Factor VIII compositions and methods of making and using same

Abstract

The present invention relates to compositions comprising a Factor VIII coagulation factor linked to an extended recombinant polypeptide (XTEN), isolated nucleic acids encoding the compositions and vectors and host cells containing the isolated nucleic acids, and methods of making and using the compositions in the treatment of Factor VIII related diseases, disorders and conditions.

Description

[0001] This application is a re-divisional application of a divisional application with a filing date of July 11, 2012, Chinese application number 201911274326.2, and invention name “Factor VIII composition and preparation and use method thereof” (the original application number of the parent case is 201280072346.1).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application Serial No. 61 / 599,400, filed February 15, 2012, which is incorporated herein by reference.

[0004] Sequence Listing

[0005] This application contains a sequence listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy, created on July 11, 2012, is named 32887346.txt and is 13,344,768 bytes in size. Background Art

[0006] Factor VIII is an important component of the intrinsic coagulation cascade pathway. In the circulation, Factor VIII is primarily complexed with von Willebrand factor. After activation by thrombin (factor IIa), it dissociates from the complex to interact with factor IXa in the intrinsic coagulation cascade, which in turn activates factor X. Once removed from the von Willebrand factor complex, activated Factor VIII is proteolytically inactivated by activated protein C (APC), factor Xa, and factor IXa, and is rapidly cleared from the bloodstream. When complexed with normal von Willebrand factor protein, the half-life of Factor VIII is approximately 12 hours, while in the absence of von Willebrand factor, the half-life of Factor VIII is reduced to 2 hours (Tuddenham EG et al., Br J Haematol. (1982) 52(2): 259-267).

[0007] In hemophilia, blood clotting is interfered with by the lack of certain plasma coagulation factors. Hemophilia A is a factor VIII deficiency and is a recessive sex-linked X-chromosome disorder that accounts for 80% of hemophilia cases. The standard of care for managing hemophilia A is supplementation therapy with recombinant factor VIII concentrate. Subjects with severe hemophilia A have circulating procoagulant factor VIII levels that are 1-2% lower than normal, and a preventive therapy is typically used with the goal of keeping factor VIII above 1% between doses, which can usually be achieved by giving factor VIII two to three times a week. People with moderately severe hemophilia (factor VIII levels are 2-5% of normal) account for 25-30% of hemophiliac events and develop bleeding after minor trauma. People with mild hemophilia A (factor VIII levels are 5-40% of normal) account for 15-20% of all hemophiliac events and only develop bleeding after major trauma or surgery.

[0008] The in vivo activity of exogenously supplied Factor VIII is limited by both the short half-life of the protein and inhibitors that bind to Factor VIII and diminish or destroy hemostatic function.

[0009] Up to 30% of hemophilia A patients who receive exogenously supplied factor VIII mount an IgG immune response against factor VIII (Towfighi, F. et al. Comparative measurement of anti-factor VIII antibody by Bethesda assay and ELISA reveals restricted isotype profile and epitopespecificity. Acta Haematol (2005) 114: 84-90), which can result in complete inhibition of its procoagulant activity and / or promote more rapid clearance of factor VIII ( E et al. High titer inhibitors in severe heemophilia A. Ameta-analysis based on eight long-term follow-ups studies conceming inhibitors associated with crude or intermediate purity factor VIII products. Throm. Haemost. (1994) 72: 162-164). IgG antibodies known as FVIII inhibitors are primarily directed against the A2, A3, and C2 domains (Scandella D et al. Localization of epitopes for human factor VIII inhibitor antibodies by immunoblotting and antibody neutralization. Blood (1989) 74: 1618-1626), but can also be produced against the A1, B, and C1 domains. Therefore, treatment options for patients with FVIII inhibitors are limited.

[0010] Large proteins such as Factor VIII are usually administered intravenously to make the agent directly available in the bloodstream. It has previously been demonstrated that intramuscular injection of unmodified Factor VIII produces a maximum circulating level of only 1.4% of normal plasma levels (Pool et al., Ineffectiveness of Intramuscularly Injected Factor VIII Concentrate in Two Hemophilic Patients. New England J. Medicine (1966) 275(10):547-548). Formulations that can be administered other than by the intravenous route would greatly simplify their use, increase safety, and result in substantial cost savings.

[0011] Chemical modification of therapeutic proteins can improve their in vivo clearance rate and subsequent serum half-life. An example of common modification is the addition of a polyethylene glycol (PEG) moiety, which is typically coupled to the protein by reacting an aldehyde or N-hydroxysuccinimide (NHS) group on the PEG with an amine group (e.g., a lysine side chain or N-terminus). However, the conjugation step can result in the formation of a heterogeneous product mixture that requires extraction, purification, and / or other further processes, all of which inevitably affect product yield and quality control. In addition, if the amino acid side chains near the binding site of the coagulation factor become modified by the PEGylation process, the pharmacological function of the coagulation factor may be hindered. Other methods include fusing the Fc domain gene to the therapeutic protein, which can increase the size of the therapeutic protein and therefore reduce the rate of clearance by the kidney. In some cases, the Fc domain confers binding to the FcRn receptor and the ability to recirculate through the FcRn receptor autolysosome, thereby increasing the pharmacokinetic half-life. Unfortunately, Fc domains do not fold efficiently during recombinant expression and tend to form insoluble precipitates called inclusion bodies. These inclusion bodies must be solubilized and functional protein must be renatured from the misfolded aggregates, a time-consuming, inefficient, and expensive process. Summary of the Invention

[0012] The present invention relates to novel blood coagulation factor VIII fusion protein compositions and uses thereof. Specifically, compositions provided herein are particularly useful for treating or improving the symptom associated with hemophilia A, factor VIII deficiency, bleeding disorders, and coagulopathy. On the one hand, the invention provides compositions comprising the isolated fusion protein of factor VIII (FVIII) and one or more extended recombinant polypeptides (XTEN), wherein the fusion protein exhibits procoagulant activity. The subject XTEN suitable for constructing the fusion protein is typically a polypeptide with non-repetitive sequences and non-structured conformation. In one embodiment, one or more XTEN are connected to a blood coagulation factor FVIII ("CF") selected from natural human factor VIII, factor VIII B domain deletion sequence ("FVIII BDD"), and sequence variants thereof (all of the aforementioned are collectively referred to as "FVIII" or "CF"), thereby producing a recombinant factor VIII-XTEN fusion protein ("CFXTEN"). The factor VIII polypeptide component of CFXTEN comprises A1 domain, A2 domain, C1 domain, C2 domain, and optionally B domain or a portion thereof. In some embodiments, FVIII is further characterized by delineating the above-mentioned domains to include acidic a1, a2, and a3 spacers. In another embodiment, the present disclosure relates to pharmaceutical compositions comprising fusion proteins and their use in methods and regimens for treating Factor VIII-related conditions. CFXTEN compositions have enhanced pharmacokinetic and pharmacological properties compared to FVIII not linked to XTEN, which can allow for more convenient administration and improved efficacy.

[0013] In a first aspect, the present invention relates to a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and one or more extended recombinant polypeptides (XTEN) linked to the Factor VIII. In some embodiments, the present invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain comprising an a1 acidic spacer region, an A2 domain comprising an a2 acidic spacer region, an A3 domain comprising an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the at least one XTEN is linked to the Factor VIII polypeptide at: (i) the C-terminus of the Factor VIII polypeptide; (ii) within the B domain of the Factor VIII polypeptide, if present; (iii) within the A1 domain of the Factor VIII polypeptide.

[0014] The XTEN is preferably present in an A2 domain of the Factor VIII polypeptide or in an A3 domain of the Factor VIII polypeptide, wherein the XTEN is present at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% of the procoagulant activity of the Factor VIII polypeptide as measured by an in vitro coagulation assay compared to the corresponding Factor VIII not linked to the XTEN. In one embodiment, in the foregoing recombinant Factor VIII fusion protein, at least one XTEN is linked to the Factor VIII polypeptide at a site that is 1 to 6 amino acids or within a site selected from Tables 5, 6, 7, 8, and 9.In other embodiments, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least a first extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an Al domain comprising an a1 acidic spacer region, an A2 domain comprising an a2 acidic spacer region, an A3 domain comprising an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the first XTEN is linked to the Factor VIII polypeptide at: (i) the C-terminus of the Factor VIII polypeptide; (ii) within the B domain of the Factor VIII polypeptide, if all or a portion of the B domain is present; (iii) within the Al domain of the Factor VIII polypeptide; (iv) within the C-terminus of the Factor VIII polypeptide; or (v) within the A2 domain of the Factor VIII polypeptide; (v) within the A3 domain of the Factor VIII polypeptide; (vi) within the C1 domain of the Factor VIII polypeptide; or (vii) within the C2 domain of the Factor VIII polypeptide; and the fusion protein (a) retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% procoagulant activity in an in vitro coagulation assay described herein or other such assays known in the art, and / or (b) exhibits reduced binding to an anti-Factor VIII antibody in an in vitro binding assay described herein or other such assays known in the art, when compared to a corresponding Factor VIII protein not linked to the XTEN. In one embodiment, in the aforementioned recombinant Factor VIII fusion proteins, at least one XTEN is linked to the Factor VIII polypeptide at a site at or within 1 to 6 amino acids of a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In other embodiments, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least a first extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an Al domain containing an a1 acidic spacer region, an A2 domain containing an a2 acidic spacer region, an A3 domain containing an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the first XTEN is linked to the Factor VIII polypeptide at an insertion site selected from Tables 6 and 7, and wherein the fusion protein retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% of the procoagulant activity compared to the corresponding Factor VIII protein not linked to the XTEN when measured by an in vitro coagulation assay described herein or other such assays known in the art.Non-limiting examples of Factor VIII proteins not linked to XTEN include native FVIII, BDD FVIII, pBC100, and the sequences from Table 1. In another embodiment of the recombinant Factor VIII fusion protein, the Factor VIII polypeptide has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity to a sequence selected from the group consisting of the sequences of Table 1, when optimally aligned. Figure 3 The sequence depicted in Figure 4 In another embodiment, the fusion protein comprises at least one additional XTEN linked to the Factor VIII polypeptide at the C-terminus of the Factor VIII polypeptide or within the B domain of the Factor VIII polypeptide, or optionally replacing the B domain of the Factor VIII polypeptide. In a specific embodiment, the fusion protein comprises at least one XTEN sequence located within the B domain of the Factor VIII polypeptide or optionally replacing the B domain of the Factor VIII polypeptide. In another specific embodiment, the fusion protein comprises at least one XTEN sequence linked to the Factor VIII polypeptide at the C-terminus of the Factor VIII polypeptide. In one embodiment, the recombinant Factor VIII fusion protein comprises a B domain deleted variant of human Factor VIII, wherein with respect to Figure 3 The full-length human Factor VIII sequence set forth in , wherein the B domain deletion begins at a first position at about amino acid residue number 741 to about 750 and ends at a second position at about amino acid residue number 1635 to about 1648. In another embodiment, the recombinant Factor VIII fusion protein comprises a first XTEN sequence linked to the Factor VIII polypeptide at the C-terminus of the Factor VIII polypeptide, and at least a second XTEN within the B domain of the Factor VIII polypeptide or replacing the B domain of the Factor VIII polypeptide, wherein with respect to Figure 3In one embodiment, the second XTEN is linked to the full-length human Factor VIII sequence set forth in , wherein the second XTEN is linked to the C-terminus at about amino acid residue numbering 741 to about 750 and the N-terminus at about amino acid residue numbering 1635 to about 1648, wherein the cumulative length of the XTEN is at least about 100 amino acid residues. In one embodiment, in the aforementioned fusion protein, the second XTEN is linked to Factor VIII amino acids between N745 and P1640, or between S743 and Q1638, or between P747 and V1642, or between N745 and Q1656, or between N745 and S1657, or between N745 and T1667, or between N745 and Q1686, or between R747 and V1642, or between T751 and T1667. In one embodiment, the recombinant Factor VIII fusion protein comprises a sequence having at least about 80% sequence identity, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% to about 100% sequence identity compared to a sequence of similar length selected from Table 21, when optimally aligned. In another embodiment, the recombinant factor VIII fusion protein comprises at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN, wherein the second, third, fourth, fifth, or sixth XTEN is each linked to the factor VIII polypeptide at a second, third, fourth, fifth, or sixth site selected from the group consisting of: an insertion site from Table 5, Table 6, Table 7, Table 8, and Table 9; an insertion site at amino acid residues 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1727, 1730, 1741, 1750, 1761, 1771, 1780, 1790, 1801, 1811, 1820, 1830, 1840, 1850, 1861, 1870, 1880, 1890, 1901, 1911, 1920, 1930, 1940, 1950, 1960 In one embodiment, the first XTEN is separated from the second XTEN by at least 10 amino acids, at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 300 amino acids, or at least 400 amino acids.In one embodiment of the recombinant Factor VIII fusion protein comprising at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN, each XTEN, when optimally aligned, has at least about 80% sequence identity, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to an XTEN of similar length selected from the group consisting of the sequences in Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17. In another embodiment of the recombinant Factor VIII fusion protein, the recombinant Factor VIII fusion protein comprises at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN. In preferred embodiments, the recombinant Factor VIII fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days when administered to a subject, wherein the subject is selected from humans and Factor VIII / von Willebrand Factor double knockout mice. Additionally, in the embodiments of this paragraph, the fusion protein exhibits reduced binding to an anti-Factor VIII antibody or retains greater procoagulant activity, or both, compared to the corresponding Factor VIII not linked to the XTEN. In one embodiment, the procoagulant activity of the recombinant Factor VIII fusion protein in the presence of an anti-FVIII antibody is at least 30%, or 40%, 50%, 80%, 100%, 200%, 300%, 400%, or 500% greater than that of the corresponding Factor VIII not linked to the XTEN, when each is assayed by an in vitro coagulation assay. In one embodiment, the reduced binding of the fusion protein to the anti-Factor VIII antibody is determined using a Bethesda assay utilizing an anti-Factor VIII antibody selected from the group consisting of the antibodies of Table 10 and polyclonal antibodies from hemophilia A patients with Factor VIII inhibitors, wherein the reduced binding and retained procoagulant activity of the fusion protein is demonstrated by a reduction in the Bethesda titer of the fusion protein by at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units compared to the Bethesda titer of Factor VIII not linked to the XTEN.

[0014] In one embodiment, the recombinant Factor VIII fusion protein can, for example, comprise one or more XTEN wherein the XTEN has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to one or more XTEN of similar length selected from Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned.

[0015] In another aspect, the present invention relates to a recombinant factor VIII fusion protein comprising FVIII and one or more XTEN in a specific N-terminal to C-terminal configuration. In one embodiment of the CFXTEN composition, the present invention provides a recombinant factor VIII fusion protein of Formula I:

[0016] (XTEN) x -CF-(XTEN) y I

[0017] Wherein, independently for each occurrence, CF is a Factor VIII as defined herein, including sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity to the sequences from Table 1; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity to the sequences set forth in Table 4. Thus, the CFXTEN fusion compositions can have XTEN-CF, XTEN-CF-XTEN, or CF-XTEN configurations.

[0018] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula II:

[0019] (XTEN) x -(S) x -(CF)-(XTEN) y II

[0020] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 1; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x + y ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0021] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein, wherein the fusion protein has Formula III:

[0022] (XTEN) x -(S) x -(CF)-(S) y -(XTEN) y III

[0023] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 1; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x + y ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0024] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IV:

[0025] (A1)-(XTEN) u -(A2)-(XTEN) v -(B)-(XTEN) w -(A3-(XTEN) x -(C1)-(XTEN) y-(C2)-(XTEN) z

[0026] IV

[0027] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; v is 0 or 1; w is 0 or 1; x is 0 or 1; y is 0 or 1; y is 0 or 1, with the proviso that u+v+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0028] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula V:

[0029] (XTEN) t -(S) a -(A1)-(S) b -(XTEN) a -(S) b -(A2)-(S) c -(XTEN) v -(S) c -(B)-(S) d -(XTEN) w -(S) d -(A3)-(S) e -(XTEN) x -(S) e -(C1)-(S) f -(XTEN) y -(S) f -(C2)-(S) g -(XTEN)2 V

[0030] wherein, independently at each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0031] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VI:

[0032] (XTEN) u -(S) a -(A1)-(S) b -(XTEN) y -(S) b -(A2)-(S) c -(XTEN) w -(S) c -(A3)-(S) d -(XTEN) x (S) d -(C1)-(S) c -(XTEN) y -(S) c -(C2)-(S) f -(XTEN) z VI

[0033] wherein, independently at each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, with the proviso that u + v + w + x + y + z ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0034] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VII:

[0035] (SP)-(XTEN) x -(CS) x -(S) x -(FVIII_1-745)-(S) y -(XTEN) y -(S) y -FVIII_1640-2332)-(S) z -(CS) z -(XTEN) z VII

[0036] wherein, independently at each occurrence, SP is a signal peptide, preferably having the sequence MQIELSTCFFLCLLRFCFS (SEQ ID NO: 1611), CS is a cleavage sequence listed in Table 12, S is a spacer sequence of between 1 to about 50 amino acid residues which may optionally include amino acids compatible with a restriction site, "FVIII 1-745" are residues 1-745 of Factor FVIII and "FVIII_1640-2332" are residues 1640-2332 of FVIII, x is 0 or 1, y is 0 or 1, and z is 0 or 1, wherein x+y+z>2; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0037] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VIII:

[0038] (A1)-(S) a -(XTEN) v -(S) a -(A2)-(B1)-(S) b -(XTEN) w -(S) b -(B2)-(A3)-(S) c -(XTEN) x -(S) e -(C1)-(S) d -(XTEN) y -(S) d -(C2)-(S) e -(XTEN) z VIII

[0039] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; B1 is a fragment of the B domain that can have residues 741 to 743-750 of FVIII or about residue 741 to about residue 745 of FVIII; B2 is a fragment of the B domain that can have residues 1635-1686 to 1689 of FVIII or about residue 1640 to about residue 1689 of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a fragment having between 1 and about 50 amino acid residues Optionally, a cleavage sequence or amino acid spacer sequence compatible with a restriction site may be included; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u + v + w + x + y + z ≥ 1; and the XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VIII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0040] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IX:

[0041] (A1 N )-(S) a -(XTEN) t -(S) b -(A1 C )-(A2 N )-(S) c -(XTEN) u -(S) d -(A2 C )-(B N )-(S) e -(XTEN) v -(S) t -(B C )-(A3 N )-(S) g -(XTEN) w -(S) h -(A3 C )-(C1 N -(S)i -(XTEN) x -(S) j -(C1 C )-(C2 N )-(S) k -(XTEN) y -(S) l -(C2 C )-(S) m -(XTEN) x

[0042] IX

[0043] In which, for each occurrence independently, A1 N is a fragment of the A1 domain from at least residue number 1 (numbered relative to native mature FVIII) to at most residue number 371, A1 c is a fragment of the A1 domain from at least residue number 2 to at most residue number 372, provided that the A1 N The sequence of the fragment is in the A1 c No repetition in the segment; A2 N is a fragment of the A2 domain from at least residue number 373 to at most residue number 739, A2 c is a fragment of the A2 domain from at least residue number 374 to at most residue number 740, provided that the A2 N The sequence of the fragment is in the A2 c No repetition in the segment; B N is a fragment of the B domain from at least residue number 741 to at most residue number 1647, B c is a fragment of the B domain from at least residue number 742 to at most residue number 1648, provided that the B N The sequence of the fragment is described in c No repetition in the segment; A3 N is a fragment of the A3 domain from at least residue number 1649 to at most residue number 2019, A3 c is a fragment of the A3 domain from at least residue number 1650 to at most residue number 2019, provided that the A3 N The sequence of the fragment is in the A3 c No repetition in the segment; C1 N is a fragment of the C1 domain from at least residue number 2020 to at most residue number 2171, C1 c is a fragment of the C1 domain from at least residue number 2021 to at most residue number 2172, provided that the C1 N The sequence of the fragment is in the C1 c No repetition in the segment; C2 Nis a fragment of the C2 domain from at least residue number 2173 to at most residue number 2331, C2 c is a fragment of the C2 domain from at least residue number 2174 to at most residue number 2332, provided that the C2 N The sequence of the fragment is in the C2 c is not repeated in the fragment; S is a spacer sequence having between 1 and about 50 amino acid residues, which may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; h is 0 or 1; i is 0 or 1; j is 0 or 1; k is 0 or 1; l is 0 or 1; m is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t+u+v+w+x+y+z≥1; and the XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to one or more XTEN of similar length selected from Table 4. In one embodiment of Formula IX, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12. In another embodiment of Formula IX, Z is 1. In another embodiment of the fusion protein of Formula IX, V is 1 and with respect to Figure 3In another embodiment of the fusion protein of Formula IX, the XTEN is linked to the C-terminus at about amino acid residue number 741 to about 750 and the N-terminus at about amino acid residue number 1635 to about 1648. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y, and z is 2, 3, 4, 5, or 6. In another embodiment of Formula IX, the sum of t, u, v, w, x, y, and z is 2, and v is 1 and z is 1. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y, and z is 3, v and z are each equal to 1, and any one of t, u, w, x, or y is 1. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y, and z is 4, v, w, and z are each equal to 1, and both of t, u, x, or y are 1. In another embodiment of the fusion protein of Formula IX, the cumulative length of the XTEN is between about 84 and about 3000 amino acid residues. In another embodiment of Formula IX, at least one XTEN is inserted immediately downstream of the amino acid corresponding to the amino acid in mature native human Factor VIII selected from the group consisting of amino acid residue numbers 32, 220, 224, 336, 339, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910. In another embodiment of the fusion protein of Formula IX, each XTEN is linked to the fusion protein at a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In another embodiment of the fusion protein of Formula IX, each XTEN has at least about 80%, or about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to an XTEN of similar length selected from the group consisting of the sequences in Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned.

