Application of FGF8 protein in preparing antibacterial agents

Abstract

The present invention belongs to the technical field of genetic engineering, and discloses the application of FGF8 protein in the preparation of antibacterial agents. In the present invention, Escherichia coli BL21(DE3) is used to express grass carp FGF8a and mouse FGF8b, and after purification by Ni 2+ -TED agarose gel column, recombinant proteins of grass carp FGF8a and mouse FGF8b are obtained, and it is found that these two proteins have significant bactericidal effects on both Gram-negative bacteria and Gram-positive bacteria, and can be used to prepare broad-spectrum antibacterial agents or antibacterial drugs, having high application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of FGF8 protein in the preparation of antibacterial agents. The present invention for the first time discloses and verifies that FGF8 protein (including FGF8a protein of grass carp or / and FGF8b protein of mouse) has a broad-spectrum antibacterial effect. Background Art

[0002] With the development of the aquaculture industry, problems such as antibiotic resistance and drug residues caused by the overuse of antibiotics have severely restricted the development of the aquaculture industry in China. Therefore, it is urgent to develop new antibacterial drugs to replace the application of traditional antibiotics in the aquaculture industry. Antibacterial peptides or antibacterial proteins are a class of polypeptides or proteins with broad-spectrum antibacterial, antifungal, antiviral, antiprotozoal and antitumor cell killing activities. And with their unique mechanism of action and the characteristic of being less likely to produce drug resistance, they are considered to be one of the effective alternatives to antibiotics and have broad application prospects for disease prevention and control.

[0003] Fibroblast growth factor 8 (FGF8) is one of the members of the fibroblast growth factor (FGF) family. It is expressed in various tissues during embryonic development and is crucial for the formation of various organs and the nervous system. In addition, FGF8 also exists in peripheral blood leukocytes and is involved in the formation of normal red blood cells. Since FGF8 is involved in the proliferation and differentiation of tissue cells, FGF8 also has the application potential of tissue wound repair clinically.

[0004] The present invention for the first time discovers that FGF8 protein (including FGF8a protein of grass carp or / and FGF8b protein of mouse) has broad-spectrum antibacterial activity and can be used for the preparation of broad-spectrum antibacterial agents. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of fibroblast growth factor 8 in the preparation of antibacterial agents.

[0006] Another purpose of the present invention is to provide the application of fibroblast growth factor 8 in the preparation of drugs for treating or preventing bacterial infections. In order to achieve the above purpose, the present invention takes the following technical measures:

[0007] The application of fibroblast growth factor 8 protein or its coding gene in the preparation of antibacterial agents.

[0008] The application of fibroblast growth factor 8 protein or its coding gene in the preparation of drugs for treating or preventing bacterial infections.

[0009] For the above-mentioned application, preferably, the fibroblast growth factor 8 is fibroblast growth factor 8 of mammals or / and oviparous animals;

[0010] For the application described above, preferably, the mammal is a mouse; the oviparous animal is a fish.

[0011] For the application described above, preferably, the fibroblast growth factor 8 is grass carp FGF8a protein and / or mouse FGF8b protein. The grass carp FGF8a protein comprises the sequence shown in SEQ ID NO.1, and the mouse FGF8b protein comprises the sequence shown in SEQ ID NO.2.

[0012] For the application described above, preferably, the fibroblast growth factor 8 contains a protein purification tag.

[0013] For the application described above, preferably, the coding gene of the grass carp FGF8a protein is as shown in SEQ ID NO.3, and the coding gene of the mouse FGF8b protein is as shown in SEQ ID NO.4.

[0014] For the application described above, preferably, the bacterium is a Gram-negative bacterium and / or a Gram-positive bacterium;

[0015] For the application described above, preferably, the Gram-negative bacteria include:

[0016] Escherichia coli (E. coli), Aeromonas hydrophila (A. hydrophila), Yersinia ruckeri (Y. ruckeri), Pseudomonas fluorescens (P. fluorescens), Edwardsiella ictaluri (E. ictaluri), Vibrio fluvialis (V. fluvialis) and / or Aeromonas sobria (A. sobria);

[0017] The Gram-positive bacteria include: Staphylococcus aureus (S. aureus), Streptococcus agalactiae (S. agalactiae), Micrococcus luteus (M. luteus) and / or Streptococcus dysgalactiae (S. dysgalactiae).

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] The present invention has for the first time discovered that fibroblast growth factor 8 (FGF8) from different animals has a broad-spectrum antibacterial effect, and has good effects on both Gram-negative and Gram-positive bacteria.

[0020] In the present invention, the applicant adopted the prokaryotic expression method to express and purify both grass carp FGF8a and mouse FGF8b, and found that the FGF8 proteins of these two animals have significant bactericidal effects on Gram-negative bacteria and Gram-positive bacteria, that is, they have broad-spectrum antibacterial activity and can be used to prepare broad-spectrum antibacterial agents or antibacterial drugs. Description of the Drawings

[0021] Figure 1 It is a detection result diagram of the purification of the recombinant grass carp FGF8a protein in Example 1 of the present invention;

[0022] Among them, lane M: Protein Marker; lane 1: His-grass carp FGF8a fusion protein.

