of the antisense oligonucleotide is administered to the human subject.

[0265] 34. The method of embodiment 33, wherein the salt is a sodium salt.

[0266] 35. The method of embodiment 33, wherein the salt of the antisense oligonucleotide has the following structure:

[0267]

[0268] 36. The method of any one of embodiments 21 to 35, wherein a loading dose of the pharmaceutical composition is administered to the human subject, followed by a maintenance dose of the pharmaceutical composition.

[0269] 37. The method of embodiment 36, wherein three loading doses are administered to the human subject, and wherein the loading doses are administered two weeks apart.

[0270] 38. The method of embodiment 36, wherein the maintenance dose is administered every 4 weeks starting 4 weeks after the third loading dose.

[0271] 39. The method of embodiment 36, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0272] (i) a first loading dose of the pharmaceutical composition;

[0273] (ii) a second loading dose of the pharmaceutical composition administered 14 days after the first loading dose;

[0274] (iii) a third loading dose of the pharmaceutical composition administered 28 days after the first loading dose; and

[0275] (iv) a first maintenance dose of the pharmaceutical composition administered 28 days or 1 month after the third loading dose.

[0276] 40. The method of embodiment 36, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0277] (i) a first loading dose equivalent to about 100 mg of the antisense oligonucleotide;

[0278] (ii) a second loading dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said second loading dose is administered 14 days after said first loading dose;

[0279] (iii) a third loading dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said third loading dose is administered 28 days after said first loading dose; and

[0280] (iv) a first maintenance dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said first maintenance dose is administered 28 days after said third loading dose.

[0281] 41. The method of embodiment 36, wherein the loading dose and maintenance dose of the pharmaceutical composition are administered to the human subject as follows:

[0282] (i) a first loading dose equivalent to about 100 mg of the antisense oligonucleotide;

[0283] (ii) a second loading dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said second loading dose is administered 14 days after said first loading dose;

[0284] (iii) a third loading dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said third loading dose is administered 28 days after said first loading dose; and

[0285] (iv) a first maintenance dose equivalent to about 100 mg of said antisense oligonucleotide, wherein said first maintenance dose is administered 1 month after said third loading dose.

Claims

1. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 100 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

2. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

3. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

4. A method of treating or preventing amyotrophic lateral sclerosis associated with a mutation in the superoxide dismutase 1 (SOD1) gene in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 20 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

5. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver a fixed dose of about 100 mg of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

6. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 60 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

7. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 40 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

8. A method of reducing superoxide dismutase 1 (SOD1) protein synthesis in a human subject having a mutation in the SOD1 gene associated with amyotrophic lateral sclerosis, the method comprising administering to the human subject a pharmaceutical composition by intrathecal administration in an amount sufficient to deliver about 20 mg of a fixed dose of an antisense oligonucleotide, wherein the nucleobase sequence of the antisense oligonucleotide consists of CAGGATACATTTCTACAGCT (SEQ ID NO:1), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside bonds between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester bonds and the internucleoside bonds between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate bonds, and wherein each cytosine is 5-methylcytosine.

9. The method of any one of claims 1 to 8, wherein the mutation in the SOD1 gene is A4V.

10. The method of any one of claims 1 to 8, wherein the mutation in the SOD1 gene is A4V, H46R, G93S, A4T, G141X, D133A, V148G, N139K, G85R, G93A, V14G, C6S, I113T, D49K, G37R, A89V, E100G, D90A, T137A, E100K, G41A, G41D, G41S, G13R, G72S, L8V, F20C, Q22L, H48R, T54R, S59I, V87A, T88deltaTAD, A89T, V97M, S105deltaSL, V118L, D124G, L114F, D90A, G12R or G147R.

Images