[0044] In another embodiment of the CFXTEN composition, the invention provides a first recombinant Factor VIII polypeptide of Formula X:

[0045] (A1)-a1-(A2)-a2-[B] X

[0046] and a second polypeptide comprising Formula XI:

[0047] a3-(A3)-(C1)-(C2) XI

[0048] wherein the first polypeptide and the second polypeptide are fused or exist as a heterodimer; wherein A1 is the A1 domain of Factor VIII; A2 is the A2 domain of Factor VIII; [B] is the B domain of Factor VIII, a fragment thereof, or a deletion thereof; A3 is the A3 domain of Factor VIII; C1 is the C1 domain of Factor VIII; C2 is the C2 domain of Factor VIII; a1, a2, and a3 are acidic spacer regions; wherein the A1 domain comprises the XTEN permissive loop-1 (A1-1) region and the X wherein the A2 domain comprises an XTEN-permissive loop-2 (A1-2) region; wherein the A2 domain comprises an XTEN-permissive loop-1 (A2-1) region and an XTEN-permissive loop-2 (A2-2) region; wherein the A3 domain comprises an XTEN-permissive loop-1 (A3-1) region and an XTEN-permissive loop-2 (A3-2) region; wherein the XTEN sequence is inserted into at least one of regions A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2; ​​and wherein the recombinant Factor VIII protein exhibits procoagulant activity. In one embodiment of the heterodimer, the first polypeptide and the second polypeptide form a single polypeptide chain comprising the formula (A1)-a1-(A2)-a2-[B]-[a3]-(A3)-(C1)-(C2). In one of the foregoing embodiments, "fused" refers to a peptide bond.

[0049] In another embodiment of the CFXTEN composition, the invention provides a first recombinant Factor VIII polypeptide of Formula X:

[0050] (A1)-a1-(A2)-a2-[B] X

[0051] and a second polypeptide comprising Formula XI:

[0052] a3-(A3)-(C1)-(C2) XI

[0053] wherein the first polypeptide and the second polypeptide are fused or exist as a heterodimer; wherein A1 is the A1 domain of Factor VIII; A2 is the A2 domain of Factor VIII; [B] is the B domain of Factor VIII, a fragment thereof, or is deleted; A3 is the A3 domain of Factor VIII; C1 is the C1 domain of Factor VIII; C2 is the C2 domain of Factor VIII; a1, a2, and a3 are acidic spacer regions; wherein the XTEN sequence is inserted into a3; and wherein the recombinant Factor VIII protein exhibits procoagulant activity. In one embodiment of the heterodimer, the first polypeptide and the second polypeptide form a single polypeptide chain comprising the formula (A1)-a1-(A2)-a2-[B]-[a3]-(A3)-(C1)-(C2). In one of the foregoing embodiments, "fused" refers to a peptide bond.

[0054] In embodiments of the foregoing polypeptides of Formulas X and XI, the XTEN permissive loop is contained within a surface-exposed flexible loop structure, and wherein, according to the secondary structure of mature Factor VIII deposited as Accession No. 2R7E in the DSSP database, A1-1 is located between β strand 1 and β strand 2, A1-2 is located between β strand 11 and β strand 12, A2-1 is located between β strand 22 and β strand 23, A2-2 is located between β strand 32 and β strand 33, A3-1 is located between β strand 38 and β strand 39, and A3-2 is located between β strand 45 and β strand 46. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A1-1 corresponds to a region of native mature human Factor VIII from about amino acid 15 to about amino acid 45. In other embodiments of the foregoing polypeptides of Formulas X and XI, A1-1 corresponds to a region of native mature human Factor VIII from about amino acid 18 to about amino acid 41. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A1-2 corresponds to a region of native mature human Factor VIII from about amino acid 201 to about amino acid 232. In other embodiments of the foregoing polypeptides of Formulas X and XI, A1-2 corresponds to a region of native mature human Factor VIII from about amino acid 218 to about amino acid 229. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A2-1 corresponds to a region of native mature human Factor VIII from about amino acid 395 to about amino acid 421. In other embodiments of the foregoing polypeptides of Formulas X and XI, A2-1 corresponds to a region of native mature human Factor VIII from about amino acid 397 to about amino acid 418. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A2-2 corresponds to a region of native mature human Factor VIII from about amino acid 577 to about amino acid 635. In other embodiments of the foregoing polypeptides of Formulas X and XI, A2-2 corresponds to a region of native mature human Factor VIII from about amino acid 595 to about amino acid 607. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A3-1 corresponds to a region of native mature human Factor VIII from about amino acid 1705 to about amino acid 1732. In other embodiments of the foregoing polypeptides of Formulas X and XI, A3-1 corresponds to a region of native mature human Factor VIII from about amino acid 1711 to about amino acid 1725. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A3-2 corresponds to a region of native mature human Factor VIII from about amino acid 1884 to about amino acid 1917. In other embodiments of the foregoing polypeptides of Formulas X and XI, A3-2 corresponds to a region of native mature human Factor VIII from about amino acid 1899 to about amino acid 1911.In other embodiments of the aforementioned polypeptides of Formulas X and XI, an XTEN sequence is inserted into at least two of regions A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2. In other embodiments of the aforementioned polypeptides of Formulas X and XI, an XTEN sequence is inserted immediately downstream of the amino acid corresponding to the amino acid in mature native human Factor VIII selected from the group consisting of amino acid residue numbers 32, 220, 224, 336, 339, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910. In other embodiments of the aforementioned polypeptides of Formulas X and XI, another XTEN sequence is inserted into the a3 acidic spacer region. In other embodiments of the aforementioned polypeptides of Formulas X and XI, another XTEN sequence is inserted into the a3 acidic spacer immediately downstream of the amino acid corresponding to amino acid 1656. In other embodiments of the foregoing polypeptides of Formulas X and XI, the Al domain comprises an XTEN permissive loop-1 (A1-1) region and an XTEN permissive loop-2 (A1-2) region, wherein the A2 domain comprises an XTEN permissive loop-1 (A2-1) region and an XTEN permissive loop-2 (A2-2) region, and wherein the A3 domain comprises an XTEN permissive loop-1 (A3-1) region and an XTEN permissive loop-2 (A3-2) region, and wherein another XTEN sequence is inserted into at least one of regions A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2. In other embodiments of the foregoing polypeptides of Formulas X and XI, another XTEN sequence is inserted immediately downstream of the amino acid corresponding to the amino acid in mature native human Factor VIII selected from the group consisting of amino acid residue numbers 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910. In the foregoing embodiments of the polypeptides of Formulas X and XI, the fusion protein exhibits at least about 30%, 40%, 50%, 60%, 70%, or 80% or 90% of the procoagulant activity of the corresponding Factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay.

[0055] In all embodiments, the polypeptide may, for example, exhibit in vitro procoagulant activity exceeding 0.5 IU / ml, or 1.0, or 1.5, or 2.0 IU / ml when expressed in cell culture medium and assayed by an in vitro coagulation assay. Procoagulant activity can be measured by a chromogenic assay, a single-stage clotting assay (e.g., aPTT), or both.

[0056] In some embodiments, wherein the recombinant Factor VIII fusion protein comprises Factor VIII and at least a first and a second XTEN, the at least first XTEN is separated from the at least second XTEN by at least 10 amino acids, at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 300 amino acids, or at least 400 amino acids.

[0057] In preferred embodiments, the recombinant factor VIII fusion protein comprises factor VIII and at least a first XTEN and optionally at least a second, or optionally at least a third, or optionally at least a fourth XTEN, and the fusion protein exhibits reduced binding to an anti-factor VIII antibody compared to the corresponding factor VIII not linked to the XTEN. The reduced binding can be assessed in vivo or by in vitro assays. In one embodiment, the in vitro assay is an ELISA assay, wherein the binding of the anti-FVIII antibody to the fusion protein is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, or at least about 40% or more compared to FVIII not linked to the XTEN. In another embodiment, the in vitro assay is a Bethesda assay, wherein the reduced binding of the fusion protein is demonstrated by a reduction in the Bethesda titer of the fusion protein by at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units compared to the Bethesda titer of Factor VIII not linked to the XTEN. In the in vitro assay, the anti-Factor VIII antibody is selected from the antibodies of Table 10 and a polyclonal antibody from a hemophilia A patient with a Factor VIII inhibitor. In a specific embodiment of a recombinant Factor VIII fusion protein comprising Factor VIII and at least a first and a second XTEN that exhibits reduced binding to a Factor VIII inhibitor antibody, the first XTEN is linked to the Factor VIII polypeptide within the C2 domain of the Factor VIII polypeptide, and the second XTEN is linked to the Factor VIII polypeptide within the A1 or A2 domain of the Factor VIII polypeptide, wherein the fusion protein exhibits reduced binding to the Factor VIII inhibitor antibody compared to the corresponding Factor VIII not linked to the XTEN, wherein the Factor VIII inhibitor antibody is capable of binding to an epitope located within the A1, A2, or C2 domain, and further, wherein the fusion protein exhibits procoagulant activity. In one embodiment of the foregoing fusion protein, the second XTEN is linked to the Factor VIII polypeptide within the A2 domain of the Factor VIII polypeptide, and the Factor VIII inhibitor antibody binds to the A2 domain of the Factor VIII polypeptide. In another embodiment of the foregoing fusion protein, the second XTEN is linked to the Factor VIII polypeptide within the C2 domain of the Factor VIII polypeptide, and the Factor VIII inhibitor antibody binds to the C2 domain of the Factor VIII polypeptide. Binding of the anti-Factor VIII antibody to the fusion protein is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40% compared to the corresponding Factor VIII not linked to the XTEN when measured by an ELISA assay, wherein the anti-Factor VIII antibody is selected from the group consisting of the antibodies in Table 10 and a polyclonal antibody from a hemophilia A subject with a Factor VIII inhibitor.The foregoing fusion proteins can further comprise at least three XTEN, wherein at least the third XTEN is linked to Factor VIII at a site selected from the group consisting of: within the B domain or replacing the B domain, at the C-terminus, and at or within 1, 2, 3, 4, 5, or 6 amino acids of an insertion site selected from Table 7 or Table 9. In embodiments in which binding to an anti-Factor VIII antibody is reduced, the fusion protein has at least 10%, 20%, 30%, 40%, 50%, 80%, 100%, 200%, 300%, 400%, or 500% greater procoagulant activity in the presence of an anti-FVIII antibody as measured by an in vitro coagulation assay (e.g., a chromogenic or single-stage clotting assay) compared to the corresponding Factor VIII not linked to the XTEN.

[0058] In all embodiments, the XTEN of the fusion protein can be characterized, for example, in that the XTEN comprises at least 36, or at least 42, or at least 72, or at least 96, or at least 144, or at least 288, or at least 400, or at least 500, or at least 576, or at least 600, or at least 700, or at least 800, or at least 864, or at least 900, or at least 1000, or at least 2000 to about 3000 amino acid residues or even more residues; glycine (G), alanine (A), serine (S), threonine (TH ... The sum of amino acid (T), glutamate (E), and proline (P) residues constitutes at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% of the total amino acid residues of the XTEN; the XTEN is substantially non-repetitive such that (i) the XTEN does not contain three identical consecutive amino acids unless the amino acid is serine; and (ii) at least about 80% of the XTEN sequence consists of non-overlapping sequence motifs, each of which comprises about 9 to about 14, or about 1 two amino acid residues consisting of four to six amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), wherein in each non-overlapping sequence motif, no two consecutive amino acid residues occur more than twice; or (iii) the subsequence score of the XTEN sequence is less than 10; the XTEN has a random coil formation rate greater than 90%, or greater than 95%, or greater than 99% (as determined by the GOR algorithm); the XTEN has less than 2% alpha helices and 2% beta helices. The XTEN lacks a predicted T-cell epitope when analyzed by the TEPITOPE algorithm, wherein the threshold value for the TEPITOPE threshold score for said prediction by said algorithm is -9, and wherein said fusion protein exhibits a terminal half-life longer than at least about 12 hours, or at least about 24 hours, or at least about 48 hours, or at least about 72 hours, or at least about 96 hours, or at least about 120 hours, or at least about 144 hours, or at least about 21 days or longer. In one embodiment, the recombinant Factor VIII fusion protein comprises at least a second, or at least a third, or at least a fourth XTEN, which may be the same as or different from another XTEN. According to a different approach, when optimally aligned, at least one, at least the second, or at least the third, or at least the fourth XTEN of the CFXTEN fusion protein each has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to one or more XTEN with similar length selected from Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17.In another different approach, at least one, at least a second, or at least a third, or at least a fourth XTEN of the CFXTEN fusion protein each has at least 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to a sequence selected from the group consisting of AE42_1, AE42_2, AE42_3, AG42_1, AG42_2, AG42_3, AG42_4 , AE144_1A, AE144_2A, AE144_2B, AE144_3A, AE144_3B, AE144_4A, AE144_4B, AE144_5A, AE144_6B, AG144_1 , AG144_2, AG144_A, AG144_B, AG144_C, AG144_F, AG144_3, AG144_4, AE288_1, AE288_2, AG288_1 and AG288_2.

[0059] In one embodiment, the factor VIII component of the CFXTEN recombinant factor VIII fusion protein comprises one, two or three amino acid replacements selected from residue R1648, Y1680 and R1689 numbered relative to mature human factor VIII, wherein the replacement is selected from alanine, glycine and phenylalanine. The limiting examples of the replacement comprises R1648A, Y1680F and R1689A.

[0060] In another embodiment, the CFXTEN fusion protein exhibits an apparent molecular weight factor of at least about 1.3, or at least about 2, or at least about 3, or at least about 4, or at least about 5, or at least about 6, or at least about 7, or at least about 8, or at least about 9, or at least about 10 when measured by size exclusion chromatography or a similar method.

[0061] In some embodiments of CFXTEN fusion rotein, one or more XTEN will be connected to FVIII by one or two cleavage sequences of the mammalian protease cracking of the group that can be selected from free factor XIa, factor XIIa, kallikrein (kallikrein), factor VIIa, factor IXa, factor Xa, factor IIa (thrombin), elastase-2 (Elastase-2), MMP-12, MMP13, MMP-17 and MMP-20 composition, wherein the cracking carried out at the cleavage sequence place by the mammalian protease makes the factor VIII sequence be released from the XTEN sequence, and the factor VIII sequence wherein released shows procoagulant activity compared to uncleaved fusion rotein and increases.In one embodiment, cleavage sequence can be by factor XIa cracking.

[0062] According to a different approach, the CFXTEN fusion protein comprises at least three XTEN located at different positions of a factor VIII polypeptide, wherein the different positions are selected from: an insertion position at 1 to 6 amino acids from a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9; an insertion position at 1 to 6 amino acids from amino acid residues 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910 of mature factor VIII; a position between any two adjacent domains in the factor VIII sequence, wherein the two adjacent domains are selected from the group consisting of A1 and A2, A2 and B, B and A3, A3 and C1, and C1 and C2; Figure 3 the full-length human factor VIII sequence set forth in , at positions within the internal B domain deletion starting at a first position at about amino acid residue number 741 to about 750 and ending at a second position at amino acid residue number 1635 to about 1648; and the C-terminus of the factor VIII sequence, wherein the cumulative length of the multiple XTEN is at least about 100 to about 3000 amino acid residues and wherein the fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay. In one of the foregoing embodiments, the fusion protein exhibits an increased terminal half-life when administered to a subject compared to a corresponding Factor VIII polypeptide lacking the XTEN, wherein the fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days when administered to a subject. In one embodiment, the subject is selected from the group consisting of humans and Factor VIII / von Willebrand Factor double knockout mice. In one of the foregoing embodiments, the fusion protein does not comprise a polypeptide selected from the group consisting of GTPGSGTASSSP (SEQ ID NO: 31), GSSTPSGATGSP (SEQ ID NO: 32), GSSPSASTGTGP (SEQ ID NO: 33), GASPGTSSTGSP (SEQ ID NO: 34), and

[0063] The sequence of GSEPATSGSETPGTSESATPESGPGSEPATSGSETPGSPAGSPTSTEEGTSTEPSEGSAPGSEPATSGSETPGSEPATSGSETPGSEPATSGSETPGTSTEPSEGSAPGTSESATPESGPGSEPAT SGSETPGTSTEPSEGSAP (SEQ ID NO: 59). In another foregoing embodiment, the fusion protein does not contain

[0064]

[0065] PGSSPSASTGTGPGSSPSASTGTGPGTPGSGTASSSPGSSTPSGATGSPGSSPSASTGTGPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGASPGTSSTGSPGASPGTSSTGSPGTPGSGTASSS (SEQ ID NO: 71) or

[0066] PGASPGTSSTGSPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGSSTPSGATGSPGSSTPSGATGSPGSSPSASTGTGPGSSPSASTGTGPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGSSPSASTGTGPGSSPS ASTGTGPGASPGTSSTGSPGASPGTSSTGSPGSSTPSGATGSPGSSPSASTGTGPGASPGTSSTGSPGSSPSASTGTGPGTPGSGTASSSPGSSTPSGATGS (SEQ ID NO: 80)-composed XTEN sequence.

[0067] On the other hand, the present invention relates to have the pharmacokinetic properties of enhancing compared to the FVIII that is not connected to XTEN, comprise the CFXTEN fusion rotein of the parameter that improves, the character of wherein said enhancing includes but not limited to compared to the FVIII that is not connected to XTEN, terminal half-life lengthens, area under the curve becomes larger, blood concentration remains on the time increase in the treatment window, causes blood concentration between the successive doses in the treatment window to increase and the administrable dosage in IU to reduce over time, but still causes blood concentration to be higher than the required threshold concentration for the procoagulant effect.In some embodiments, when using to the experimenter, the CFXTEN fusion rotein shows terminal half-life extension compared to the corresponding factor VIII polypeptide that lacks described XTEN.The experimenter can be people or mouse, as the double knockout mice of factor VIII / von Willebrand factor.In a aforementioned embodiment, when using to the experimenter, compared to the corresponding factor VIII that is not connected to XTEN, CFXTEN shows terminal half-life length at least about 2 times or about 3 times or about 4 times or about 5 times or about 10 times or about 20 times. In one embodiment, when administered to a subject, the CFXTEN fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days. In other embodiments, the enhanced pharmacokinetic properties of the fusion protein of the embodiment are compared to the corresponding FVIII not being connected to XTEN and used to a subject at similar dosage, maintaining the circulating blood concentration of the procoagulant fusion protein in a subject in need higher than the threshold concentration of 0.01 IU / ml, or 0.05 IU / ml, or 0.1 IU / ml, or 0.2 IU / ml, or 0.3 IU / ml, or 0.4 IU / ml or 0.5 IU / ml for a period of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 6 times, or at least about 8 times, or at least about 10 times, or at least about 20 times, or at least about 40 times, or at least about 60 times. The increase in half-life and the time spent above threshold concentration allows for reducing dosing frequency and reducing the amount of the fusion protein (with molar equivalents) used to a subject compared to the corresponding FVIII not being connected to XTEN. In one embodiment, administration of a subject fusion protein to a subject using a therapeutically effective dose regimen results in an increase in the time between at least two consecutive Cmax peaks and / or Cmin troughs of blood levels of the fusion protein by at least 2-fold, or at least 3-fold, or at least 4-fold, or at least 5-fold, or at least 6-fold, or at least 8-fold, or at least 10-fold, or at least about 20-fold, or at least about 40-fold, or at least about 60-fold, or more, compared to the corresponding FVIII not linked to the XTEN and administered to the subject using a similar dose regimen.

[0068] In preferred embodiments, the CFXTEN fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding Factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay, such as, but not limited to, a chromogenic assay or a single-stage or two-stage clotting assay.

[0069] According to a different approach, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises all or a portion of the A1 domain, the A2 domain, the A3 domain, the C1 domain, the C2 domain, and optionally the B domain, and wherein the at least one XTEN is linked to the Factor VIII polypeptide at an insertion site selected from residue numberings 18-32, or 40, or 211-224, or 336-403, or 599, or 745-1640, or 1656-1728, or 1796-1804, or 1900-1912, or 2171-2332; and wherein the fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding Factor VIII not linked to the XTEN. In one of the foregoing embodiments, the fusion protein comprises at least a second XTEN, or at least a third, or at least a fourth XTEN, wherein the XTEN is linked to Factor VIII at a site at or within 1 to 6 amino acids of a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In another embodiment, the invention provides a recombinant Factor VIII fusion protein further comprising at an insertion site selected from Table 5, Table 6, Table 7, Table 8, Table 9, at a site from Figure 8 at or within 6 amino acids on the N-terminal or C-terminal side of the insertion position at one or more insertion positions of Figure 9 The invention also provides at least a second XTEN, or at least a third, or at least a fourth XTEN linked to the FVIII polypeptide within the insertion range of XTEN, wherein at least two XTEN are separated by an amino acid sequence of at least 100 to about 400 amino acids.

[0070] The present invention provides CFXTEN, wherein the XTEN radius ratio of XTEN is at least 2.3 or at least 2.5, and by having at least about 20 amino-acid residues or at least about 50 or at least about 100 or at least about 200 or at least about 300 or at least about the aminoacid sequence of 400 amino-acid residues, separate.In other embodiments, CFXTEN comprises at least four XTEN, the XTEN radius ratio of wherein said XTEN is at least 2.3 or at least 2.5 or at least 2.8, and wherein at least three that are connected in fusion rotein among the four XTEN are by having at least about 20 amino-acid residues or at least about 50 or at least about 100 or at least about 200 or at least about 300 or at least about the aminoacid sequence of 400 amino-acid residues, and the 4th XTEN is connected in the B structural domain (or its fragment) or in the C structural domain (or its end).

[0071] In some embodiments, theme composition is constructed to compare to the corresponding FVIII that is not connected to XTEN, and the clearing receptor in the experimenter has the binding affinity of reduction.In one embodiment, the CFXTEN fusion rotein shows the binding affinity of the clearing receptor to FVIII in the scope of about 0.01%-30% or about 0.1% to about 20% or about 1% to about 15% or about 2% to about 10% of the binding affinity of the corresponding FVIII that is not connected to XTEN.In another embodiment, compared to the corresponding FVIII that is not connected to XTEN, the active clearance reduction of the fusion rotein that the affinity of clearing receptor is reduced and the corresponding increase of half-life is long at least about 2 times, or 3 times, or at least 4 times, or at least about 5 times, or at least about 6 times, or at least about 7 times, or at least about 8 times, or at least about 9 times, or at least about 10 times, or at least about 12 times, or at least about 15 times, or at least about 17 times, or at least about 20 times.