[0023] Figure 2 It is a detection result diagram of the antibacterial activity of the recombinant grass carp FGF8a protein in Example 2 of the present invention.

[0024] Figure 3 It is a detection result diagram of the purification of the recombinant mouse FGF8b protein in Example 1 of the present invention;

[0025] Among them, lane M: Protein Marker; lane 1: His-mouse FGF8b fusion protein.

[0026] Figure 4 It is a detection result diagram of the antibacterial activity of the recombinant mouse FGF8b protein in Example 2 of the present invention. Detailed Embodiments

[0027] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments in the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present invention.

[0028] The present invention obtained recombinant grass carp FGF8a and mouse FGF8b proteins with purification tags by prokaryotic expression, and verified their antibacterial effects. Proteins obtained by other methods, such as artificially synthesized grass carp FGF8a and mouse FGF8b without purification tags, can also achieve their antibacterial effects. Due to space limitations, they will not be elaborated in this application.

[0029] Example 1:

[0030] Preparation of recombinant proteins of grass carp FGF8a and mouse FGF8b:

[0031] (1) Amplification of grass carp FGF8a gene and synthesis of mouse FGF8b gene

[0032] According to the gene sequence of grass carp FGF8a on NCBI and the multiple cloning sites on the pET-15b vector, specific primers with NcoI and BamHⅠrestriction enzyme sites were designed using Primer Premier 5.0 software:

[0033] Up: catg a ccatgg b ac c TCCCCGCCTAATTTTACACAG,

[0034] Down: cgc d ggatcc e TCAACGCTCTCCTGAGTAGCG.

[0035] Among them a and d represent the protection bases of the restriction enzyme sites, b and e represent the NcoI and BamH I restriction enzyme sites respectively, c represents the anti-mismatch base.

[0036] Using grass carp cDNA as a template, the target gene FGF8a shown in SEQ ID NO.3 (the signal peptide sequence is not included in this gene) was cloned, and the PCR product was recovered using a PCR product recovery kit.

[0037] The mouse FGF8b gene sequence (shown in SEQ ID NO.4) with NcoI and BamH I restriction enzyme sites added at the 5' and 3' ends respectively was synthesized by Wuhan Qingke Biotechnology Co., Ltd.

[0038] (2) Obtaining of BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b engineering bacteria

[0039] After double digestion of the PCR recovery product of grass carp FGF8a gene in step (1) and pET-15b plasmid with NcoI and BamH I, they were ligated using T4 DNA ligase and then transformed into DH5α competent cells. In addition, the synthesized gene sequence of mouse FGF8b with NcoI and BamHⅠ restriction sites was ligated into the double-digested pET-15b plasmid and transformed into DH5α competent cells. Positive clones were screened and sequenced respectively. The recombinant plasmids of grass carp pET-15b-FGF8a and mouse pET-15b-FGF8b were extracted from the correctly sequenced strains respectively and transformed into BL21(DE3) expression strains. The positive clones were engineering bacteria (BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b) containing pET-15b-grass carp FGF-8a and pET-15b-mouse FGF-8b recombinant plasmids respectively.

[0040] (3) Prokaryotic expression and purification of His-grass carp FGF8a and His-mouse FGF8b fusion proteins

[0041] 1) Prepare buffer A, pH 8.0: 20 mM Tris, 300 mM NaCl; binding buffer B, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea; washing buffer C, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea, 10 mM imidazole; elution buffer D, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea, 300 mM imidazole; dialysis buffer E, pH 7.4: 20 mM Tris.

[0042] 2) Inoculate the engineering bacteria BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b into LB medium containing ampicillin (100 μg / mL) respectively, and culture them with shaking at 37 °C until OD 600 = 0.6, add IPTG to a final concentration of 0.75 mM and then induce culture at 37 °C for 5 h.

[0043] 3) Centrifuge to collect the bacterial cells (5000 g, 10 min), then resuspend them in 50 mL of pre-cooled solution A, disrupt them under high pressure for 10 min, and then centrifuge at 12000 g for 60 min to collect the inclusion body precipitate.

[0044] 4) Dissolve the inclusion bodies with 50 mL of solution B and then centrifuge at 12000 g for 60 min to collect the supernatant.

[0045] 5) Equilibrate Ni with 100 mL of solution B 2+-TED agarose gel column, incubate the supernatant with the purification filler at 4°C overnight, wash with 200 mL of solution B, wash away impurities with 200 mL of solution C, and elute the target protein with 20 mL of solution D. The eluted target protein is gradually dialyzed into buffer E with decreasing gradients of urea, imidazole, and sodium chloride to obtain the His-grass carp FGF8a fusion protein fused with His-tag ( Figure 1 , containing the amino acid sequence shown in SEQ ID NO.1) and the His-mouse FGF8b fusion protein ( Figure 3 , containing the amino acid sequence shown in SEQ ID NO.2).