[0072] In one embodiment, the invention provides a recombinant Factor VIII fusion protein comprising FVIII and one or more XTEN, wherein the fusion protein exhibits at least a 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6-fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10-fold, or at least about 15-fold, or at least 20-fold, or at least 40-fold, or at least 60-fold increased solubility under physiological conditions compared to FVIII not linked to the XTEN.

[0073] In another aspect, the present invention provides a pharmaceutical composition comprising the fusion protein of any embodiment described herein and a pharmaceutically acceptable carrier.

[0074] In another embodiment, the present invention provides a method for treating a coagulopathy in a subject, comprising administering to the subject a composition comprising a coagulation-effective amount of a pharmaceutical composition. In one embodiment of the method, after the administration, the blood concentration of procoagulant Factor VIII is maintained at about 0.05, or 1, or 1.5 IU / ml or higher for at least 48 hours after the administration. In another embodiment, the present invention provides a method for clotting the blood of a subject, comprising contacting the blood with a coagulation-effective amount of a pharmaceutical composition.

[0075] In another embodiment, the invention provides a method for treating a coagulopathy in an experimenter with a circulating inhibitor of factor VIII, comprising administering to the experimenter a composition comprising a pharmaceutical composition of a therapeutically effective amount of CFXTEN, wherein the composition exhibits greater procoagulant activity in the experimenter than a composition comprising the corresponding factor VIII not connected to XTEN and administered in similar amounts. In one embodiment of the method, the coagulopathy is hemophilia A. In another embodiment, the coagulopathy is the result of trauma, surgery, or infection.

[0076] The invention provides a method for treating a bleeding episode in a subject, comprising administering to the subject a composition comprising a CFXTEN pharmaceutical composition comprising a coagulation effective amount, wherein the fusion protein comprising a coagulation effective amount suppresses a bleeding episode for a period of at least 3 times, or at least 4 times, or at least 5 times longer than a corresponding Factor VIII not connected to XTEN and administered to the subject using a similar amount. Non-limiting examples of corresponding Factor VIII not connected to XTEN include native FVIII, the sequences of Table 1, BDD-FVIII, and pCB0114FVIII.

[0077] In another embodiment, the invention provides a CFXTEN recombinant factor VIII fusion protein for the treatment of a hemophilia A patient's medical regimen, the regimen comprising a pharmaceutical composition comprising the CFXTEN fusion protein. In one embodiment of the medical regimen, the regimen further comprises a step of determining the amount of the pharmaceutical composition comprising the CFXTEN required for achieving hemostasis in the hemophilia A patient. In another embodiment, the medical regimen for the treatment of a hemophilia A experimenter comprises administering a pharmaceutical composition to the experimenter for two or more consecutive doses of an effective amount, wherein the administration results in at least one, two or three parameters associated with hemophilia A being significantly improved by at least 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90%, compared to a factor VIII not connected to XTEN and administered at similar dosages. Non-limiting examples of improved parameters include blood concentration of procoagulant FVIII, decreased activated partial thrombin (aPTT) assay time, decreased single-stage or two-stage clotting assay time, delayed onset of bleeding episodes, decreased chromogenic assay time, decreased bleeding assay time, resolution of bleeding episodes, or decreased Bilipin titer relative to native FVIII.

[0078] On the other hand, the invention provides the nucleic acid sequence of the separation of the fusion protein of any embodiment of the coding CFXTEN fusion protein.In one embodiment, the nucleic acid of separation is the complementary sequence of the sequence of the CFXTEN fusion protein of the coding embodiment.In one embodiment, the nucleic acid of separation further comprises the sequence of coding signal peptide, wherein said sequence is

[0079] ATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTTTTGCGATTCTGCTTTAGT (SEQ ID NO: 1613) or its complementary sequence. In another embodiment, the present invention provides an expression vector comprising a nucleic acid encoding a fusion protein or its complementary sequence. In another embodiment, the present invention provides an isolated host cell comprising the aforementioned expression vector. In another embodiment, the present invention provides a method for producing the fusion protein of any embodiment, comprising providing a host cell comprising an expression vector; culturing the host cell to achieve production of the fusion protein; and recovering the fusion protein.

[0080] In one embodiment, the invention provides an isolated fusion protein comprising a polypeptide having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98% or about 99% to about 100% sequence identity compared to a sequence of similar length selected from Table 21 when optimally aligned.

[0081] In another embodiment, the invention provides an isolated nucleic acid comprising a polynucleotide sequence selected from the group consisting of: (a) a sequence having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to a sequence of similar length selected from Table 21 when optimally aligned, or (b) the complement of the polynucleotide of (a). In another embodiment, the isolated nucleic acid comprises the sequence ATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTTTTGCGATTCTGCTTTAGT (SEQ ID NO: 1613) linked to the 5' end of the nucleic acid of (a), or the complement of said sequence linked to the 3' end of (b).

[0082] It is expressly contemplated that the recombinant Factor VIII fusion proteins may exhibit one or more, or any combination, of the properties disclosed herein.

[0083] Incorporated by reference

[0084] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] The features and advantages of the present invention can be further illustrated by reference to the following detailed description and accompanying drawings which illustrate illustrative embodiments.

[0086] Figure 1 A diagram showing the spatial arrangement of FVIII domains during processing and coagulation is shown and is intended to represent both native FVIII and B-domain deleted variants. The Al domain ranges from residues 1 to 372 (numbering is relative to the mature form of FVIII sequence NCBI protein RefSeq NP_000123 and encompasses the a1 residue), the A2 domain ranges from residues 373 to 740, the B domain ranges from residues 741 to 1648, the A3 domain ranges from residues 1649 to 2019 (encompassing the a3 acidic region), the C1 domain ranges from residues 2020 to 2172, and the C2 domain ranges from residues 2173 to 2332. BDD variants include deletions between 741 and 1648, leaving some or no residues remaining, with the non-limiting BDD remainder sequence being SFSQNPPVLKRHQR (SEQ ID NO: 1614). Figure 1A shows the domain organization of single-chain FVIII before processing. Arrows indicate the sites at residues R372, R740, R1648 and R1689 that are cleaved during processing and conversion of FVIII to FVIIIa. Figure 1 B shows a FVIII molecule that has been processed into a heterodimer by cleavage at residue R1648, wherein the a3 acidic region of the A3 domain is indicated on the N-terminus of A3. Figure 1 C shows the FVIOO molecule processed into the FVIIIa heterotrimer by cleavage at residues R372, R740, and R1689.

[0087] Figure 2 is a schematic diagram of the coagulation cascade showing the intrinsic and extrinsic arms leading to a common pathway.

[0088] Figure 3 The amino acid sequence of mature human Factor VIII is depicted (SEQ ID NO: 1592).

[0089] Figure 4 Depicted is the Factor VIII sequence lacking a portion of the B domain (SEQ ID NO: 1593).

[0090] Figure 5 Several examples of CFXTEN configurations are illustrated in which FVIII is linked to XTEN (XTEN is shown as a thick wavy line). In all cases, the FVIII can be the native or BDD form of FVIII, or a single-chain form with the entire B domain (including the native cleavage site) removed. Figure 5 A shows, from left to right, three variations of single-chain Factor VIII, namely, XTEN linked to the N-terminus, C-terminus, and two XTEN linked to the N-terminus and C-terminus. Figure 5 B shows, from left to right, six variations of mature heterodimeric FVIII, namely, XTEN linked to the N-terminus of the A1 domain; XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and the N-terminus of the A3 domain; XTEN linked to the C-terminus of the C2 domain and to the N-terminus of the A3 domain through residual B domain amino acids; and XTEN linked to the N-terminus of the A1 domain, to the C-terminus of the A2 domain through residual B domain amino acids, and to the C-terminus of the C2 domain. Figure 5C shows, from left to right, three variations of single-chain Factor VIII: XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, and XTEN linked within a surface loop of the A3 domain; XTEN linked within a surface loop of the A2 domain, XTEN linked within a surface loop of the C2 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and within a surface loop of the C1 domain and linked to the C-terminus of the C domain. Figure 5 D shows, from left to right, six variations of mature heterodimeric FVIII, namely, XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, and XTEN linked within a surface loop of the A3 domain; XTEN linked within a surface loop of the A2 domain, and XTEN linked within a surface loop of the C1 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, XTEN linked within a surface loop of the A3 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain, XTEN linked to the surface loop of the A1 domain, XTEN linked to the surface loop of the A3 domain, and XTEN linked to the C-terminus of the C2 domain; The XTEN is linked to the N-terminus of the A3 domain through the residual amino acids of the B domain and the XTEN is linked within the surface loop of the C2 domain; the XTEN is linked within the surface loop of the A2 domain, the XTEN is linked to the N-terminus of the A3 domain through the residual amino acids of the B domain, the XTEN is linked within the surface loop of the C1 domain and the XTEN is linked to the C-terminus of the C2 domain; and the XTEN is linked within the B domain or between the residual B domain residues of the BDD variant (and the invention also encompasses variations in which the XTEN replaces the entire B domain connecting the A2 and A3 domains (including all native cleavage sites), thereby generating a single-chain form of Factor VIII). This figure also includes all variations in which one or more XTEN sequences are inserted within the B domain and the resulting fusion is cleaved at one or more sites (e.g., at the R1648 site) during intracellular processing.

[0091] Figure 6 is a graphic depiction of a CFXTEN construct with XTEN inserted within the B domain and linked to the C-terminus of the C2 domain, illustrating the unstructured feature of XTEN that results in the formation of a random coil that can cover the portion of Factor VIII adjacent to the XTEN. In the figure below, the diagram depicts that when XTEN is in a random coil, it can adopt a conformation that creates steric hindrance that would block the binding of Factor VIII inhibitor antibodies that would otherwise have affinity for an epitope adjacent to the XTEN insertion site.

[0092] Figure 7Figure 1 is a graphical depiction of various analyses performed on FVIII B domain deletion sequences to identify insertion sites for XTEN within the FVIII sequence. Rows A to H are on an arbitrary scale spanning the Y-axis values ​​of the FVIII BDD sequence, with residue numbering on the X-axis, so that low values ​​represent regions with higher predicted tolerance to XTEN insertions. Row A shows domain boundaries; all breaks in this row represent boundaries that are likely to accept XTEN. Row B shows exon boundaries; that is, each step in the row represents a new exon. Row C shows regions that are not visible in the X-ray structure due to a lack of order in the crystal. The row marked D represents multiple order prediction results calculated using the corresponding programs FoldIndex, which can be found on the World Wide Web site bip.weizmann.ac.il / fldbin / findex (last visited on February 23, 2011) (see Jaime Prilusky, Clifford E. Felder, Tzviya Zeev-Ben-Mordehai, Edwin Rydberg, Orna Man, Jacques S. Beckmann, Israel Silman and Joel L. Sussman, 2005, Bioinformatics based on the Kyte & Doolittle algorithm) and RONN, which can be found on the World Wide Web site strubi.ox.ac.uk / RONN (last visited on February 23, 2011) (see Yang, ZR, Thomson, R., McMeil, P. and Esnouf, RM (2005) RONN: the bio-basis function neurura; network technique applied to the detection of natively disordered regions in proteins (Bioinformatics 21:3369-3376). Rows E and F are calculated based on a multiple sequence alignment of FVIII genes from 11 mammalian species available in GenBank. Row E shows the conservation of individual residues. Row F shows the conservation of a 3-amino acid segment of FVIII. Rows G and H show gaps and insertions observed in a multiple sequence alignment of 11 mammalian FVIII genes. Row J lists the XTEN insertion points obtained by combining these multiple measurements by amino acid number.

[0093] Figure 8 Describing Use Figure 8Based on the information described in and as confirmed in the assays of Example 34, a site was identified in the FVIII B domain deletion sequence (SEQ ID NO: 1594) as the active insertion point for XTEN.

[0094] Figure 9 Describing Use Figure 8 The range of sites identified for insertion of XTEN in the FVIII B domain deletion sequence (SEQ ID NO: 1595) was determined using the information described in Example 34, plus a span of amino acids surrounding each insertion point deemed suitable for insertion of XTEN.

[0095] Figure 10 It is through Figure 7 Described identification insertion point, uses molecular biology technique to insert the schematic diagram of the assembling of the CFXTEN library that single XTEN (black stick) produces at each insertion point subsequently.Express and reclaim construct, then assess FVIII activity and pharmacokinetic properties to identify those CFXTEN configurations that cause property to enhance.

[0096] Figure 11 Schematic diagram of the assembly of a library of CFXTEN components, in which segments of the FVIII BDD domain, either alone or linked to XTEN of various lengths (black sticks), are combinatorially assembled into a library of genes encoding CFXTEN, which can then be evaluated for FVIII activity and pharmacokinetic properties to identify those CFXTEN configurations that result in enhanced properties.

[0097] Figure 12 Several examples of CFXTEN configurations with XTEN (shown as bold wavy lines) are illustrated, some of which can be released by the insertion of a cleavage sequence (indicated by a black triangle) that is cleavable by a procoagulant protease. Figure 12 A illustrates scFVIII with two terminal releasable XTEN. Figure 12 B Description and Figure 12 A Same configuration, but with an additional non-releasable XTEN connecting the A3 and C1 domains. Figure 12 C illustrates mature heterodimeric FVIII with two terminal releasable XTEN. Figure 12 D illustrates the same configuration as 10C, but with an additional non-releasable XTEN connecting the A3 and C1 domains.

[0098] Figure 13 is a schematic flow chart of representative steps in assembling, producing, and evaluating XTEN.

[0099] Figure 14505.It is the schematic flow chart of the representative steps in the CFXTEN polynucleotide construct of assembling coding fusion protein.Individual oligonucleotide 501 anneals into sequence motif 502 (as containing 12 amino acid whose motif (" 12-mer")), it is connected to other sequence motifs from the library to produce the set of the XTEN 504 that contains the desired length, and is connected to the oligomer 503 that contains BbsI and KpnI restriction site of less concentration.The gained set of connecting product is carried out gel-purified and cuts the band of the XTEN with the desired length, thereby produces the isolated XTEN gene with blocking sequence (stopper sequence) 505.The XTEN gene is cloned into and filled in the carrier.In this case, carrier encoding is optional CBD sequence 506 and GFP gene 508.Then digest with BbsI / HindIII to remove 507 and 508 and place terminator codon. The resulting product was then cloned into a BsaI / HindIII-digested vector containing the gene encoding FVIII, thereby generating gene 500 encoding the FVIII-XTEN fusion protein.

[0100] Figure 15 is a schematic flow chart of representative steps in assembling a gene encoding a fusion protein comprising CF and XTEN, expressing and recovering the gene as a fusion protein, and evaluating the fusion protein as a candidate CFXTEN product.

[0101] FIG. 16 illustrates the use of donor XTEN sequences to generate truncated XTEN. Figure 16A The sequence of AG864 is provided (SEQ ID NO: 1596), where the underlined sequence was used to generate a sequence length of 576 (SEQ ID NO: 1597). Figure 16B The sequence of AG864 is provided (SEQ ID NO: 1598), where the underlined sequence was used to generate a sequence length of 288 (SEQ ID NO: 1599). Figure 16C The sequence of AG864 is provided (SEQ ID NO: 1600), where the underlined sequence was used to generate a sequence length of 144 (SEQ ID NO: 1601). Figure 16D The sequence of AE864 is provided (SEQ ID NO: 1602), where the underlined sequence was used to generate a sequence length of 576 (SEQ ID NO: 1603). Figure 16E The sequence of AE864 is provided (SEQ ID NO: 1604), where the underlined sequence was used to generate a sequence length of 288 (SEQ ID NO: 1605). Figure 16FThe sequence of AE864 (SEQ ID NO: 1606) used to generate four 144 length sequences (SEQ ID NOs 1607-1610, respectively, in order of appearance) is provided (double underline indicates the first amino acid in the 144 sequence, with single underline indicating the remainder of that sequence).

[0102] Figure 17 is a schematic representation of the design of Factor VIII-XTEN expression vectors with different strategies for introducing XTEN elements into the FVIII coding sequence. Figure 17 A shows an expression vector encoding XTEN fused to the 3' end of the sequence encoding FVIII. Figure 17 B depicts an expression vector encoding an XTEN element inserted into the middle of a coding sequence encoding a single FVIII. Figure 17 C depicts an expression vector encoding two XTEN elements: one inserted internally into the FVIII coding sequence and the other fused to the 3' end of the FVIII coding sequence.

[0103] Figure 18 The process of combinatorial gene assembly of genes encoding XTEN is illustrated. In this case, the gene is assembled from 6 base fragments and each fragment can be obtained in 4 different codon forms (A, B, C and D). This allows a theoretical diversity of 4096 to be achieved when assembling a motif containing 12 amino acids.

[0104] Figure 19 41. Pharmacokinetic profiles (plasma concentrations) of GFP in cynomolgus monkeys after subcutaneous or intravenous administration of single-dose unstructured polypeptides of varying lengths. The compositions are GFP-L288, GFP-L576, GFP-XTEN_AF576, GFP-Y576, and XTEN_AD836-GFP. Blood samples were analyzed at various times after injection and the concentration of the GFP in the plasma was measured by ELISA using a polyclonal antibody for catching GFP and a biotinylated formulation of the same polyclonal antibody for detection. The results are presented as plasma concentrations relative to time (hours) after administration, and particularly show that the half-life of XTEN_AD836-GFP (i.e., the composition with the longest XTEN sequence length) increases significantly. The construct GFP-L288 with the shortest sequence length has the shortest half-life.

[0105] Figure 20SDS-PAGE gel showing samples from a stability study of a fusion protein of XTEN_AE864 fused to the N-terminus of GFP (see Example 42). GFP-XTEN was incubated in cynomolgus monkey plasma and rat kidney lysate at 37°C for up to 7 days. In addition, GFP-XTEN administered to cynomolgus monkeys was also evaluated. Samples were taken at 0, 1, and 7 days and analyzed by SDS PAGE, followed by detection using Western blot analysis with an antibody against GFP.

[0106] Figure 21 Shown are the results of size exclusion chromatography analysis of glucagon-XTEN construct samples measured relative to protein standards of known molecular weight, with the graph output as absorbance versus retention volume, as described in Example 40. The glucagon-XTEN constructs are 1) glucagon-Y288; 2) glucagon Y-144; 3) glucagon-Y72; and 4) glucagon-Y36. The results indicate that the apparent molecular weight increases with increasing length of the XTEN portion (see Example 40 for data).

[0107] Figure 22 The results of western blots showing proteins expressed in cell culture using cells transformed with the specified constructs (Example 25) are shown. The samples in lanes 1-12 are: MW standards, FVIII (42.5 ng), pBC0100B, pBC0114A, pBC0100, pBC0114, pBC0135, pBC0136, pBC0137, pBC0145, pBC0149, and pBC0146. Lanes 8, 9, and 12 show bands consistent with the FVIII with C-terminal XTEN288, which has an estimated MW of 95 kDa. Lanes 7 and 11 show bands consistent with the FVIII with C-terminal XTEN42, which has an estimated MW of 175 kDa. Lanes 2-6 show bands consistent with FVIII and heavy chain. Lanes 10 and 23 show bands consistent with heavy chain. Lane 7 shows a band consistent with heavy chain and connected XTEN42.

[0108] Figure 23 Shown are the results of the FVIII assay on samples obtained from FVIII and von Willebrand Factor double knockout mice hydrodynamically injected with plasmid DNA, as detailed in Example 36.

[0109] Figure 24are graphical and tabular depictions of the pharmacokinetic properties of rBDD-FVIII and purified CFXTEN fusion proteins pBC0145 and pBC0146 (with C-terminal XTEN) administered to HemA or FVIII / VWF double knockout mice as described in Example 30, showing that the half-life of CFXTEN was enhanced in both mouse strains.

[0110] Figure 25 A cell culture PK assay was performed in HemA mice to Figure 25 A) or FVIII / VWF double knockout mice ( Figure 25 B) Graphical and tabular depictions of the pharmacokinetic properties of rBDD-FVIII and CFXTEN fusion proteins pSD0050 and pSD0062 (with internally inserted XTEN) administered. As described in Example 32, dose, 5-minute recovery, and half-life (T1 / 2) are shown to emphasize that in both mouse strains, the recovery and half-life of CFXTEN are enhanced compared to the positive control FVIII.

[0111] Figure 26 Figure 2 is a graphical depiction of the titration of the GMA8021 FVIII inhibitor using pBC0114BDD-FVIII and the CFXTEN construct LSD0049.002 containing three 144 amino acid XTEN insertions at residues 18, 745, and 2332. The data indicate that the amount of antibody in μg / ml required to inhibit the CFXTEN by 50% is shifted rightward by approximately 0.7 orders of magnitude compared to the FVIII positive control.

[0112] Figure 27 This is a schematic diagram of the logic flow diagram for the SegScore algorithm. In the figure, the following legends apply: i, j—counters used in the control loop that traverses the entire sequence; HitCount—this variable is a counter that records how many times a subsequence encounters the same subsequence within a block; SubSeqX—this variable holds the subsequence being checked for redundancy; SubSeqY—this variable holds the subsequence against which SubSeqX is being checked; BlockLen—this variable holds the user-specified block length; SegLen—this variable holds the segment length. The program is hard-coded to generate scores for subsequences of lengths 3, 4, 5, 6, 7, 8, 9, and 10; Block—this variable holds a string of length BlockLen. This string consists primarily of letters from the input XTEN sequence and is determined by the position of the i counter; SubSeqList—this variable holds a list of all generated subsequence scores.

[0113] Figure 28Depicts the application of the SegScore algorithm to a hypothetical XTEN of 11 amino acids (SEQ ID NO: 1591) to determine reproducibility. The XTEN sequence consisting of N amino acids is divided into N-S+1 subsequences of length S (S=3 in this case). All subsequences are compared pairwise and the average number of identical subsequences is calculated to generate a subsequence score of 1.89.

[0114] Figure 29 Be after being exposed to the GMA8021 antibody for FVIII, the figure of the individual construct ratio value of the FVIII activity of the FVIII active in the CFXTEN of mensuration and the pBC114FVIII positive control, grouping is according to the number (referring to embodiment 28) of the XTEN in building the fusion protein.Result shows that the ability that CFXTEN retains FVIII activity increases substantially linearly with the number of the XTEN incorporated into.