[0046] Example 2:

[0047] Detection of in vitro antibacterial activities of grass carp FGF8a and mouse FGF8b proteins

[0048] In this example, a total of 7 common Gram-negative bacteria and 4 Gram-positive bacteria in the art are used as examples to verify the broad-spectrum antibacterial activities of grass carp FGF8a and mouse FGF8b proteins in vitro, including:

[0049] Gram-negative bacteria:

[0050] Test group of grass carp FGF8a protein: Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri, Pseudomonas fluorescens, Edwardsiella ictaluri, Vibrio fluvialis, and Aeromonas sobria;

[0051] Test group of mouse FGF8b protein: Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri, and Pseudomonas fluorescens;

[0052] Gram-positive bacteria:

[0053] Test group of grass carp FGF8a protein: Staphylococcus aureus, Streptococcus agalactiae, Micrococcus luteus, and Streptococcus dysgalactiae.

[0054] Test group of mouse FGF8b protein: Staphylococcus aureus, Streptococcus agalactiae, and Micrococcus luteus. (1) Detection of bactericidal activities of grass carp FGF8a and mouse FGF8b

[0055] 1) Streak inoculate 11 strains stored at -80°C on TSA plates and incubate at 37°C (Escherichia coli, Yersinia ruckeri, Pseudomonas fluorescens, Staphylococcus aureus, Streptococcus agalactiae, Micrococcus luteus, and Streptococcus dysgalactiae) or 28°C (Aeromonas hydrophila, Edwardsiella ictaluri, Vibrio fluvialis, and Aeromonas sobria) for 18 - 24 h; pick single colonies on the TSA plates and inoculate them into 20 mL of TSB medium, shake until the logarithmic phase (3 - 5 h), and collect the bacterial cells by centrifugation (5000 g, 10 min).

[0056] 2) Wash the bacteria twice with 20 mM Tris (pH 7.4) (5000 g, 10 min), resuspend, and adjust the bacterial cell concentration to 5×10 7 CFU / mL.

[0057] 3) Mix 2 μL of the bacterial cell suspensions of the test strains for grass carp FGF8a protein and mouse FGF8b protein with different concentrations of the corresponding proteins (48 μL) or an equal volume of Tris buffer evenly, and incubate at 37°C or 28°C for 3 h. Then, use the dilution plating method combined with the CFU counting method to count the number of bacteria in each group.

[0058] Use an equal volume of Tris buffer to replace the FGF8a protein as a negative control.

[0059] 4) Calculate the antibacterial rate according to the following formula:

[0060] Bacterial antibacterial rate = (number of colonies in the negative control group - number of colonies in the experimental group) / number of colonies in the negative control group × 100%

[0061] According to Figure 2 and Figure 4 the detection results, grass carp FGF8a and mouse FGF8b both have good bactericidal activities against Gram-negative and Gram-positive bacteria and can both be used to prepare antibacterial agents.

[0062] Table 1 Antibacterial rate of grass carp FGF8a against bacteria

[0063]

[0064]

[0065] Table 2 Antibacterial rate of mouse FGF8b against bacteria

[0066]

[0067] The above is only the preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. Use of fibroblast growth factor 8 protein or its encoding gene in the preparation of an antibacterial agent in vitro, wherein the fibroblast growth factor 8 protein is grass carp FGF8a protein, and its amino acid sequence is shown as SEQ ID NO.1, and the antibacterial target of the antibacterial agent is Escherichia coli ( Escherichia coli ), Aeromonas hydrophila ( Aeromonas hydrophila ), Yersinia ruckeri ( Yersinia ruckeri ), Pseudomonas fluorescens ( Pseudomonas fluorescens ), Edwardsiella ictaluri ( Edwardsiella ictaluri ), Vibrio fluvialis ( Vibrio fluvialis ), Aeromonas sobria ( Aeromonas sobria ), Staphylococcus aureus ( Staphylococcus aureus ), Streptococcus agalactiae ( Streptococcus agalactiae ), Micrococcus luteus ( Micrococcus luteus ), and / or Streptococcus dysgalactiae ( Streptococcus dysgalactiae ).

2. The application according to claim 1, characterized in that, The coding gene of the grass carp FGF8a protein is shown as SEQ ID NO.

3.

3. Application of fibroblast growth factor 8 protein or its coding gene in preparing an in vitro antibacterial agent, wherein the fibroblast growth factor 8 is mouse FGF8b protein, and its amino acid sequence is shown as SEQ ID NO.2, and the antibacterial target of the antibacterial agent is Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri, Pseudomonas fluorescens, Staphylococcus aureus, Streptococcus agalactiae and / or Micrococcus luteus.

4. The application according to claim 3, wherein The coding gene of the mouse FGF8b protein is shown as SEQ ID NO.4.

Images