[0115] Figure 30 depicts the primary sequence and domain structure of a mature B-domain deleted (BDD) human FVIII construct (Example 46). The positions of the introduced NheI and ClaI restriction sites are shown. It should be noted that the amino acid numbering corresponds to the amino acid position in the primary sequence of mature FVIII (Figure 30). Individual domains are defined by gray lines / frames, with gray text identifying the domains. Acidic regions (a1, a2, a3) are indicated by dotted boxes. The solid wedges / triangles indicate the thrombin cleavage site when FVIII is activated to FVIIIa. The hollow wedges / triangles indicate the site of intracellular proteolytic processing to a double-chain form of FVIII. The hexagons indicate N-linked glycosylated sites. The circles indicate Tyr sulfation sites. The unique non-natural restriction sites (NheI, GCTAG; ClaI, ATCGAT) introduced into the cDNA to facilitate XTEN insertion / recombination are highlighted with gray double underlines.

[0116] Figure 31 A schematic representation of the FVIII construct depicted in Figure 30 is provided, indicating the domain organization and the locations of natural and non-natural restriction sites.

[0117] Figure 32Graphical ASAView output showing the structural datasets 2R7E, 3CDZ, and PM0076106. The accessible solvent areas (ASA) are shown for the amino acids in domains A1, A2, A3, C1, and C2. The X-ray crystallographic coordinates of 3CDZ (Ngo et al., Structure 16:597-606 (2008)) and 2R7E (Shen et al., Blood 111:1240-1247 (2008)) deposited in the Protein Data Bank maintained by the Research Collaboratory for Structural Bioinformatics (RCSB; http: / / www.rcsb.org / pdb) and in the Protein Model Database maintained by the Consorzio Interuniversitario per le Applicazioni di Supercalcoloper Universitàe Riserca (CASPUR) and the Department of Biochemical Sciences of the University of Rome were used. The atomic coordinates of the predicted refined FVIII structure PM0076106 (Venkateswarlu, BMC Struct. Biol. 10:7 (2010)) obtained from molecular dynamics simulation studies in the Caspur Data Bank (http: / / mi.caspur.it / PMDB / main.php) were used for analysis.

[0118] Figure 33 Structural diagram showing the location of the XTEN insertion site. The central diagram corresponding to the crystal structure of FVIII (PDB: 2R7E) is surrounded by detailed views of domains A1, A2, A3, C1, and C2. The β strands and α helices are shown as ribbons. The loops are shown as α carbon tubes. The amino acids at the XTEN insertion site are shown as CPK spheres. The numbering in each figure indicates the location of the XTEN insertion site according to the numbering in Figure 30.

[0119] Figure 34 show Figure 33 Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0120] Figure 35 show Figure 34Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0121] Figure 36 show Figure 35 Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0122] Figure 37 A ClustalW multiple sequence alignment of domains A1, A2, A3, C1, and C2 of FVIII is shown, indicating the positions of XTEN insertions that result in recombinant FVIII proteins exhibiting FVIII activity (black boxes, white text) or no FVIII activity (grey boxes, bold text).

[0123] Figure 38 A DSSP diagrammatic representation of the secondary structure of the two polypeptide chains in the native active human FVIII crystal structure deposited at the Protein Data Bank with the identifier 2R7E is shown (see Example 47). The amino acid sequence numbering is the same as the protein sequence in Figure 30. The beta-pleated regions are shown as solid arrows and are designated β1 to β66. The positions of the XTEN-permitted loops are indicated by cross-hatched boxes. The domain A1 XTEN-permitted loops are designated as loop A1-1 and loop A1-2. The domain A2 XTEN-permitted loops are designated as loop A2-1 and loop A2-2. The domain A3 XTEN-permitted loops are designated as loop A3-1 and loop A3-2.

[0124] Figure 39 A DSSP diagrammatic representation of the secondary structure of the two polypeptide chains in the native active human FVIII crystal structure deposited at the Protein Data Bank with the identifier 2R7E is shown (see Example 47). The amino acid sequence numbering is the same as the protein sequence in Figure 30. The beta-pleated regions are shown as solid arrows and are designated β1 to β66. The positions of the XTEN-permitted loops are indicated by cross-hatched boxes. The domain A1 XTEN-permitted loops are designated as loop A1-1 and loop A1-2. The domain A2 XTEN-permitted loops are designated as loop A2-1 and loop A2-2. The domain A3 XTEN-permitted loops are designated as loop A3-1 and loop A3-2.

[0125] Figure 40 A ClustalW multiple sequence alignment of domains A1, A2, A3, C1, and C2 of FVIII is shown, showing XTEN insertion positions that result in recombinant FVIII proteins displaying FVIII activity (black boxes, white text) or not displaying FVIII activity (grey boxes, bold text). The positions of the XTEN permissive loops are indicated by dotted rectangles (see Example 47).

[0126] Figure 41 . Figure 41 A presents a schematic frontal view of the structure of human FVIII (PDB: 2R7E) showing the positions of domains A1, A2, A3, C1, and C2 (circled with dashed lines) and the positions of the XTEN-permitting loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 highlighted with CPK spherical representations. Figure 41 B presents a schematic side view of the structure of human FVIII (PDB: 2R7E) showing the positions of domains A1, A2, A3, C1, and C2 (circled with dashed lines) and the positions of the XTEN-permitting loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 highlighted with CPK spherical representations.

[0127] Figure 42 Shown is a schematic top view of the isolated human FVIII (PDB: 2R7E) A domain showing the positions of the XTEN-permitting loops highlighted with CPK spherical representations. Figure 42 B, 42D, and 42F show schematic side-view structures of the isolated human FVIII (PDB: 2R7E) A domain showing the positions of the XTEN-permitting loops highlighted with CPK spherical representations.

[0128] Figure 43 The sequences of various Factor VIII B domain deletions and individual mutations are shown. Rows 4-10 show various B domain deletions with the indicated XTEN linkages flanking the B domain residual residues or A3 domain residues. The R1648A mutation is indicated by arrows in rows 5 and 8, while the Y1680F mutation is indicated by arrows in rows 8-10.

[0129] Figure 44 is a bar graph of chromogenic and aPTT assay activities of various CFXTEN with a single XTEN insert (Example 49).

[0130] Figure 45 is a bar graph of chromogenic and aPTT assay activities of various CFXTEN with two XTEN inserts (Example 49).

[0131] Figure 46 is a bar graph of chromogenic and aPTT assay activities of various CFXTEN with three XTEN inserts (Example 49).

[0132] Figure 47 is a graph of plasma levels in DKO mice of various administered CFXTEN with single XTEN inserts compared to BDD-FVIII control, showing 10- to 20-fold longer half-lives achieved by inserting XTEN at various positions (Example 50).

[0133] Figure 48 is a graph of plasma levels in DKO mice of various administered CFXTEN with one, two, and three XTEN inserts compared to a BDD-FVIII control, showing the increase in half-life achieved by including additional XTEN inserts compared to single or two inserts (Example 51).

[0134] Figure 49 The three hemophiliac sera described in Example 52 ( Figure 49 AC) or sheep anti-FVII ( Figure 49 D) Graph plotting inhibition curves of the remaining Factor VIII procoagulant activity in the assayed samples, showing a clear left shift in the inhibition curves for the two CFXTEN molecules compared to FVIII not linked to XTEN. DETAILED DESCRIPTION

[0135] Before describing the embodiment of the present invention, it should be understood that the embodiment is provided by way of example only, and various alternatives of the embodiment of the present invention described herein can be used to implement the present invention. Numerous variations, changes and substitutions will now occur to those skilled in the art without departing from the present invention.

[0136] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used when implementing or testing the present invention, the following description of suitable methods and materials is provided. In the event of a conflict, the patent specification including the definitions shall prevail. In addition, materials, methods, and examples are illustrative only and are not intended to be restrictive. Numerous variations, changes, and substitutions will now be appreciated by those skilled in the art without departing from the present invention.

[0137] definition

[0138] In the context of this application, unless otherwise specified, the following terms have the meanings ascribed to them:

[0139] As used in the specification and claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.

[0140] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to amino acid polymers of any length. A polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[0141] As used herein, the term "amino acid" refers to natural and / or unnatural or synthetic amino acids, including but not limited to both optical isomers, D or L, and amino acid analogs and peptidomimetics. Standard single-letter or three-letter codes are used to designate amino acids.

[0142] The term "domain" when used in reference to a Factor VIII polypeptide refers to a full-length domain or a functional fragment thereof, e.g., full-length or functional fragments of the A1 domain, A2 domain, A3 domain, B domain, C1 domain and / or C2 domain of Factor VIII.

[0143] The term "natural L-amino acids" refers to the L optical isomer forms of glycine (G), proline (P), alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M), cysteine ​​(C), phenylalanine (F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), glutamine (Q), asparagine (N), glutamic acid (E), aspartic acid (D), serine (S), and threonine (T).

[0144] As applied to sequences and as used herein, the term "non-naturally occurring" refers to a polypeptide or polynucleotide sequence that does not have a counterpart in a wild-type or naturally occurring sequence found in a mammal, is not complementary to a wild-type or naturally occurring sequence found in a mammal, or does not have a high degree of homology to a wild-type or naturally occurring sequence found in a mammal. For example, a non-naturally occurring polypeptide or fragment may share up to 99%, 98%, 95%, 90%, 80%, 70%, 60%, 50% or even less amino acid sequence identity with a native sequence when properly aligned.

[0145] The terms "hydrophilicity" and "hydrophobicity" refer to the degree of affinity a substance has for water. Hydrophilic substances have a strong affinity for water and tend to dissolve in, mix with, or be wetted by water, while hydrophobic substances generally lack affinity for water, tend to repel rather than absorb water, and tend not to dissolve in, mix with, or be wetted by water. Amino acids can be characterized based on their hydrophobicity. Many scales have been developed. One example is the scale developed by Levitt, M ​​et al., J Mol Biol (1976) 104:59, which is listed in Hopp, TP et al., Proc Natl Acad Sci U SA (1981) 78:3824. Examples of "hydrophilic amino acids" are arginine, lysine, threonine, alanine, asparagine, and glutamine. Of particular interest are the hydrophilic amino acids aspartic acid, glutamic acid, as well as serine and glycine. Examples of "hydrophobic amino acids" are tryptophan, tyrosine, phenylalanine, methionine, leucine, isoleucine and valine.

[0146] "Fragment," when applied to proteins, is a truncated form of a native biologically active protein that retains at least a portion of the therapeutic and / or biological activity. "Variant," when applied to proteins, is a protein that has sequence homology to a native biologically active protein that retains at least a portion of the therapeutic and / or biological activity of the biologically active protein. For example, a variant protein may share at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with a reference biologically active protein. As used herein, the term "biologically active protein portion" includes proteins that have been intentionally modified, such as by site-directed mutagenesis, synthesis of an encoding gene, insertion, or proteins that have been accidentally modified by mutation.

[0147] The term "sequence variant" refers to a polypeptide that has been modified by insertion, deletion, or substitution of one or more amino acids compared to its native or original sequence. The insertion can be located at either or both ends of the protein and / or can be located within an internal region of the amino acid sequence. A non-limiting example is the insertion of an XTEN sequence within the sequence of a biologically active payload protein. In a deletion variant, one or more amino acid residues in a polypeptide as described herein are removed. Thus, a deletion variant includes all fragments of a payload polypeptide sequence. In a substitution variant, one or more amino acid residues of a polypeptide are removed and replaced with an alternative residue. In one aspect, substitutions are conservative in nature and this type of conservative substitution is well known in the art.

[0148] As used herein, "internal XTEN" refers to an XTEN sequence that has been inserted into the sequence of a coagulation factor. An internal XTEN can be constructed by inserting an XTEN sequence into the sequence of a coagulation factor such as FVIII, wherein the insertion is achieved by inserting between two adjacent amino acids within a domain of the coagulation factor ("intradomain") or between two domains ("interdomain"), or wherein the XTEN replaces a portion of the internal sequence of the coagulation factor.

[0149] As used herein, "terminal XTEN" refers to an XTEN sequence that has been fused to the N-terminus or C-terminus of a coagulation factor, or to a proteolytic cleavage sequence or linker fused within or to the N-terminus or C-terminus of a coagulation factor. The terminal XTEN can be fused to the native termini of the coagulation factor. Alternatively, the terminal XTEN can replace a portion of the terminal sequence of the coagulation factor.

[0150] The term "XTEN release site " refers to the CFXTEN fusion rotein and can be identified and cracked by mammalian protease, thereby realizes the cleavage sequence that a part of XTEN or XTEN is discharged from the CFXTEN fusion rotein. As used herein, " mammalian protease " refers to the protease that is usually present in mammalian body fluid, cell or tissue. The XTEN release site can be engineered to be cracked by various mammalian protease (also referred to as " XTEN release protease "), described mammalian protease such as FXIa, FXIIa, kallikrein, FVIIIa, FVIIIa, FXa, FIIa (thrombin), elastase-2, MMP-12, MMP13, MMP-17, MMP-20 or any protease that exists during the coagulation event. Can utilize other equivalent proteases (endogenous or exogenous) that can identify and determine the cleavage site. Can adjust and customize the cleavage site at protease used.

[0151] When referring to a first polypeptide being linked to a second polypeptide, the term "within" encompasses linkage such that the N-terminus of the first or second polypeptide is linked to the C-terminus of the second or first polypeptide, respectively, as well as insertion of the first polypeptide into the sequence of the second polypeptide. For example, when an XTEN is linked "within a domain of a Factor VIII polypeptide," the XTEN can be linked to the N-terminus, the C-terminus, or can be inserted into the domain.

[0152] As used herein, the term "site," when used to refer to the site of insertion of an XTEN into a biological polypeptide, such as Factor VIII, refers to the amino acid position at which the XTEN is attached. When describing numbered sites, such as the first, second, third, fourth, fifth, or sixth site of insertion of an XTEN into or into Factor VIII, each site is to be understood to refer to a different site in Factor VIII; e.g., the second site is a different Factor VIII position than the first site, the third site is different from both the second and first sites, etc.

[0153] As applied to one or more forms of CFXTEN polypeptide provided herein, " activity " or " procoagulant activity " refer to no matter by measuring in vitro, in vitro or in vivo, all can combine target coagulation protein substrate or cofactor and promote the ability of clotting events. Said mensuration includes but is not limited to single-stage clotting assay, two-stage clotting assay, chromogenic assay and ELISA assay. " Biological activity " refers to biological function or effect in vitro or in vivo, includes but is not limited to receptor or ligand binding or FVIII coagulation factor to the effect of coagulation commonly known in the art or cell, physiology or clinical response, comprises stopping bleeding events.

[0154] As used herein, the term "ELISA" refers to an enzyme-linked immunosorbent assay as described herein or as otherwise known in the art.

[0155] "Host cell" includes an individual cell or cell culture that can be or has been a recipient of a subject vector. Host cells include the progeny of a single host cell. Due to natural, accidental, or deliberate mutation, the progeny may not necessarily be completely identical to the original parent cell (in morphology or in terms of genome with respect to total DNA complement sequence). Host cells include cells transfected in vivo with a vector of the invention.

[0156] "Isolated" when used to describe the various polypeptides disclosed herein refers to a polypeptide that has been identified and separated from the components of its natural environment and / or recovered from the components of the natural environment. The pollutant components of its natural environment are substances that will generally interfere with the diagnosis or therapeutic use of the polypeptide, and may include enzymes, hormones, and other proteins or non-protein solutes. As will be apparent to those skilled in the art, non-naturally occurring polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof do not need to be "isolated" to distinguish them from their naturally occurring counterparts. In addition, "concentrated," "isolated," or "diluted" polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof can be distinguished from their naturally occurring counterparts because the concentration or number of molecules per volume is typically greater than that of their naturally occurring counterparts. In general, polypeptides prepared by recombinant means and expressed in host cells are considered to be "isolated."

[0157] An "isolated" polynucleotide or polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that has been identified and separated from at least one contaminant nucleic acid molecule with which it is normally associated in the natural source of the polypeptide-encoding nucleic acid. An isolated polypeptide-encoding nucleic acid molecule is different from the form or configuration in which it is found in nature. Thus, an isolated polypeptide-encoding nucleic acid molecule is different from the specific polypeptide-encoding nucleic acid molecule as it is present in natural cells. However, an isolated polypeptide-encoding nucleic acid molecule includes polypeptide-encoding nucleic acid molecules contained in cells that normally express the polypeptide, where, for example, the nucleic acid molecule is in a chromosomal or extrachromosomal location that is different from the location of the natural cell.

[0158] A "chimeric" protein contains at least one fusion polypeptide that includes at least one region in a position in the sequence that is different from that in nature. The regions may normally exist as separate proteins and are brought together in the fusion polypeptide; or they may normally exist as the same protein but are placed in a novel arrangement in the fusion polypeptide. Chimeric proteins can be produced, for example, by chemical synthesis or by generating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship.

[0159] "Conjugated," "linked," "fused," and "fusion" are used interchangeably herein. These terms refer to the joining together of two or more chemical elements, sequences, or components by whatever means, including chemical conjugation or recombinant means. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. Generally, "operably linked" means that the DNA sequences being joined are contiguous and in reading phase or in frame. "In-frame fusion" refers to the joining of two or more open reading frames (ORFs) to form a continuous, longer ORF in a manner that maintains the correct reading frame of the original ORFs. Thus, the resulting recombinant fusion protein is a single protein containing two or more segments corresponding to the polypeptides encoded by the original ORFs (the segments are not normally so joined in nature).

[0160] In the context of polypeptides, a "linear sequence" or "sequence" is an order of amino acids in a polypeptide in the amino-terminal to carboxyl-terminal direction, wherein residues that are adjacent to each other in the sequence are contiguous in the primary structure of the polypeptide. A "partial sequence" is a linear sequence of a portion of a polypeptide that is known to include additional residues in one or both directions.

[0161] "Heterologous" refers to an entity that is genotypically different from the rest of the entity to which it is compared. For example, a glycine-rich sequence that is removed from its native coding sequence and operably linked to a coding sequence other than the native sequence is a heterologous glycine-rich sequence. As applied to polynucleotides and polypeptides, the term "heterologous" refers to a polynucleotide or polypeptide that is genotypically different from the rest of the entity to which it is compared.

[0162] The terms "polynucleotide," "nucleic acid," "nucleotide," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, which are deoxyribonucleotides or ribonucleotides or their analogs. A polynucleotide can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide can include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after polymer assembly. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.

[0163] The term "complement of a polynucleotide" refers to a polynucleotide molecule having a complementary base sequence and in the reverse orientation compared to a reference sequence such that it can hybridize with full fidelity to the reference sequence.

[0164] "Recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of in vitro cloning, restriction and / or ligation steps, and other procedures that result in a construct that can potentially be expressed as a recombinant protein in a host cell.

[0165] The terms "gene" and "gene fragment" are used interchangeably herein. They refer to polynucleotides containing at least one open reading frame that, after transcription and translation, encodes a specific protein. A gene or gene fragment can be genomic or cDNA, as long as the polynucleotide contains at least one open reading frame encompassing the entire coding region or a segment thereof. A "fusion gene" is a gene composed of at least two heterologous polynucleotides linked together.

[0166] "Homology" or "homologous" or "sequence identity" refers to the sequence similarity or interchangeability between two or more polynucleotide sequences or between two or more polypeptide sequences. When using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings can be used, or an appropriate scoring matrix such as blosum45 or blosum80 can be selected to optimize the identity, similarity or homology scores. Preferably, homologous polynucleotides are those that hybridize under stringent conditions as defined herein and have at least 70%, preferably at least 80%, more preferably at least 90%, more preferably 95%, more preferably 97%, more preferably 98%, and even more preferably 99% sequence identity compared to those sequences. Homologous polypeptides preferably have sequence identity that is at least 70%, preferably at least 80%, even more preferably at least 90%, even more preferably at least 95-99%, and most preferably 100% identical.

[0167] "Connection" refers to the process of forming a phosphodiester bond between two nucleic acid fragments or genes that connects them together. In order to connect DNA fragments or genes together, the ends of the DNA must be compatible with each other. In some cases, after endonuclease digestion, the ends will be directly compatible. However, it may be necessary to first convert the staggered ends that are usually produced after endonuclease digestion into blunt ends so that they are compatible for connection.

[0168] The term "stringent conditions" or "stringent hybridization conditions" includes conditions under which a polynucleotide will hybridize to its target sequence to a greater detectable extent than to other sequences (e.g., at least 2-fold over background). Typically, the stringency of hybridization is expressed in part with respect to the temperature and salt concentration at which wash steps are performed. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ions, typically about 0.01 to 1.0 M Na ion concentration (or other salts), at pH 7.0 to 8.3, and the temperature is at least about 30° C. for short polynucleotides (e.g., 10 to 50 nucleotides) and at least about 60° C. for long polynucleotides (e.g., greater than 50 nucleotides). For example, "stringent conditions" may include hybridization at 37° C. in 50% formamide, 1 M NaCl, 1% SDS, and three washes at 60° C. to 65° C. in 0.1×SSC / 1% SDS for 15 minutes each. Alternatively, temperatures of about 65°C, 60°C, 55°C, or 42°C may be used. The SSC concentration may vary from about 0.1 to 2×SSC, with SDS present at about 0.1%. The wash temperature is typically selected to be about 5°C to 20°C below the thermal melting point of the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matching probe. The equation for calculating the Tm and conditions for nucleic acid hybridization are well known and can be found in Sambrook, J. et al., “Molecular Cloning: A Laboratory Manual,” 3rd ed., Cold Spring Harbor Laboratory Press, 2001. Typically, a blocking reagent is used to block nonspecific hybridization. Such blocking reagents include, for example, about 100-200 μg / ml of sheared and denatured salmon sperm DNA. Organic solvents (e.g., formamide at a concentration of about 35-50% v / v) may also be used in certain circumstances (e.g., RNA:DNA hybridization). Applicable variations on these wash conditions will be readily apparent to those skilled in the art.

[0169] The terms "percent identity," "percent sequence identity," and "% identity," as applied to polynucleotide sequences, refer to the percentage of residues that match between at least two polynucleotide sequences aligned using a standardized algorithm. The algorithm can insert gaps in the compared sequences in a standardized and reproducible manner to optimize the alignment between the two sequences, and thereby achieve a more meaningful comparison of the two sequences. The percent identity can be measured over the length of an entire defined polynucleotide sequence, or can be measured over a shorter length, such as a fragment (e.g., a fragment of at least 45, at least 60, at least 90, at least 120, at least 150, at least 210, or at least 450 contiguous residues) taken from a larger defined polynucleotide sequence. The lengths are exemplary only, and it will be appreciated that any fragment length supported by the sequences shown herein in the tables, figures, or sequence listing can be used to describe the length over which the percent identity is measured. Percent sequence identity is calculated by comparing two optimally aligned sequences over a comparison window, determining the number of matched positions (positions where the identical residue is present in both polypeptide sequences), dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to produce percent sequence identity. When sequences of different lengths are to be compared, the shortest sequence defines the length of the comparison window. Conservative substitutions are not considered when calculating sequence identity.

[0170] "Percentage (%) sequence identity" with respect to the polypeptide sequences identified herein is defined as the percentage of amino acid residues in the query sequence that are identical to the amino acid residues in the second reference polypeptide sequence or a portion thereof, after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percentage of sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percentage amino acid sequence identity can be achieved in various ways that are within the skill of the art, such as using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. One skilled in the art can determine parameters suitable for measuring alignment, including any algorithm required to achieve maximum alignment over the full length of the compared sequences. Percent identity can be measured over the length of the entire determined polypeptide sequence, or can be measured over a shorter length, such as a fragment (e.g., a fragment having at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 consecutive residues) taken from a larger determined polypeptide sequence. The lengths are exemplary only, and it will be appreciated that any fragment length supported by the sequences shown herein in the tables, figures or sequence listing can be used to describe the length over which percent identity is measured.

[0171] As used herein in the context of polypeptides, the term "non-repetitive" refers to the lack of, or limited degree of, internal homology in a peptide or polypeptide sequence. The term "substantially non-repetitive" may refer, for example, to the presence or absence of the following: four consecutive amino acids in a sequence are of the same amino acid type; or to the presence of a subsequence score (defined below) of 10 or less for a polypeptide; or to the absence of a pattern of sequence motifs constituting a polypeptide sequence in the order from N-terminus to C-terminus. As used herein in the context of polypeptides, the term "repetitive" refers to the degree of internal homology in a peptide or polypeptide sequence. In contrast, a "repetitive" sequence may contain multiple identical copies of a short amino acid sequence. For example, a target polypeptide sequence can be divided into n-mer sequences and the number of identical sequences can be counted. Highly repetitive sequences contain a large fraction of identical sequences, while non-repetitive sequences contain a small fraction of identical sequences. In the case of polypeptides, a sequence may contain multiple copies of a shorter sequence or motif of defined or variable length, wherein the motif itself has a non-repetitive sequence, thereby rendering the full-length polypeptide substantially non-repetitive. The length of the polypeptide at which non-repetitiveness is measured can vary from 3 amino acids to about 200 amino acids, from about 6 amino acids to about 50 amino acids, or from about 9 amino acids to about 14 amino acids. "Repetitiveness," as used in the context of polynucleotide sequences, refers to the degree of internal homology in a sequence, such as, for example, the frequency of identical nucleotide sequences of a given length. Repetitiveness can be measured, for example, by analyzing the frequency of identical sequences.

[0172] A "vector" is a nucleic acid molecule that transfers an inserted nucleic acid molecule into a host cell and / or between host cells, preferably self-replicating in an appropriate host. The term includes vectors that primarily function to insert DNA or RNA into a cell, replication vectors that primarily function to replicate DNA or RNA, and expression vectors that function to transcribe and / or translate DNA or RNA. Vectors that provide more than one of the above functions are also included. An "expression vector" is a polynucleotide that can be transcribed and translated into a polypeptide when introduced into an appropriate host cell. An "expression system" generally implies a suitable host cell containing an expression vector that can function to produce a desired expression product.

[0173] "Resistance to serum degradation" as applied to polypeptides refers to the ability of a polypeptide to resist degradation in blood or its components, which degradation typically involves proteases in serum or plasma. Resistance to serum degradation can be measured by combining the protein with human (or mouse, rat, monkey, as appropriate) serum or plasma, typically at about 37°C, for a range of days (e.g., 0.25, 0.5, 1, 2, 4, 8, 16 days). Samples at these time points can be subjected to Western blot assays and the protein detected with antibodies. The antibodies can be directed against a tag in the protein. If the protein shows a single band on the Western blot (wherein the size of the protein is consistent with the size of the injected protein), then no degradation has occurred. In this exemplary method, the time point at which 50% of the protein is degraded, as judged by Western blot or an equivalent technique, is the serum degradation half-life or "serum half-life" of the protein.

[0174] As used herein, the term " 1 / 2 ” is calculated as ln(2) / K el The terminal half-life of K el The terminal elimination rate constant is calculated by linear regression of the terminal linear portion of the log concentration versus time curve. Half-life is generally defined as the time required for half the amount of an administered substance deposited in a living organism to be metabolized or eliminated by normal biological processes. The term "t 1 / 2 "Terminal half-life", "elimination half-life" and "circulatory half-life" are used interchangeably herein.

[0175] "Active clearance" refers to mechanisms by which proteins are removed from the circulation other than by filtration or aggregation, and includes removal of proteins from the circulation mediated by cells, receptors, metabolism, or degradation.

[0176] "Apparent molecular weight factor" and "apparent molecular weight" are related terms that refer to a measure of the relative increase or decrease in the apparent molecular weight exhibited by a particular amino acid sequence. Apparent molecular weight is determined by comparison with globular protein standards using size exclusion chromatography (SEC) or similar methods and is measured in "apparent kD" units. The apparent molecular weight factor is the ratio between the apparent molecular weight and the actual molecular weight; the latter is predicted by adding the calculated molecular weight of each type of amino acid in the composition based on the amino acid composition or by estimating it based on comparison with molecular weight standards in SDS electrophoresis gels.

[0177] The term "hydrodynamic radius" or "Stokes radius" is the effective radius (R h, in nm), which is measured by assuming that an object passes through a solution and is resisted by the viscosity of the solution. In embodiments of the present invention, the hydrodynamic radius measurements of XTEN fusion proteins are related to the 'apparent molecular weight factor' as a more intuitive measure. The "hydrodynamic radius" of a protein affects its diffusion rate in aqueous solution and its ability to migrate in a gel of macromolecules. The hydrodynamic radius of a protein is measured by its molecular weight and by its structure (including shape and compactness). Methods for measuring the hydrodynamic radius are well known in the art, such as by using size exclusion chromatography (SEC) as described in U.S. Patent Nos. 6,406,632 and 7,294,513. Most proteins have a globular structure, which is the most compact three-dimensional structure that a protein can have with a minimum hydrodynamic radius. Some proteins adopt a random and open unstructured or 'linear' conformation and therefore have a much larger hydrodynamic radius than typical globular proteins with similar molecular weights.

[0178] "Physiological conditions" refers to a set of conditions in a living host as well as in vitro conditions, including temperature, salt concentration, and pH that simulate those of a living subject. Hosts with physiologically relevant conditions for in vitro assays have been established. Typically, physiological buffers contain physiological concentrations of salt and are adjusted to a neutral pH in the range of about 6.5 to about 7.8, and preferably about 7.0 to about 7.5. A variety of physiological buffers are listed in Sambrook et al. (2001). Physiologically relevant temperatures are in the range of about 25°C to about 38°C, and preferably about 35°C to about 37°C.

[0179] A "reactive group" is a chemical structure that can be coupled to a second reactive group. Examples of reactive groups are amino, carboxyl, sulfhydryl, hydroxyl, aldehyde, and azido. Some reactive groups can be activated to facilitate coupling with a second reactive group. Non-limiting examples of activation are the reaction of a carboxyl group with a carbodiimide, the conversion of a carboxyl group to an activated ester, or the conversion of a carboxyl group to an azide functional group.

[0180] "Controlled release agent," "slow release agent," "depot formulation," and "sustained release agent" are used interchangeably to refer to an agent that extends the duration of release of a polypeptide of the invention relative to the duration of release when the polypeptide is administered in the absence of the agent. Different embodiments of the present invention may have different release rates, thereby producing different therapeutic amounts.

[0181] The terms "antigen," "target antigen," and "immunogen" are used interchangeably herein to refer to a structure or binding determinant to which an antibody fragment or antibody fragment-based therapeutic binds or has specificity for.

[0182] As used herein, the term "payload" refers to a protein or peptide sequence with biological or therapeutic activity; i.e., the counterpart of the pharmacophore of a small molecule. Examples of payables include, but are not limited to, coagulation factors, cytokines, enzymes, hormones, and blood and growth factors.

[0183] As used herein, the term "antagonist" includes any molecule that partially or completely blocks, inhibits, or neutralizes a biological activity of a native polypeptide disclosed herein. Methods for identifying antagonists of a polypeptide may comprise contacting the native polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities typically associated with the native polypeptide. In the context of the present invention, antagonists may include proteins, nucleic acids, carbohydrates, antibodies, or any other molecule that reduces the effect of a biologically active protein.

[0184] The term "agonist" is used in a broad sense and includes any molecule that mimics a biological activity of a naturally occurring polypeptide disclosed herein. Suitable agonist molecules specifically include agonist antibodies or antibody fragments, fragments, or amino acid sequence variants of naturally occurring polypeptides, peptides, small organic molecules, and the like. Methods for identifying agonists of naturally occurring polypeptides may comprise contacting the naturally occurring polypeptide with a candidate agonist molecule and measuring a detectable change in one or more biological activities typically associated with the naturally occurring polypeptide.

[0185] As used herein, "treat," "treat," "alleviate," or "ameliorate" are used interchangeably and refer to the administration of a drug or biologic to achieve a therapeutic benefit, curing an existing condition or lessening the severity of an existing condition, or to achieve a prophylactic benefit, preventing or reducing the likelihood of onset of a condition or the severity of a condition if it occurs. By therapeutic benefit, it is meant eradication or amelioration of the underlying condition being treated, or one or more physiological symptoms associated with the underlying condition, such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying condition.

[0186] As used herein, "therapeutic effect" or "therapeutic benefit" refers to the physiological effect produced by the administration of the fusion protein of the present invention, including but not limited to alleviating, ameliorating or preventing a disease in a human or other animal, or otherwise enhancing the physical or mental well-being of a human or animal, rather than being able to induce the production of antibodies against antigenic epitopes possessed by the biologically active protein. For preventive and prophylactic benefit, the composition can be administered to a subject at risk of developing a particular disease, a condition or symptom of the disease (e.g., bleeding in a subject diagnosed with hemophilia A), or to a subject who, although he may not have been diagnosed with the disease, reports one or more physiological symptoms of the disease.

[0187] As used herein, the terms "therapeutically effective amount" and "therapeutically effective dose" refer to an amount of a drug or biologically active protein, alone or as part of a fusion protein composition, that is capable of having any detectable beneficial effect on any symptom, aspect, measured parameter, or characteristic of a disease state or condition when administered to a subject in a single or repeated dose. The effect need not be absolute beneficial. Determining a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0188] As used herein, the term "therapeutically effective dosage regimen" refers to a schedule for the sequential administration of multiple doses (i.e., at least two or more) of a biologically active protein, either alone or as part of a fusion protein composition, wherein the doses are given in therapeutically effective amounts to produce a sustained beneficial effect on any symptom, aspect, measured parameter, or characteristic of a disease state or condition.

[0189] I). General Technology

[0190] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, J. et al., "Molecular Cloning: A Laboratory Manual," 3rd ed., Cold Spring Harbor Laboratory Press, 2001; "Current protocols in molecular biology," FM Ausubel et al., eds., 1987; the series "Methods in Enzymology," Academic Press, San Diego, CA.; "PCR 2: a practical approach," eds. MJ MacPherson, BD Hames and GR Taylor, Oxford University Press, 1995; "Antibodies, a laboratory manual," eds. Harlow, E. and Lane, D., Cold Spring Harbor Laboratory, 1988; "Goodman & Gilman's The Pharmacological Basis of Therapeutics," 11th ed., McGraw-Hill, 2005; and Freshney, RI, "Culture of Animal Cells: A Manual of Basic Technique," 4th ed., John Wiley & Sons, 1996. Wiley & Sons, Somerset, NJ, 2000, the contents of which are incorporated herein by reference in their entirety.

[0191] II). Coagulation Factor VIII

[0192] The present invention relates in part to the compositions comprising the factor VIII thrombin (CF) that is connected to one or more extended recombinant proteins (XTEN), thereby produces the CFXTEN fusion protein compositions.As used herein, " CF " refers to analogies, sequence variants and the truncated form of factor VIII (FVIII) or FVIII, as described below.

[0193] "Factor VIII" or "FVIII" or "FVIII protein" refers to a coagulation factor protein and species thereof (including human, porcine, canine, rat or murine FVIII protein) and sequence variants thereof, including but not limited to a single-chain precursor protein containing 2351 amino acids (with a 19 amino acid hydrophobic signal peptide); a mature factor VIII cofactor protein of approximately 270-330 kDa containing 2332 amino acids, which has the domain structure A1-A2-B-A3-C1-C2; and the non-enzymatically "active" or cofactor form of FVIII (FVIIIa), which is a circulating heterodimer having two chains formed as a result of proteolytic cleavage after R1648, with a heavy chain form (ranging from 90 to 220 kD) consisting primarily of A1-A2-B containing amino acids 1-1648 (numbered relative to the mature FVIII form) and an 80 kDa light chain A3-C1-C2 containing amino acids 1649-2232, each of which is schematically depicted in Figure 1 In addition, and as used herein, the A1, A2, and A3 domains each encompass an acidic spacer region; the a1, a2, and a3 acidic regions, respectively. Thus, it will be understood that a CFXTEN construct described as having the A1, A2, A3, B, C1, and C2 domains includes the a1, a2, and a3 acidic regions. As used herein, "factor VIII" or "FVIII" or "FVIII polypeptide" also includes variant forms, including proteins with substitutions, additions, and / or deletions, as long as the variant retains the desired biological activity, such as procoagulant activity. Tens of thousands of functional FVIII variants have been constructed and can be used as recombinant FVIII proteins as described herein. See PCT Publication Nos. WO 2011 / 069164A2, WO 2012 / 006623A2, WO 2012 / 006635A2, or WO 2012 / 006633A2, all of which are incorporated herein by reference in their entirety. Many functional FVIII variants are known. In addition, hundreds of non-functional mutations in FVIII have been identified in hemophiliacs. See, for example, Cutler et al., Hum. Mutat. 19:274-8 (2002), which is incorporated herein by reference in its entirety. In addition, comparisons between human FVIII and FVIII from other species have identified conserved residues that may be required for function. See, for example, Cameron et al., Thromb. Haemost. 79:317-22 (1998) and US 6,251,632, which are incorporated herein by reference in their entirety.

[0194] In one embodiment, the human Factor VIII domain is defined by the following amino acid residues: A1, residues Ala1-Arg372; A2, residues Ser373-Arg740; B, residues Ser741-Arg1648; A3, residues Ser1649-Asn2019; C1, residues Lys2020-Asn2172; and C2, residues Ser2173-Tyr2332. The A3-C1-C2 sequence includes residues Ser1649-Tyr2332. In another embodiment, residues Arg336-Arg372 are generally referred to as the a1 region, and Arg372 is cleaved by thrombin. In certain embodiments, the a2 region is part of the A1 domain. In another embodiment, residues Glu1649-Arg1689 are referred to as the a3 acidic region. In certain embodiments, the a3 acidic region is part of the A3 domain. In another embodiment, the native FVIII protein has the formula: A1-a1-A2-a2-B-a3-A3-C1-C2, wherein A1, A2, and A3 are structurally related "A domains," B is a "B domain," C1 and C2 are structurally related "C domains," and a1, a2, and a3 are acidic spacer regions. In the preceding formula and with reference to the primary amino acid sequence positions in Figure 30, the A1 domain of human FVIII extends from Ala1 to approximately Arg336, the a1 spacer region extends from approximately Met337 to approximately Arg372, the A2 domain extends from approximately Ser373 to approximately Tyr719, the a2 spacer region extends from approximately Glu720 to approximately Arg740, the B domain extends from approximately Ser741 to approximately Arg1648, the a3 spacer region extends from approximately Glu1649 to approximately Arg1689, the A3 domain extends from approximately Ser1690 to approximately Asn2019, the C1 domain extends from approximately Lys2020 to approximately Asn2172, and the C2 domain extends from approximately Ser2173 to Tyr2332 (Saenko et al., 2005, J Thromb Hemostasis, 1, 922-930). Aside from specific proteolytic cleavage sites, the designation of the positions of boundaries between domains and regions of FVIII may vary in different references. Accordingly, boundaries indicated herein are designated as approximate boundaries by use of the term "about."

[0195] The Factor VIII includes truncated sequences, such as a B domain deleted "BDD" sequence in which a portion or a majority of the B domain sequence is deleted (e.g., the BDD sequences disclosed or referenced in U.S. Patent Nos. 6,818,439 and 7,632,921). An example of a BDDFVIII is or (recombinant BDD FVIII) comprising a first polypeptide corresponding to amino acids 1 to 743 of Figure 30 fused to a second polypeptide corresponding to amino acids 1638 to 2332 of Figure 30. Exemplary BDD FVIII constructs that can be used to produce recombinant proteins of the invention include, but are not limited to, FVIII with a deletion of amino acids corresponding to amino acids 747-1638 of mature human FVIII ( Figure 30 ) (Hoeben RC et al. J. Biol. Chem. 265(13):7318-7323 (1990), which is incorporated herein by reference in its entirety), and FVIII with a deletion of amino acids corresponding to amino acids 771-1666 or amino acids 868-1562 of mature human FVIII ( Figure 30 ) (Meulien P. et al. Protein Eng. 2(4):301-6 (1988), which is incorporated herein by reference in its entirety).

[0196] In addition, sequences including heterologous amino acid insertions or substitutions (such as aspartic acid replacing valine at position 75) or single-chain FVIII (scFVIII) in which the heavy and light chains are covalently linked by a linker are encompassed. As used herein, "FVIII" will be any functional form of the Factor VIII molecule having the typical characteristics of Factor VIII that, when administered to a subject, such as a subject with hemophilia A, is capable of correcting human Factor VIII deficiency. FVIII or sequence variants have been isolated, characterized, and cloned as described in U.S. Patents or Application Nos. 4,757,006; 4,965,199; 5,004,804; 5,198,349; 5,250,421; 5,919,766; 6,228,620; 6,818,439; 7,138,505; 7,632,921; and 20100081615.

[0197] Human factor VIII is encoded by a single copy gene present at the tip of the long arm of chromosome X (q28). It contains approximately 186,000 base pairs (bp) and occupies approximately 0.1% of the X chromosome (White, GC. and Shoemaker, CB, Blood (1989) 73: 1-12). The human FVIII amino acid sequence was deduced from the cDNA as shown in U.S. Patent No. 4,965,199, which is incorporated herein by reference in its entirety. The native mature human FVIII obtained from the cDNA sequence (i.e., without the secretory signal peptide but before other post-translational processing) appears as Figure 3 .

[0198] The DNA encoding mature Factor VIII mRNA is found in 26 individual exons ranging in size from 69 to 3,106 bp. The 25 intervening intronic regions separating the exons range in size from 207 to 32,400 bp. The complete gene consists of approximately 9 kb exons and 177 kb introns. The three repeated A domains share approximately 30% sequence homology. The B domain contains 19 of approximately 25 predicted glycosylation sites, and the A3 domain is believed to contain a binding site for von Willebrand factor. Tandem C domains follow the A3 domains and share approximately 37% homology with each other (White, GC. and Shoemaker, CB, Blood (1989) 73: 1-12).

[0199] In the newly synthesized single-chain precursor molecule, the B domain separates the A2 and A3 domains of native factor FVIII. The exact boundaries of the B domain have been variously reported as extending from amino acid 712 to 1648 of the precursor sequence (Wood et al., Nature (1984) 312: 330-337), or as amino acids 741-1648 (Pipe, SW, Haemophilia (2009) 15: 1187-1196 and U.S. Patent No. 7,560,107), or as amino acids 740-1689 (Toole, JJ. Proc. Natl. Acad. Sci. USA (1986) 83: 5939-5942). As used herein, "B domain" refers to amino acids 741-1648 of mature factor VIII. As used herein, "FVIII B domain deletion" or "FVIII BDD" refers to a FVIII sequence in which any, a fragment, or all of amino acids 741 to 1648 are deleted. In one embodiment, the FVIII BDD variant retains the remaining amino acids of the B domain from the N-terminus (as used herein, "B1") and the C-terminus (as used herein, "B2"). In one FVIII BDD variant, the B domain remaining amino acids are SFSQNPPVLKRHQR (SEQ ID NO: 1614). In one FVIII BDD variant, the B1 remainder is SFS and the B2 remainder is QNPPVLKRHQR (SEQ ID NO: 1615). In another FVIII BDD variant, the B1 remainder is SFSQN (SEQ ID NO: 1616) and the B2 remainder is PPVLKRHQR (SEQ ID NO: 1617). "B domain deleted Factor VIII," "FVIII BDD," or "BDD FVIII" may have complete or partial deletions as disclosed in U.S. Pat. Nos. 6,316,226; 6,346,513; 7,041,635; 5,789,203; 6,060,447; 5,595,886; 6,228,620; 5,972,885; 6,048,720; 5,543,502; 5,610,278; 5,171,844; 5,112,950; 4,868,112; and 6,458,563, each of which is herein incorporated by reference in its entirety. In some embodiments, the B-domain deleted Factor VIII sequence of the invention comprises any of the deletions disclosed at column 4, line 4 to column 5, line 28 and Examples 1-5 of U.S. Pat. No. 6,316,226 (also in U.S. Pat. No. 6,346,513).In another embodiment, the B-domain deleted Factor VIII is an S743 / Q1638 B-domain deleted Factor VIII (SQ form Factor VIII) (e.g., a Factor VIII with a deletion of amino acids 744 to amino acids 1637, e.g., a Factor VIII having amino acids 1-743 and amino acids 1638-2332 of full-length Factor VIII). In some embodiments, the B-domain deleted Factor VIII of the present invention has a deletion disclosed in column 2, lines 26-51 and Examples 5-8 of U.S. Patent No. 5,789,203 (as well as US 6,060,447, US 5,595,886, and US 6,228,620). In some embodiments, the B domain deleted Factor VIII has a deletion as described in U.S. Pat. No. 5,972,885, column 1, line 25 to column 2, line 40; U.S. Pat. No. 6,048,720, column 6, lines 1-22, and Example 1; U.S. Pat. No. 5,543,502, column 2, lines 17-46; U.S. Pat. No. 5,171,844, column 4, line 22 to column 5, line 36; U.S. Pat. No. 5,112,950, column 2, lines 55-68. Figure 2and Example 1; U.S. Patent No. 4,868,112 at column 2, line 2 to column 19, line 21, and Table 2; U.S. Patent No. 7,041,635 at column 2, line 1 to column 3, line 19, column 3, line 40 to column 4, line 67, column 7, line 43 to column 8, line 26, and column 11, line 5 to column 13, line 39; or U.S. Patent No. 6,458,563 at column 4, lines 25-53. In some embodiments, the B-domain-deleted Factor VIII lacks most of the B domain, but still contains the amino-terminal sequence of the B domain necessary for proteolytic processing of the primary translation product into two polypeptide chains in vivo, as disclosed in WO 91 / 09122, which is incorporated herein by reference in its entirety. In some embodiments, a B-domain-deleted Factor VIII is constructed that lacks amino acids 747-1638, i.e., that effectively completely lacks the B domain. Hoeben RC et al. J Biol. Chem. 265(13):7318-7323 (1990), which is incorporated herein by reference in its entirety. The B domain deleted Factor VIII may also contain a deletion of amino acids 771-1666 or amino acids 868-1562 of Factor VIII. Meulien P. et al. Protein Eng. 2(4):301-6 (1988), which is incorporated herein by reference in its entirety. Other B domain deletions that are part of the present invention include: deletion of amino acids 982 to 1562 or 760 to 1639 (Toole et al., Proc. Natl. Acad. Sci. USA (1986) 83, 5939-5942)), 797 to 1562 (Eaton et al., Biochemistry (1986) 25:8343-8347)), 741 to 1646 (Kaufman (PCT Published Application No. WO 87 / 04187)), 747-1560 (Sarver et al., DNA (1987) 6:553-564), 741 to 1648 (Pasek (PCT Application No. 88 / 00831)), or 816 to 1598 or 741 to 1648 (Lagner (Behring Inst. Mitt. (1988) 82:16-25; EP 5477785)). 295597)), each of which is incorporated herein by reference in its entirety. Each of the foregoing deletions can be made in any Factor VIII sequence utilized in embodiments of the present invention.

[0200] The proteins involved in coagulation include Factor I, Factor II, Factor III, Factor IV, Factor V, Factor VI, Factor VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, Protein C, and Tissue Factor (collectively or individually "coagulation proteins"). The interactions of the major coagulation proteins in the intrinsic and extrinsic coagulation pathways are shown in Figure 2 In. Most coagulation proteins exist in zymogen form, but when activated, they exhibit procoagulant protease activity, wherein they activate another coagulation protein, thus contributing to intrinsic or exogenous coagulation path and clot formation. In the intrinsic coagulation cascade pathway, FVIII associates with the complex of activated factors IX, factor X, calcium and phospholipid. Factor VIII heterodimer does not have enzymatic activity, but after being activated by thrombin or factor Xa proteolytic enzymes, heterodimer becomes active as the cofactor of enzyme factor IXa, wherein the activity of factor VIIIa is characterized in that it can form factors IXa and X in a membrane binding site suitable for the conformation of activated factor X by factors IXa. After being cleaved by thrombin, activated FVIII (FVIIIa) dissociates from von Willebrand factor and combines negatively charged phospholipid PL, and the resulting complex participates in factor X activation (factor X enzyme (tenase)) complex as the cofactor of factors IXa. Within the C2 domain and amino acid residues 1649 to 1689 in the A3 domain is the von Willebrand factor (vWF) binding site, which is used to complex with von Willebrand factor. The resulting circulating complex protects FVIII from rapid degradation in the blood (Weiss HJ et al. Stabilization of factor VIII in plasma by the von Willebrand factor. Studies on posttransfusion and dissociated factor VIII and in patients with von Willebran d's disease. J Clin Invest (1977) 60: 390).

[0201] Activated factor VIII is a heterotrimer comprising the A1 and A2 domains and a light chain comprising the domains A3-C1-C2. Activation of factor IX is achieved by removing the activation peptide (Ala 146-Arg 180) from the molecule in two steps (Bajaj et al., Human factor IX and factor IXa, METHODS IN ENZYMOLOGY. 1993). The first cleavage is performed by factor XIa or factor VIIa / tissue factor at the Arg 145-Ala 146 site. The second and rate-limiting cleavage is performed at Arg 180-Val 181. Activation removes 35 residues. Activated human factor IX exists as a heterodimer of a C-terminal heavy chain (28 kDa) and an N-terminal light chain (18 kDa) held together by a disulfide bridge that connects the enzyme to the Gla domain. Factor IXa, in turn, works in conjunction with activated factor VIII to activate factor X. Alternatively, factors IX and X can both be activated by factor VIIa produced by the extrinsic pathway in complex with lipidated tissue factor. Factor Xa then participates in the final common pathway by which prothrombin is converted to thrombin, which in turn converts fibrinogen to fibrin to form a clot.

[0202] Defects in the coagulation process can lead to bleeding disorders (coagulopathy) in which the time spent on clot formation is prolonged. The defects can be congenital or acquired. For example, hemophilia A and hemophilia B are genetic diseases characterized by the lack of FVIII and FIX, respectively. In other words, bioactive factor VIII corrects the coagulation defects in the plasma of individuals suffering from hemophilia A. Recombinant FVIII has been shown to be effective and approved for the treatment of hemophilia A in adult patients and pediatric patients, and is also used to stop bleeding episodes or prevent bleeding associated with trauma and / or surgery. The current therapeutic use of factor VIII can be problematic in treating individuals who exhibit factor VIII deficiency and those who suffer from von Willebrand's disease. In addition, individuals who receive factor VIII with supplemental therapy often produce antibodies that often reduce or eliminate the procoagulant activity of the combined FVIII for these proteins. Due to the presence of these antibodies that reduce or eliminate therapeutic efficacy, continuous treatment is extremely difficult.

[0203] On the one hand, the present invention encompasses FVIII sequences consistent with human FVIII, sequences with homology to the FVIII sequence, native sequences (e.g., from humans, non-human primates, mammals (including domesticated animals)), or truncated forms of FVIII in CFXTEN fusion protein compositions; which all retain at least a portion of the procoagulant activity of native FVIII and are applicable to preventing, treating, mediating, or improving hemophilia A or hemorrhagic episodes associated with trauma, surgery, or the lack of factor VIII. Sequences with homology to FVIII can be obtained by standard homology search techniques (e.g., NCBI BLAST) or in open databases, such as Chemical Abstracts Services Database (CAS registration), GenBank, Universal Protein Resource (UniProt), and subscription-based databases, such as GenSeq (e.g., Derwent).

[0204] In one embodiment, the FVIII incorporated into the subject CFXTEN compositions is a recombinant polypeptide having a sequence corresponding to a FVIII protein found in nature. In another embodiment, FVIII is a non-natural FVIII sequence variant, fragment, homologue or analogue of at least a portion of the procoagulant activity of the corresponding native FVIII that retains the native sequence. In another embodiment, FVIII is a truncated variant ("FVIII BDD") of all or a portion of the B domain deletions, which can be in a heterodimeric form or can remain as a single chain ("scFVIII"), which is described in Meulien et al., Protein Eng. (1988) 2 (4): 301-306. Non-limiting examples of FVIII BDDs are Factor VIII sequences with amino acids deleted between residue number 741 and residue number 1640 (numbered relative to native mature FVIII), or between residue number 745 and residue number 1640, or between residue number 745 and residue number 1640, or between residue number 741 and residue number 1690, or between residue number 745 and residue number 1667, or between residue number 745 and residue number 1657, or between residue number 747 and residue number 1642, or between residue number 751 and residue number 1667.

[0205] In another embodiment, a heterologous sequence is incorporated into the FVIII, which heterologous sequence may comprise an XTEN as described more fully below. Table 1 provides a non-limiting list of amino acid sequences of the FVIII encompassed by the CFXTEN fusion proteins of the present invention. In some embodiments, the FVIII incorporated into the CFXTEN fusion proteins comprises a protein having at least about 70% sequence identity, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to an amino acid sequence with similar length selected from Table 1.

[0206] Table 1: FVIII amino acid sequence

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] The present invention also encompasses the CFXTEN comprising the FVIII of the retention procoagulant activity of the various amino acid deletions, insertions and replacements carried out in the FVIII sequence of Table 1. The example of amino acid whose conservative substitutions in the polypeptide sequence is shown in Table 2. Compared to particular sequences disclosed herein, the sequence identity of FVIII is less than in the embodiment of 100% CFXTEN, the present invention encompasses replacing the given amino acid residue at any position in the FVIII sequence of given FVIII with any of other 19 kinds of natural L-amino acids, including adjacent amino acid residues. If any replacement causes procoagulant activity to change undesirably, a kind of alternative amino acid can be adopted so and by method as described herein (e.g., mensuration of Table 49), or using any technique and the guidelines for conservative and non-conservative mutations set forth in, for example, U.S. Patent number 5,364,934 (its contents are incorporated herein by reference in their entirety); Or use methods generally known in the art to assess construct proteins. In a preferred replacement, the FVIII component of the CFXTEN embodiment is modified to prevent the proteolytic processing of the heterodimer form by replacing the R1648 residue (numbering relative to the FVIII of natural mature form) with glycine or alanine. In another replacement, the FVIII component of the CFXTEN embodiment is modified by replacing the Y1680 residue (numbering relative to the FVIII of natural mature form) with phenylalanine. In another embodiment, the FVIII component of the CFXTEN embodiment is modified by replacing the Y1680 residue (numbering relative to the FVIII of natural mature form) with phenylalanine and replacing the R1648 residue (numbering relative to the FVIII of natural mature form) with glycine or alanine.

[0219] In one embodiment, the FVIII of the fusion protein composition has one or more amino acid substitutions designed to reduce the binding of a FVIII inhibitor at an epitope recognized by an antibody of Table 9, including but not limited to substitutions at: Lys(377), Lys(466), Lys(380), Ser(488), Arg(489), Arg(490), Leu(491), Lys(493), Lys(496), His(497), Lys(499), Lys(512), Lys(523), Lys(556), Met(2199), Phe(2200), Leu(2252), Val(2223), and Lys(2227). In addition, variants may include, for example, polypeptides in which one or more amino acid residues are added or deleted at or near the N-terminus or C-terminus of the full-length native amino acid sequence or domain of FVIII, as long as the variant retains some, if not all, of the procoagulant activity of the native peptide. The resulting FVIII sequences that retain at least a portion (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or at least 95% or more) of the procoagulant activity compared to native circulating FVIII are considered suitable for use in the fusion protein compositions of the present invention. Examples of FVIII variants are known in the art and include those described in U.S. Patents and Application Nos. 6,316,226; 6,818,439; 7,632,921; 20080227691, which are incorporated herein by reference. In one embodiment, the FVIII sequence variant has an aspartic acid substituted for a valine at amino acid position 75 (numbered relative to the native mature form of FVIII).

[0220] Table 2: Exemplary conservative amino acid substitutions

[0221] Original residue Exemplary Substitutions Ala(A) val;leu;ile Arg(R) lys;gln;asn Asn(N) gin;his;lys;arg Asp(D) Glu Cys(C) Ser Gln(Q) Asn Glu(E) Asp Gly(G) Pro His(H) asn:gin:lys:arg Ile(I) leu; val; met; ala; phe: norleucine Leu(L) Norleucine:ile:val;met;ala:phe Lys(K) arg:gin:asn Met(M) leu; phe; ile Phe(F) leu:val:ile;ala Pro(P) Gly Ser(S) Thr Thr(T) Ser Trp(W) Tyr Tyr(、Y、) Trp:phe:thr:ser Val(V) Ile; leu; met; phe; ala; norleucine

[0222] III). Extending the recombinant polypeptide

[0223] On the one hand, the present invention provides applicable effects to be connected to FVIII polypeptide and / or be incorporated in FVIII polypeptide, thereby produce the XTEN polypeptide compositions of the fusion protein partner (partner) of CFXTEN fusion rotein.XTEN normally has the polypeptide of non-naturally occurring non-repetitive sequence roughly, and described sequence has low degree or does not have secondary or tertiary structure under physiological condition.XTEN usually has approximately 36 to approximately 3000 amino acids, and wherein most or all are small hydrophilic amino acids. As used herein, "XTEN" clearly excludes complete antibodies or antibody fragments (such as single-chain antibodies and Fc fragments).XTEN polypeptides have the effectiveness as fusion protein partner, because they play various effects when being connected to FVIII albumen to produce CFXTEN fusion rotein, thereby give some desirable pharmacokinetics, physicochemistry, pharmacology and medical properties. Said CFXTEN fusion protein compositions has the character of enhancing compared to the corresponding FVIII that is not connected to XTEN, thereby makes them applicable to treat certain symptom relevant to FVIII deficiency or bleeding disorder as described more fully below.

[0224] The selection criteria for XTEN to be fused to the FVIII protein used to produce the fusion protein compositions of the present invention generally involve the attributes of the XTEN's physical / chemical properties and conformational structure, which in turn is used to impart enhanced pharmaceutical, pharmacological, and pharmacokinetic properties to the FVIII fusion protein compositions. The unstructured characteristics and physical / chemical properties of XTEN are due, in part, to an overall amino acid composition that is disproportionately limited to 4-6 hydrophilic amino acids, the linkage of amino acids in a quantitatively non-repetitive design, and the length of the XTEN polypeptide. In an advantageous feature shared by XTEN but not by polypeptides, the properties of the XTEN disclosed herein are independent of the absolute primary amino acid sequence, as demonstrated by the diversity of the exemplary sequences in Table 4, with similar properties across a range of lengths, many of which are described in the Examples. The XTEN of the present invention may exhibit one or more or all of the following advantageous properties: an unstructured conformation, conformational flexibility, enhanced water solubility, high protease resistance, low immunogenicity, low binding to mammalian receptors, a defined charge, and an increased hydrodynamic (or Stokes) radius; properties that make them particularly suitable as fusion protein partners. Compared to the FVIII that is not connected to XTEN, the limiting examples of the property of the enhancement that XTEN gives the fusion rotein that comprises the FVIII that is fused to XTEN comprises that overall solubility and / or metabolic stability increase, susceptibility to proteolysis is reduced, immunogenicity reduces, when subcutaneous or intramuscular administration, absorption rate reduces, with the combination of FVIII clearance receptors reduces, with the reactivity of anti-payload antibody reduces, with the interaction enhancement of substrate and / or when using to experimenter, pharmacokinetic properties strengthen.Compared to the FVIII that is not connected to XTEN, the pharmacokinetic properties of the enhancement of CFXTEN compositions comprises that terminal half-life is longer (for example, 2 times, 3 times, 4 times or longer), area under the curve (AUC) increases (for example, 25%, 50%, 100% or larger), volume of distribution is lower and after subcutaneous or intramuscular injection, absorption enhances (this is an advantage compared to the commercially available FVIII form that must be administered intravenously). In addition, it is believed that the CFXTEN compositions comprising cleavage sequences (described more fully below) allows sustained release bioactive FVIII, so that the CFXTEN used serves as storage tank (depot). Clearly encompassed is that the CFXTEN fusion rotein of the present invention can show one or more or any combination of improved properties disclosed herein. Because these properties strengthen, it is believed that when using under similar dosage, the CFXTEN compositions allows with less frequent administration compared to the FVIII that is not connected to XTEN. Said CFXTEN fusion protein compositions has the effectiveness of treating some Factor VIII related symptom as described herein.

[0225] The multiple methods and the mensuration of the physics / chemical properties of the protein of the CFXTEN compsn that is known in the art for measuring as comprising XTEN.Said property includes but is not limited to secondary or tertiary structure, solubility, protein aggregation, stability, absolute and apparent molecular weight, purity and homogeneity, melting property, pollution and water content.Comprise analytical centrifugation, EPR, HPLC-ion exchange, HPLC-size exclusion, reversed-phase HPLC, light scattering, capillary electrophoresis, circular dichroism, differential scanning calorimetry, fluorescence, HPLC-ion exchange, HPLC-size exclusion, IR, NMR, Raman (Raman) spectroscopy, refractometry and UV / visible spectroscopy in order to the method for measuring these properties.Other methods are disclosed in Arnau etc., Prot Expr and Purif (2006) 48, among the 1-13.

[0226] The XTEN component of CFXTEN is designed to act as a denatured peptide sequence under physiological conditions, regardless of the extended length of the polymer. "Denatured" describes a state in which the peptide backbone has a large degree of conformational freedom in solution. Most peptides and proteins adopt a denatured conformation in the presence of high concentrations of denaturants or at high temperatures. Peptides in a denatured conformation have, for example, characteristic circular dichroism (CD) spectra and are characterized by a lack of long-range interactions, as determined by NMR. "Denatured conformation" and "unstructured conformation" are used synonymously in this article. In some embodiments, the invention provides XTEN sequences that primarily lack secondary structure under physiological conditions. In other cases, the XTEN sequence generally lacks secondary structure under physiological conditions so that the XTEN can adopt a random coil conformation. "Mainly lacking," as used in this context, refers to at least 50% of the XTEN amino acid residues of the XTEN sequence that do not contribute to secondary structure, as measured or determined by means described herein. As used in this context, "substantially lacking" means that at least about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or at least about 99% of the XTEN amino acid residues of the XTEN sequence do not contribute to secondary structure as measured or determined by the methods described herein.

[0227] A variety of methods are established in the art to discern the presence or absence of secondary and tertiary structure in a given polypeptide. Specifically, secondary structure can be measured spectrophotometrically, for example, by circular dichroism spectroscopy in the "far ultraviolet" spectral region (190-250 nm). Secondary structural elements such as α-helices and β-sheets each produce a characteristic shape and amplitude of the CD spectrum, as does the absence of these structural elements. The secondary structure of a polypeptide sequence can also be predicted by certain computer programs or algorithms, such as the well-known Chou-Fasman algorithm (Chou, PY et al. (1974) Biochemistry, 13: 222-45) and the Garnier-Osguthorpe-Robson ("GOR") algorithm (Garnier J, Gibrat JF, Robson B. (1996), GOR method for predicting protein secondary structure from amino acid sequence. Methods Enzymol 266: 540-553), as described in U.S. Patent Application Publication No. 20030228309A1. For a given sequence, the algorithm can predict whether there is some or no secondary structure, expressed as the total number of residues and / or the percentage of residues in the sequence that form, for example, alpha helices or beta sheets, or the percentage of residues in the sequence that are predicted to form random coils (which lack secondary structure).

[0228] In one embodiment, the XTEN sequences used in the subject fusion protein compositions have an alpha helix percentage in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In another embodiment, the XTEN sequences of the fusion protein compositions have a beta sheet percentage in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In some embodiments, the XTEN sequences of the fusion protein compositions have an alpha helix percentage in the range of 0% to less than about 5% and a beta sheet percentage in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In some embodiments, the XTEN sequences of the fusion protein compositions have an alpha helix percentage of less than about 2% and a beta sheet percentage of less than about 2%. The XTEN sequences of the fusion protein compositions have a high random coil percentage, as determined by the GOR algorithm. In some embodiments, the XTEN sequence has at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and most preferably at least about 99% random coil, as determined by the GOR algorithm. In some embodiments, the XTEN sequence of the fusion protein composition has an alpha helix percentage ranging from 0% to less than about 5% and a beta sheet percentage ranging from 0% to less than about 5%, as determined by the Chou-Fasman algorithm, and has at least about 90% random coil, as determined by the GOR algorithm. In other embodiments, the XTEN sequence of the fusion protein composition has an alpha helix percentage of less than about 2% and a beta sheet percentage of less than about 2%, and at least about 90% random coil, as determined by the GOR algorithm.

[0229] 1. Non-repetitive sequences

[0230] The XTEN sequence of intention CFXTEN embodiment is roughly non-repetitive.In general, the repetitive amino acid sequence has the tendency of gathering or forming higher structure, as illustrated by natural repetitive sequence (such as collagen and leucine zipper).These repetitive amino acids also can tend to form contact, thereby produce crystallization or pseudocrystalline structure.On the contrary, the gathering tendency of non-repetitive sequence is lower and makes it possible to design the relatively low long sequence XTEN of charged amino acid whose frequency, if sequence is repetitive, so said long sequence XTEN will possibly gather in addition.The non-repetitiveness of theme XTEN can be observed by assessing one or more following characteristics. In one embodiment, a "substantially non-repetitive" XTEN sequence has about 36, or at least 72, or at least 96, or at least 144, or at least 288, or at least 400, or at least 500, or at least 600, or at least 700, or at least 800, or at least 864, or at least 900, or at least 1000, or at least 2000 to about 3000 or more amino acid residues, or has a length ranging from about 36 to about 3000, about 100 to about 500, about 500 to about 1000, about 1000 to about 3000 amino acids and residues, wherein no three consecutive amino acids in the sequence are the same amino acid type, unless the amino acid is serine, in which case no more than three consecutive amino acids are serine residues. In another embodiment, as described more fully below, a "substantially non-repetitive" XTEN sequence comprises a motif of 9 to 14 amino acid residues, wherein the motif consists of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any one motif is not repeated more than twice in the sequence motif.

[0231] The degree of repetitiveness of a polypeptide or gene can be measured by a computer program or algorithm or by other means known in the art. According to the present invention, an algorithm for calculating the degree of repetitiveness of a particular polypeptide such as XTEN is disclosed herein, and examples of sequences analyzed by the algorithm are provided (see the Examples below). In one aspect, the repetitiveness of a polypeptide of a predetermined length can be calculated according to the formula given by Equation 1 (hereinafter referred to as "subsequence score"):

[0232] Subsequence Scoring

[0233] Where: m = (amino acid length of polypeptide) - (amino acid length of subsequence) + 1; and count i =Sequence i The cumulative number of occurrences of each unique subsequence in

[0234] An algorithm termed "SegScore" was developed to quantify the repetitiveness of polypeptides such as XTEN using the aforementioned equation, thereby providing a subsequence score, wherein the repetitiveness of a sequence of a predetermined amino acid length "n" is analyzed by determining the number of times a unique subsequence of length "s" occurs within the set length (the "count"), divided by the absolute number of subsequences within the predetermined length of the sequence. Figure 27 Describes the logical flow chart of the SegScore algorithm, and Figure 28 Schematic diagram depicting how to obtain a subsequence score for a hypothetical XTEN having 11 amino acids and a subsequence length of 3 amino acid residues. For example, a predetermined polypeptide length of 200 amino acid residues has 192 overlapping 9-amino acid subsequences and 198 3-mer subsequences, but the subsequence score for any given polypeptide will depend on the absolute number of unique subsequences and the frequency with which each unique subsequence (referring to a different amino acid sequence) occurs within the predetermined length of the sequence.

[0235] In the context of the present invention, "subsequence score" refers to that each unique 3-mer frame spans the total number of occurrences of 200 continuous amino acids of the cumulative XTEN polypeptide divided by the absolute number of unique 3-mer subsequences in the sequence containing 200 amino acids. Examples of the subsequence scores obtained by repeating and non-repeating polypeptides are presented in Example 45. In one embodiment, the invention provides a CFXTEN that comprises an XTEN, wherein the subsequence score of the XTEN is less than 12, more preferably less than 10, more preferably less than 9, more preferably less than 8, more preferably less than 7, more preferably less than 6 and most preferably less than 5. In another embodiment, the invention provides the CFXTEN that comprises at least two to about six XTEN, wherein the subsequence score of 200 amino acids of XTEN is less than 10, more preferably less than 9, more preferably less than 8, more preferably less than 7, more preferably less than 6 and most preferably less than 5. In the embodiment of the CFXTEN fusion protein compositions as herein described, the XTEN component with a subsequence score of 10 or lower (i.e., 9,8,7, etc.) of the fusion protein is also generally non-repetitive.

[0236] It is believed that the non-repetitive characteristics of XTEN of the present invention together with the amino acid of the particular type that prevails in XTEN rather than absolute primary sequence give many enhancing physicochemical and biological properties of CFXTEN fusion rotein.The character of these enhancements comprises that gained CFXTEN is compared to the fusion rotein that comprises the polypeptide with tumor-necrosis factor-α-glycoprotein, and the genetic stability of the gene of the expression level of fusion rotein in host cell is higher, encoding XTEN is bigger, solubility is bigger, aggregation tendency is less and pharmacokinetics strengthens.The character of these enhancements allows more efficient manufacturing, reduces commodity cost, and helps to prepare the pharmaceutical preparation that contains the high protein concentration (surpassing 100mg / ml in some cases) of XTEN.In addition, the XTEN peptide sequence of each embodiment is designed to have low degree internal repeatability to reduce or eliminate the immunogenicity when using to mammals roughly.When using to mammals, can produce relatively high antibody titer by the peptide sequence that mainly is limited to only three amino acid whose short repeat motif composition (as glycine, serine and glutamic acid), although in these sequences, there is not prediction t cell epitope. This may be due to the repetitive nature of the polypeptide, as immunogens with repetitive epitopes (including protein aggregates, cross-linked immunogens, and repetitive carbohydrates) have been shown to be highly immunogenic and can, for example, lead to cross-linking of B cell receptors, thereby leading to B cell activation. (Johansson, J. et al. (2007) Vaccine, 25: 1676-82; Yankai, Z. et al. (2006) Biochem Biophys Res Commun, 345: 1365-71; Hsu, CT et al. (2000) Cancer Res, 60: 3701-5); Bachmann MF et al. Eur J Immunol. (1995) 25(12): 3445-3451).

[0237] 2. Exemplary sequence motifs

[0238] The present invention encompasses XTEN that comprises multiple shorter sequence units or motifs as fusion partners, wherein the amino acid sequence of the motif is non-repetitive. Although using a library utilizing multimerization sequence motifs to carry out a "building block" method to produce the XTEN sequence, the non-repetitive nature is met. Therefore, although the XTEN sequence can be made up of a plurality of units as few as four different types of sequence motifs, because the motif itself is usually made up of non-repetitive amino acid sequence, overall XTEN sequence is designed to cause the sequence to be non-repetitive roughly.

[0239] In one embodiment, the XTEN has a substantially non-repetitive sequence containing greater than about 36 to about 3000, or about 100 to about 2000, or about 144 to about 1000 amino acid residues, or even longer, wherein at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 97%, or about 100% of the XTEN sequence consists of non-overlapping sequence motifs, and wherein each of the motifs has about 9 to 36 amino acid residues. In other embodiments, at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 97%, or about 100% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 9 to 14 amino acid residues. In other embodiments, at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 97% or about 100% of the XTEN sequence is made up of non-overlapping sequence motifs, wherein the motifs each have 12 amino acid residues. In these embodiments, it is preferred that the sequence motifs are made up of roughly (for example, 90% or more than 90%) or only little hydrophilic amino acids so that the overall sequence has unstructured flexibility characteristics. The amino acid whose example included in the XTEN is for example arginine, lysine, threonine, alanine, asparagine, glutamine, aspartic acid, glutamic acid, serine and glycine. Due to testing variables such as codon optimization, assembly of polynucleotide coding sequence motifs, expression of proteins, charge distribution and solubility of expressed proteins, and secondary and tertiary structure, it was found that the XTEN compositions with enhanced characteristics disclosed herein include primarily or exclusively glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P) residues, wherein the sequences are designed to be substantially non-repetitive. In one embodiment, the XTEN sequence has primarily four to six types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), or proline (P), arranged in a substantially non-repetitive sequence of greater than about 36 to about 3000, or about 100 to about 2000, or about 144 to about 1000 amino acid residues in length. In some embodiments, the XTEN sequence is composed of 4, 5, or 6 types of amino acids selected from the group consisting of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), or proline (P).In some embodiments, the XTEN has a sequence of greater than about 36 to about 1000, or about 100 to about 2000, or about 400 to about 3000 amino acid residues, wherein at least about 80% of the sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 9 to 36 amino acid residues and wherein at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or 100% of each of the motifs consists of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 30%. In other embodiments, at least about 90% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 9 to 36 amino acid residues, wherein the motifs consist of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 40%, or about 30%, or 25%, or about 17%. In other embodiments, at least about 90% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 12 amino acid residues consisting of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 40%, or 30%, or about 25%. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 12 amino acid residues consisting of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P).

[0240] In other embodiments, the XTEN comprises a substantially non-repetitive sequence of greater than about 36 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the sequence consists of non-overlapping sequence motifs of 9 to 14 amino acid residues, wherein the motifs consist of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any one motif is not repeated more than twice in the sequence motif. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the XTEN sequence consists of non-overlapping sequence motifs of 12 amino acid residues, wherein the motifs consist of four to six types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any one sequence motif is not repeated more than twice in the sequence motif. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the XTEN sequence consists of non-overlapping sequence motifs of 12 amino acid residues, wherein the motifs consist of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any sequence motif is not repeated more than twice in the sequence motif. In other embodiments, the XTEN consists of sequence motifs of 12 amino acids, wherein the amino acids are selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any sequence motif is not repeated more than twice in the sequence motif, and wherein the content of any one amino acid type in the full-length XTEN does not exceed 30%. The foregoing embodiments are examples of substantially non-repetitive XTEN sequences. Other examples are described in detail below.

[0241] In some embodiments, the invention provides CFXTEN compositions comprising one, or two, or three, or four, five, six or more non-repetitive XTEN sequences having about 36 to about 1000 amino acid residues, or cumulatively having about 100 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the sequences consist of multiple units of four or more non-overlapping sequence motifs of the amino acid sequences selected from Table 3, wherein the overall sequence remains substantially non-repetitive. In some embodiments, the XTEN comprises non-overlapping sequence motifs wherein about 80%, or at least about 85%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 100% of the sequence consists of multiple units of non-overlapping sequence selected from a single motif family (thereby generating a family sequence) selected from Table 3. As used herein, "family" refers to the XTEN having motifs selected from only a single motif species from Table 3 (i.e., AD, AE, AF, AG, AM, AQ, BC, or BD XTEN), and any other amino acids in the XTEN that are not from the family motifs are selected to achieve a desired property, such as allowing incorporation of restriction sites by the encoding nucleotides, incorporation of a cleavage sequence, or achieving better linkage to the FVIII coagulation factor component of the CFXTEN. In some embodiments of the XTEN family, the XTEN sequence comprises multiple units of non-overlapping sequence motifs of the AD motif family or the AE motif family or the AF motif family or the AG motif family or the AM motif family or the AQ motif family or the BC family or the BD family, so that the resulting XTEN exhibits the above-mentioned range of homology. In other embodiments, the XTEN comprises multiple units of motif sequences from two or more motif families of Table 3. These sequences can be selected to achieve the desired physical / chemical characteristics conferred by the amino acid composition of the motifs described more fully below, including properties such as net charge, hydrophilicity, lack of secondary structure, or lack of reproducibility. In the embodiments described above in this paragraph, the motifs incorporated into the XTEN can be selected and assembled using the methods described herein to obtain XTEN of about 36 to about 3000 amino acid residues.

[0242] Table 3: XTEN sequence motifs and motif families with 12 amino acids

[0243]

[0244]

[0245] *Indicates individual motif sequences that, when used together in various permutations, produce a "family sequence"

[0246] In some embodiments of the XTEN family, the XTEN sequence comprises a plurality of units of the non-overlapping sequence motifs of AD motif family, AE motif family or AF motif family or AG motif family or AM motif family or AQ motif family or BC family or BD family, thereby the gained XTEN demonstrates above-mentioned homology scope.In other embodiments, XTEN comprises a plurality of units of the motif sequence from two or more motif families of table 3 that are selected to realize the required physicochemical characteristics that can be given by the amino acid composition of the following more fully described motif, and said feature comprises as net charge, lacks secondary structure or lacks repeatability character.Above in the embodiment described in this paragraph, can use method as herein described to select and assemble the motif that is incorporated among the XTEN or each part of motif to obtain about 36, about 42, about 72, about 144, about 288, about 576, about 864, about 1000, about 2000 to about 3000 amino acid residues or the XTEN of any intermediate length.The limiting examples that are applicable to be incorporated among the theme CFXTEN XTEN family sequence are presented in table 4. Reference to a specified sequence in connection with Table 4 is intended to have that sequence set forth in Table 4, while general reference to, for example, the AE144 sequence is intended to encompass any AE sequence having 144 amino acid residues; e.g., AE144_1A, AE144_2A, etc., or general reference to, for example, the AG144 sequence is intended to encompass any AG sequence having 144 amino acid residues, e.g., AG144_1, AG144_2, AG144_A, AG144_B, AG144_C, etc.

[0247] Table 4: XTEN polypeptides

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267] In other embodiments, the CFXTEN composition comprises one or more non-repetitive XTEN sequences ranging in length from about 36 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the sequence consists of non-overlapping 36 amino acid sequence motifs selected from one or more polypeptide sequences of Tables 13-17, in the form of family sequences, or wherein the motifs are selected from two or more motif families.

[0268] In those embodiments in which less than 100% of the amino acids of the XTEN component of the CFXTEN fusion protein consist of 4, 5, or 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), or less than 100% of the sequence consists of sequence motifs from Table 3 or the XTEN sequences of Tables 4 and 13-17, the other amino acid residues of the XTEN are selected from any of the other 14 natural L-amino acids, but are preferably selected from hydrophilic amino acids so that the XTEN sequence contains at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% hydrophilic amino acids. The XTEN amino acid that is not glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) is dispersed in the whole XTEN sequence, is positioned at or between sequence motif, or concentrates in one or more short chain segments of XTEN sequence, for example to produce joint between XTEN component and FVIII component.In the described situation that the XTEN component of CFXTEN comprises amino acid except glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P), preferably be less than about 2% or be less than about 1% amino acid hydrophobic residue so that gained sequence lacks secondary structure usually, for example, do not have more than 2% alpha spiral or 2% beta sheet, as determined by method disclosed herein.The less hydrophobic residue of favourability comprises tryptophan, phenylalanine, tyrosine, leucine, isoleucine, valine and methionine when making up XTEN. In addition, can design XTEN sequence to contain less than 5% or less than 4% or less than 3% or less than 2% or less than 1% or do not contain following amino acid: cysteine ​​(to avoid forming disulfide and oxidation), methionine (to avoid oxidation), asparagine and glutamine (to avoid deamidation).Therefore, in some embodiments, the CFXTEN fusion rotein except glycine (G), alanine (A), serine (S), threonine (T), glutamic acid (E) and proline (P) also comprises other amino acid whose XTEN component has the sequence that the residue that facilitates alpha spiral and beta sheet is less than 5% (as measured by Chou-Fasman algorithm) and has at least 90% or at least about 95% or 95% above random coil formation rate (as measured by GOR algorithm).

[0269] 3. The length of the sequence

[0270] On the other hand, the present invention provides the XTEN with different lengths that is used to be incorporated into the CFXTEN compsn, wherein based on the character for the treatment of realizing in fusion rotein or the length of function selection XTEN sequence.Decide on predetermined property or function, the CFXTEN compsn comprises the short length or medium length XTEN that is positioned at FVIII sequence inside or between the FVIII structural domain and / or is positioned at the longer XTEN sequence that can serve as carrier in the fusion rotein as described herein.Although not intended to have restrictive, the fragment of XTEN or XTEN comprises the short segment with approximately 6 to approximately 99 amino-acid residues, the medium length of approximately 100 to approximately 399 amino-acid residues and approximately 400 to approximately 1000 and up to the longer length of approximately 3000 amino-acid residues. Thus, the XTEN for incorporation into the subject CFXTEN encompasses XTEN or fragments of XTEN that are about 6, or about 12, or about 36, or about 40, or about 42, or about 72, or about 96, or about 144, or about 288, or about 400, or about 500, or about 576, or about 600, or about 700, or about 800, or about 864, or about 900, or about 1000, or about 1500, or about 2000, or about 2500, or up to about 3000 amino acid residues in length. In one embodiment, the length of the XTEN sequence can be approximately 6 to approximately 50, approximately 50 to approximately 100, approximately 100 to 150, approximately 150 to 250, approximately 250 to 400, approximately 400 to approximately 500, approximately 500 to approximately 900, approximately 900 to 1500, approximately 1500 to 2000 or approximately 2000 to approximately 3000 amino acid residues.The accurate length of the XTEN that is incorporated into the theme CFXTEN can change and not adversely affect the activity of the CFXTEN compsn.In one embodiment, the length that is used for the one or more XTEN among the CFXTEN disclosed herein is 36 amino acid, 42 amino acid, 144 amino acid, 288 amino acid, 576 amino acid or 864 amino acid and can be selected from an XTEN family sequence; In another embodiment, the length of two or more XTEN used in the CFXTEN disclosed herein is 36 amino acid, 42 amino acid, 144 amino acid, 288 amino acid, 576 amino acid or 864 amino acid and can be selected from two XTEN family sequences; i.e. AD, AE, AF, AG, AM, AQ, BC or BD, wherein the combination of AE and AG family sequences is preferred. In some embodiments, the CFXTEN comprising one or more XTEN used herein contains an XTEN selected from the arbitrary sequence in Table 4, which can be directly or by a spacer sequence disclosed herein connected to the FVIII component.

[0271] In some embodiments, the XTEN acts as a flexible linker, or is inserted into external loops or disordered regions of the FVIII sequence to increase the volume, flexibility, or hydrophilicity of the region, or is designed to interfere with the clearance receptors of FVIII to enhance pharmacokinetic properties, or interferes with the binding of FVIII inhibitors or other anti-FVIII antibodies, or wherein short or medium length XTEN is used to promote tissue penetration or alter the intensity of the interaction of the CFXTEN fusion protein with its target, or wherein it is desirable to distribute the cumulative length of the XTEN in segments of short or medium length at multiple positions within the FVIII sequence in a specific CFXTEN configuration design, the invention encompasses one, two, three, four, five or more short or medium XTEN sequences inserted between or within one or more FVIII domains or within external loops, or at other sites in the FVIII sequence, such as, but not limited to, at or adjacent to the sites identified in Tables 5, 6, 7, 8, and 9 or as described herein. Figure 8-9 In one embodiment, the CFXTEN fusion rotein contains a plurality of XTEN segments, for example at least two or at least three or at least four or at least five or more XTEN segments, wherein said XTEN segments can be identical or they can be different and wherein when being measured by a kind of mensuration disclosed herein, CFXTEN retains at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or more procoagulant activity of natural FVIII.XTEN serves as carrier to increase the volume of fusion rotein therein, or changes the interactional intensity of CFXTEN fusion rotein and its target, or strengthens in other specific CFXTEN configuration design of the pharmacokinetic properties of fusion rotein, the present invention contains one or more medium lengths or longer length XTEN sequences and is inserted in the C-terminal, B structural domain (or the residue of BDD sequence), between one or more FVIII structural domains or in, in the outer ring or the CFXTEN compsn at other sites in the FVIII sequence, described other sites are such as but not limited to identifying in table 5, table 6, table 7, table 8 and table 9 or as Figure 8-9 However, it is believed that multiple short lengths to medium length XTEN are incorporated into the CFXTEN compositions to give the fusion protein compared to fewer but longer length XTEN with the same number of amino acid whose CFXTEN fusion protein enhances, but still produce compositions with procoagulant activity and prolonged half-life; Its basic principle is described in detail in this article about the acquisition radius of multiple XTEN.

[0272] In the embodiment that the CFXTEN fusion rotein comprises a plurality of XTEN sequences therein, the cumulative length of total residues is greater than approximately 100 to approximately 3000 or approximately 200 to approximately 2000 or approximately 400 to approximately 1000 amino-acid residues and XTEN can be identical or they can be different aspect sequence, net charge or length.In an embodiment of the CFXTEN that comprises a plurality of XTEN, when with the sequence optimal comparison with similar length, individual XTEN sequence shows at least about 80% sequence identity separately compared to the motif or XTEN or its fragment that are selected from table 3,4 and 13-17, perhaps 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

[0273] As described more fully below, disclose following each method: wherein CFXTEN is by selecting the length of XTEN and it incorporating site in CFXTEN to design to give the target half-life of CFXTEN fusion rotein, the maintenance of procoagulant activity, with the combination reduction of FVIII inhibitor or physicochemical property (for example, stability or solubility) strengthening; Produce and express coding construct; And separate and reclaim recombinant CFXTEN fusion rotein.In general, compared to shorter cumulative length, for example, be shorter than about 280 residues, cumulative length is longer than the XTEN of about 400 residues and is incorporated in the CFXTEN compsn and causes half-life longer.In one embodiment, contain and comprise and have long sequence length at least about 400 or at least about 600 or at least about 800 or at least about 900 or at least about 1000 or more amino acid whose at least single XTEN is as the CFXTEN fusion rotein design of carrier. In another embodiment, a plurality of XTEN are incorporated in the fusion rotein to realize cumulative length at least about 400 or at least about 600 or at least about 800 or at least about 900 or at least about 1000 or more amino acid, wherein XTEN can be identical or they can be different in sequence or length.As used herein, when being incorporated in the CFXTEN fusion rotein beyond an XTEN, " cumulative length " is intended to contain the total length in terms of amino acid residue number.Two aforementioned embodiments are designed to give the bioavailability and / or the terminal half-life of increase compared to the CFXTEN that comprises shorter cumulative XTEN length after using to the experimenter, but still produce procoagulant activity and hemostasis. When subcutaneous or intramuscular administration, compared to the CFXTEN with shorter cumulative length XTEN of similar dosage or the FVIII that is not connected to XTEN, Cmax reduces but area under the curve (AUC) increases, help thus to maintain the effective level of CFXTEN compositions and continue the long period and allow to increase to 2,4,7,10,14 or 21 days in the period between administration, as more fully described below.Therefore, except other physicochemical properties as herein described, XTEN gives the storage tank property to the CFXTEN of use.

[0274] When XTEN is used as a carrier, the present invention utilizes the physical / chemical and pharmacokinetic properties that discovery increases the length of non-repetitive unstructured polypeptide and can strengthen the unstructured property of XTEN and corresponding enhancement comprises the fusion protein of XTEN carrier.As more fully described in the embodiments, proportionally increasing the length of XTEN (even if produced by the single family sequence motif (for example, the four AE motifs of table 3) of repeating order) causes sequence to have higher random coil formation percentage (for example, 90% or higher) (as determined by GOR algorithm) or α spiral or β folded sheet content reduction (for example, less than 2%) (as determined by Chou-Fasman algorithm) compared to shorter XTEN length.In addition, as described in the embodiments, increasing the length of unstructured polypeptide fusion partner causes fusion protein to have the fusion protein of shorter sequence length compared to unstructured polypeptide partner, and terminal half-life disproportionately increases (for example, up to 50,100,200 hours or more than 200 hours).Below more fully describe the pharmacokinetic properties that CFXTEN strengthens compared to the FVIII that is not connected to XTEN.

[0275] In another aspect, the invention provides methods for generating short or medium length XTEN from longer "donor" XTEN sequences, wherein the longer donor XTEN sequences are truncated at the N-terminus or C-terminus, or fragments are generated from the interior of the donor sequence, thereby resulting in short or medium length XTEN. In non-limiting examples, such as Figure 16A As schematically depicted in FIG-C, the 864 amino acid residue AG sequence can be truncated to produce an AG sequence having 144 residues, an AG sequence having 288 residues, an AG sequence having 576 residues, or other intermediate lengths, while the 864 residue AE sequence can be truncated (e.g., Figure 16D, E) to produce a plurality of 144 residue AE sequences, AE sequences with 288 or 576 residues, or other shorter or intermediate lengths. Clearly encompassed is that the method can be used to produce an XTEN of desired length together with any XTEN embodiment as described herein or with any sequence listed in Table 4 or 13-17. In a preferred embodiment, the CFXTEN comprising a plurality of XTEN has a sequence that is selected from the group consisting of AE42_1, AE42_2, AE42_3, AG42_1, AG42_2, AG42_3, AG42_4, AE144_1A, AE144_2A, AE144_2B, AE144_3A, AE144_3B, AE144_4A, AE144_4B, AE144_5A, AE144_6B, AG144_1, AG144_2, AG144_A, AG In some embodiments, the XTEN exhibits at least about 80%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences of 144_B, AG144_C, AG144_F, AG144_3, AG144_4, AE288_1, AE288_2, AG288_1, AG288_2, and AG288_DE.

[0276] 4. Net charge

[0277] In other embodiments, the unstructured feature of the XTEN polypeptide can be enhanced by incorporating an amino acid residue with a net charge and / or reducing the overall percentage ratio (for example, less than 5% or 4% or 3% or 2% or 1%) of hydrophobic amino acids in the XTEN sequence. Overall net charge and net charge density are controlled by revising the content of positively charged or negatively charged amino acids in the XTEN sequence, wherein net charge is typically expressed as, except for those residues offset by residues with opposite charge, the amino acid whose percentage ratio that facilitates charged state in the polypeptide. In some embodiments, the net charge density of the XTEN of compositions can be higher than+0.1 or lower than-0.1 charge / residue. With regard to " net charge density " of this paper protein or peptide, it refers to net charge divided by the amino acid sum in the protein or peptide original. In other embodiments, the net charge of XTEN can be about 0%, about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10% about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, or about 20% or more. Based on the net charge, some XTEN have an isoelectric point (pi) of 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0 or even 6.5. In a preferred embodiment, XTEN will have an isoelectric point between 1.5 and 4.5 and carry a net negative charge under physiological conditions.

[0278] Because most tissues and surfaces in humans or animals have a net negative charge, in some embodiments, the XTEN sequence is designed to have a net negative charge to minimize nonspecific interactions between the compositions containing XTEN and various surfaces such as blood vessels, healthy tissues, or various receptors. Without being bound by a particular theory, due to the electrostatic repulsion between the individual amino acids that individually carry a net negative charge and span the sequence distribution of the XTEN polypeptide, the XTEN can adopt an open conformation. In some embodiments, the design of an XTEN sequence in which at least 90% or 95% of the charged residues are separated by other residues such as serine, alanine, threonine, proline, or glycine results in a more uniform distribution of charge and better expression or purification characteristics. The distribution of the net negative charge in the XTEN of extended sequence length can produce an unstructured conformation, which in turn can result in an effective increase in the hydrodynamic radius. In a preferred embodiment, the negative charge of the subject XTEN is imparted by incorporating glutamic acid residues. Typically, the glutamic acid residues are uniformly spaced across the XTEN sequence. In some cases, every 20kDaXTEN can contain about 10-80 or about 15-60 or about 20-50 glutamic acid residues in the XTEN, it can cause XTEN to have and will have the charged residue of very similar pKa, this can increase the charge homogeneity of product and make its isoelectric point sharp, strengthen the physicochemical property of gained CFXTEN fusion rotein, and therefore simplify purification process.For example, when needs have negatively charged XTEN, XTEN can only be selected from AE family sequence with about 17% net charge owing to the glutamic acid that is incorporated into, or can comprise the glutamic acid motif containing of the table 3 of different proportions to provide required net charge degree.The limiting examples of AE XTEN includes but is not limited to table 4 and 14 36,42,144,288,576,624,864 and 912AE family sequence or its fragment.In one embodiment, the XTEN sequence of table 4 or 13-17 can be modified to comprise other glutamic acid residues to realize required net negative charge. Thus, in one embodiment, the invention provides XTEN wherein the XTEN sequence contains about 1%, 2%, 4%, 8%, 10%, 15%, 17%, 20%, 25%, or even about 30% glutamic acid. In one embodiment, in addition to glutamic acid, the invention also contemplates incorporating up to 5% aspartic acid residues into the XTEN to achieve a net negative charge.

[0279] In other embodiments where a net charge is not desired, the XTEN can be selected, for example, from AGXTEN components such as the AG motifs of Table 3 or those AM motifs of Table 3 that do not have a net charge. Non-limiting examples of AG XTEN include, but are not limited to, the 36, 42, 144, 288, 576, and 864 AG family sequences of Tables 4 and 16, or fragments thereof. In another embodiment, the XTEN can comprise varying ratios of AE and AG motifs to have a net charge deemed optimal for a given use or to maintain a given physicochemical property.

[0280] Without being bound by a particular theory, it is expected that the nonspecific interactions of the XTEN with higher net charge of the CFXTEN compositions with various negatively charged surfaces such as blood vessels, tissues or various receptors are smaller, and this will further contribute to the active removal reduction. On the contrary, it is believed that the XTEN with low net charge (or without net charge) of the CFXTEN compositions will have a higher degree of interaction with the surface, in view of the known effects of cell (for example, platelet) and vascular surface on coagulation process and coagulation factor activation intensity, this can strengthen the activity of related coagulation factors (Zhou, R. et al., Biomaterials (2005) 26 (16): 2965-2973; London, F. et al. Biochemistry (2000) 39 (32): 9850-9858).

[0281] The XTEN of compositions of the present invention does not have positively charged amino acid or has low-level positively charged amino acid usually.In some embodiments, XTEN can have and be less than about 10% and have positively charged amino acid residue or be less than about 7% or be less than about 5% or be less than about 2% or be less than about 1% and have positively charged amino acid residue.However, the present invention contains wherein limited number of amino acid with positive charge (such as lysine) is incorporated among the XTEN to allow the reactive group on the epsilon amine of lysine and peptide, joint bridge or to be conjugated to the construct of conjugating between the reactive group on the medicine or small molecule on XTEN skeleton.In a aforementioned embodiment, the XTEN of theme CFXTEN has approximately 1 to approximately 100 lysine residues or approximately 1 to approximately 70 lysine residues or approximately 1 to approximately 50 lysine residues or approximately 1 to approximately 30 lysine residues or approximately 1 to approximately 20 lysine residues or approximately 1 to approximately 10 lysine residues or approximately 1 to approximately 5 lysine residues or only single lysine residue. Using the aforementioned lysine-containing XTEN, fusion proteins can be constructed comprising XTEN, FVIII coagulation factor plus chemotherapeutic agents or other coagulation factors or cofactors useful for treating coagulopathy conditions, where the maximum number of molecules of the agent that can be incorporated into the XTEN component is determined by the number of lysines or other amino acids with reactive side chains (e.g., cysteines) incorporated into the XTEN.

[0282] In one embodiment, the XTEN of theme CFXTEN compsn will have following sequence, described sequence has the amino acid residue that is less than 10% with positive charge or is less than about 7% or is less than about 5% or is less than about 2% or is less than about 2% amino acid residue, the summation of methionine and tryptophan residue will be less than 2%, and the summation of asparagine and glutamine residue will be less than 5% of total XTEN sequence.

[0283] 5. Low immunogenicity

[0284] On the other hand, the XTEN sequences provided herein have a low degree of immunogenicity or are roughly non-immunogenic. Several factors can contribute to the low immunogenicity of XTEN, such as non-repetitive sequences, unstructured conformation, high solubility, low degree of self-aggregation or lack of self-aggregation, low degree of proteolytic sites within the sequence or lack of proteolytic sites and low degree epitopes or lack of epitopes in the XTEN sequence.

[0285] Conformational epitopes are formed by regions on the surface of proteins consisting primarily of multiple discontinuous amino acid sequences of the protein antigen. Accurate folding of the protein causes these sequences to assume a well-defined, stable spatial configuration, or epitope, that is recognized as "foreign" by the host's humoral immune system, leading to the production of antibodies against the protein or activation of a cell-mediated immune response. In the latter case, the immune response to the protein in an individual is deeply influenced by T cell epitope recognition, which varies with the peptide binding specificity of that individual's HLA-DR allotype. Engagement of the MHC class II peptide complex by the cognate T cell receptor on the surface of the T cell, along with cross-binding of certain other co-receptors such as the CD4 molecule, can induce an activated state within the T cell. Activation leads to the release of cytokines, which further activate other lymphocytes, such as B cells, to produce antibodies or activate T killer cells as a complete cellular immune response.

[0286] The ability that peptide combines given MHC II class molecule to present on APC (antigen presenting cell) surface depends on many factors; Most significantly depends on its primary sequence.In one embodiment, lower degree immunogenicity is by designing the XTEN sequence of antigen processing in the resistance antigen presenting cell, and / or selecting the sequence that does not fully combine MHC acceptor to realize.The invention provides the CFXTEN fusion rotein with generally non-repetitive XTEN polypeptide, and described XTEN polypeptide is designed to reduce and the combination of MHC II acceptor, and avoids forming the epi-position of T cell receptor or antibody combination, thereby produces low degree immunogenicity.The avoidance of immunogenicity can be at least partially attributed to the result of the conformational flexibility of XTEN sequence, i.e. lack secondary structure due to the selection and order of amino acid residues.For example, be particularly interested in in aqueous solution or under the physiological condition that can produce conformational epitope, adopt the lower sequence of tendency of compact folding conformation.Use conventional treatment norm and administration to administer the fusion rotein that comprises XTEN will usually not cause the formation of neutralizing antibodies to XTEN sequence, and also reduce the immunogenicity of FVIII fusion partner in CFXTEN compositions.

[0287] In one embodiment, the XTEN sequences utilized in the subject fusion proteins may be substantially free of epitopes recognized by human T cells. Elimination of such epitopes for the purpose of generating less immunogenic proteins has been previously disclosed; see, for example, WO 98 / 52976, WO 02 / 079232, and WO 00 / 3317, which are incorporated herein by reference. Assays for human T cell epitopes have been described (Stickler, M. et al. (2003) J Immunol Methods, 281:95-108). Of particular interest are peptide sequences that can be oligomerized without generating T cell epitopes or non-human sequences. This is achieved by testing these sequences for the presence of T cell epitopes in direct repeats and the presence of 6 to 15-mer, and specifically 9-mer, sequences that are not human sequences, and then altering the design of the XTEN sequence to eliminate or destroy the epitope sequence. In some embodiments, by limiting the number of epitopes of the XTEN that are predicted to bind to MHC receptors, the XTEN sequence is substantially non-immunogenic. As the number of epitopes capable of binding to MHC receptors decreases, there is a concomitant decrease in T cell activation potential and T helper cell function, decreased B cell activation or upregulation, and decreased antibody production. The low degree of a predicted T cell epitope can be determined, for example, by an epitope prediction algorithm such as TEPITOPE (Sturniolo, T. et al. (1999) Nat Biotechnol, 17: 555-61), as shown in Example 46. The TEPITOPE score for a given peptide frame within a protein is the logarithm of the Kd (dissociation constant, affinity, off-rate) for that peptide frame binding to multiple most common human MHC alleles, as disclosed in Sturniolo, T. et al. (1999) Nature Biotechnology 17: 555. The score is calculated over at least 20 logs between about 10 and about -10 (corresponding to binding to a bound 10e). 10 K d to 10e -10 K d ), and can be reduced by avoiding the hydrophobic amino acids (such as M, I, L, V, F) that serve as anchor residues during peptide display on MHC.In some embodiments, at a TEPITOPE threshold score of about -5 or -6 or -7 or -8 or -9, or at a TEPITOPE score of -10, the XTEN component incorporated into the CFXTEN does not have the T cell epitope of prediction.As used herein, score "-9" is a stricter TEPITOPE threshold than score -5.

[0288] In another embodiment, by limiting the known proteolytic site from the sequence of XTEN, thereby reduce the little peptide that XTEN is processed into and can combine MHC II receptor and cause XTEN sequence of the present invention (comprising those that are incorporated in theme CFXTEN fusion rotein) to be non-immunogenic roughly.In another embodiment, by using and lack secondary structure roughly, thereby cause XTEN sequence to be non-immunogenic roughly because the entropy of structure is higher and give the sequence of resistance to many proteases.Therefore, TEPITOPE score reduces and eliminates the known proteolytic site from XTEN and causes the XTEN composition that comprises the XTEN of CFXTEN fusion protein composition to be combined by mammalian receptor (comprising those receptors of immune system or the activity removal receptor of targeting FVIII).In one embodiment, the K of the XTEN of CFXTEN fusion rotein is combined with mammalian receptor. d Can be >100nM, or K d Greater than 500 nM, or K for mammalian cell surface receptors or circulating polypeptide receptors d Greater than 1μM.

[0289] In addition, the non-repetitive sequence of XTEN and the corresponding lack of epi-position restriction B cell in conjunction with XTEN or by the ability of XTEN activation.Repetitive sequence is identified and can form multivalent contact with even a little B cell, and because the crosslinking of a plurality of T cell-independent receptors, can stimulate B cell proliferation and antibody production.On the contrary, although XTEN can contact with many different B cells on its extended sequence, because sequence lacks repeatability, each individual B cell only can contact once or a few several times with individuation XTEN.Under being bound by any theory, the tendency that XTEN stimulates B cell proliferation and therefore stimulates immune response is much lower usually.In one embodiment, CFXTEN has the immunogenicity of reduction compared to the corresponding FVIII that is not fused in XTEN.In one embodiment, the CFXTEN that uses up to three parenteral doses produces in serum dilution 1:100 and can detect but undetectable anti-CFXTEN IgG under dilution 1:1000. In another embodiment, administration of up to three parenteral doses of CFXTEN to a mammal produces anti-FVIII IgG that is detectable at a serum dilution of 1:100 but undetectable at a dilution of 1:1000. In another embodiment, administration of up to three parenteral doses of CFXTEN to a mammal produces anti-XTEN IgG that is detectable at a serum dilution of 1:100 but undetectable at a dilution of 1:1000. In the foregoing embodiments, the mammal can be a mouse, rat, rabbit, or cynomolgus monkey.

[0290] Another characteristic of XTEN with non-repetitive sequences is that non-repetitive XTEN forms weaker contacts with antibodies relative to sequences with high repetitiveness. Antibodies are multivalent molecules. For example, IgG has two identical binding sites and IgM contains 10 identical binding sites. Therefore, antibodies against repetitive sequences can form multivalent contacts with the repetitive sequences with high avidity, which can affect the effectiveness and / or elimination of the repetitive sequences. In contrast, antibodies against non-repetitive XTEN can produce monovalent interactions, thereby resulting in a lower likelihood of immune clearance, so that the period that the CFXTEN compositions can remain in circulation increases. In addition, it is believed that Figure 6 As schematically depicted in , the flexible, unstructured nature of XTEN provides steric shielding of the FVIII region adjacent to the XTEN insertion site and provides steric hindrance to binding by FVIII inhibitors.

[0291] This is a kind of to and the CFXTEN fusion rotein of XTEN is given the corresponding increase of apparent molecular weight in some embodiments, and strengthens the steric hindrance for FVIII inhibitor and anti-FVIII antibody in other embodiments, thereby reduces the character of their ability in conjunction with CFXTEN.As described in detail in embodiment 26, XTEN is connected to therapeutic protein sequence and causes the CFXTEN compsn to have the hydrodynamic radius of increase, the apparent molecular weight of increase and the apparent molecular weight factor of increase compared to the therapeutic protein that is not connected to XTEN. For example, in therapeutic applications where extended half-life is desired, compositions in which XTEN with a high hydrodynamic radius is incorporated into a fusion protein comprising a therapeutic protein can effectively increase the hydrodynamic radius of the composition beyond the approximately 3-5 nm glomerular pore size (corresponding to an apparent molecular weight of approximately 70 kDa) (Caliceti. 2003. Pharmacokinetic and biodistribution properties of poly(ethylene glycol)-protein conjugates. Adv Drug Deliv Rev 55: 1261-1277), thereby resulting in reduced renal clearance of the circulating protein, with a corresponding increase in terminal half-life and other enhanced pharmacokinetic properties. The hydrodynamic radius of a protein is conferred by its molecular weight as well as by its structure (including shape or compactness). Without being bound by a particular theory, XTEN can adopt an open conformation due to electrostatic repulsion between the individual charges of the peptide or the inherent flexibility conferred by certain amino acids in the sequence that lack the potential to confer secondary structure. The invention provides the method for the hydrodynamic radius of XTEN polypeptide.Compared to the polypeptide (as typical globular protein) with secondary and / or tertiary structure with similar sequence length and / or molecular weight, the opening, extension and non-structured conformation of XTEN polypeptide can have larger proportional hydrodynamic radius.The method for measuring hydrodynamic radius is well known in the art, as by using the size exclusion chromatography (SEC) described in U.S. Patent number 6,406,632 and 7,294,513.Embodiment 26 proves that the XTEN length increase can cause hydrodynamic radius, apparent molecular weight and / or apparent molecular weight factor to increase in proportion, and therefore allows to customize CFXTEN with respect to the required cut-off value of apparent molecular weight or hydrodynamic radius.Therefore, in certain embodiments, available XTEN structure CFXTEN fusion rotein can have hydrodynamic radius at least about 5nm or at least about 8nm or at least about 10nm or about 12nm or about 15nm or about 20nm or about 30nm or larger.In the foregoing embodiments, the large hydrodynamic radius conferred by the XTEN in the CFXTEN fusion protein can result in reduced clearance, increased terminal half-life, and increased mean residence time of the resulting fusion protein.

[0292] In some embodiments, the CFXTEN of FVIII and at least one or more XTEN exhibits an apparent molecular weight of at least 400kD or at least about 500kD or at least about 700kD or at least about 1000kD or at least about 1400kD or at least about 1600kD or at least about 1800kD or at least about 2000kD. In one embodiment, the CFXTEN fusion rotein of any embodiment disclosed herein is presented in the present invention and has the apparent molecular weight factor of about 3 to about 20 or about 5 to about 15 or about 8 to about 12 or about 9 to about 10 under physiological conditions.

[0293] IV). CFXTEN compositions

[0294] The present invention provides compositions comprising fusion proteins with factor VIII connected to one or more XTEN sequences, wherein when administered to a subject, the fusion proteins act to replace or increase the amount of FVIII present in an endogenous or contact-activated coagulation pathway. The present invention addresses the long-term, immediate need to increase the terminal half-life of factor VIII administered exogenously to a subject in need. A method for increasing the circulating half-life of a therapeutic protein is to ensure that the renal clearance or metabolism of the protein is reduced. Another method for increasing the terminal half-life is to reduce the active clearance of the therapeutic protein, whether mediated by receptors, active metabolism of the protein, or other endogenous mechanisms. Both can be achieved by conjugating the protein to a polymer, which, on the one hand, can impart an increased molecular size (or hydrodynamic radius) to the protein and, therefore, reduce renal clearance, and, on the other hand, interfere with protein binding to remove receptors or other proteins that contribute to metabolism or removal. Therefore, certain objects of the present invention include, but are not limited to, providing improved FVIII molecules with longer circulating or terminal half-lives, reducing the number or frequency of necessary administration of FVIII compositions, retaining at least a portion of activity compared to native coagulation Factor VIII, and / or enhancing the ability to treat coagulation deficiencies and uncontrolled bleeding more efficiently, effectively, economically, and / or with greater safety than currently available Factor VIII formulations.

[0295] In one embodiment, FVIII is a natural FVIII. In another ... Non-limiting examples of FVIII suitable for inclusion in the composition include sequences of Table 1 or sequences having at least 80%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto. In a preferred embodiment, the FVIII is a B domain deleted (BDD) FVIII sequence variant, such as those BDD sequences from Table 1 or other such sequences known in the art. In another preferred embodiment, the CFXTEN comprises a B domain deleted (BDD) FVIII sequence variant expressing a native 19 amino acid signal sequence that is cleaved during protein maturation.

[0296] Compositions of the present invention include when being used to the experimenter in need being applicable to mediation or prevention or improving the condition of illness relevant to the defect in the FVIII that lacks or endogenous generation or the fusion rotein of the hemorrhagic disorder relevant to trauma, surgery, factor VIII.What are particularly interested in is seeking compared to natural FVIII, its pharmacokinetic parameter increases, solubility increases, stability increases or some other medical properties strengthen, or increase its terminal half-life and will improve effect, safety, or cause administration frequency to reduce and / or improve the CFXTEN fusion protein compositions of patient management.The CFXTEN fusion rotein of embodiment disclosed herein presents one or more or any combination of improved properties and / or embodiment as described in detail herein. In some embodiments, the CFXTEN fusion composition when administered to a subject maintains levels above a threshold of at least 0.01-0.05, or 0.05 to 0.1, or 0.1 to 0.4 IU / ml for a longer period of time when compared to FVIII not linked to XTEN and administered at a similar dose to a subject in need thereof (e.g., a subject with hemophilia A, such as a human or mouse or monkey).

[0297] The FVIII of the subject compositions (particularly those disclosed in Table 1) along with their corresponding nucleic acid and amino acid sequences are available in public databases such as the Chemical Abstracts Service database (e.g., CAS registry), GenBank, the Universal Protein Resource (UniProt), subscription-provided databases such as GenSeq (e.g., Derwent), and in patents and primary literature. The polynucleotide sequence suitable for expressing the subject CFXTEN sequence can be a wild-type polynucleotide sequence encoding a given FVIII (e.g., full-length or mature), or in some cases, the sequence can be a variant of the wild-type polynucleotide sequence (e.g., a polynucleotide encoding a wild-type biologically active protein, wherein the DNA sequence of the polynucleotide has been optimized, for example, for expression in a particular species; or a polynucleotide encoding a variant of the wild-type protein (e.g., a site-directed mutant or allelic variant). It is well within the ability of the skilled artisan to generate CFXTEN constructs encompassed by the present invention using wild-type or consensus cDNA sequences or codon-optimized variants of FVIII using methods known in the art and / or in conjunction with the guidance and methods provided herein and more fully described in the Examples.

[0298] In one embodiment, the CFXTEN fusion protein comprises a single FVIII molecule linked to a single XTEN (e.g., as described above) with a sequence of 42, 144, 288, 576, or 864 amino acids, including, but not limited to, the AE or AG families set forth in Table 4, that exhibits at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity to the sequence of Table 1. In another embodiment, the CFXTEN comprises a single FVIII linked to two XTEN, wherein the XTEN can be identical or they can be different. In another embodiment, the CFXTEN fusion protein comprises a single FVIII molecule linked to one, two, three, four, five, six or more XTEN sequences, wherein the FVIII has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 200%, 2010 In some embodiments, the one or more XTEN of the present invention have at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% or 100% sequence identity.In the aforementioned embodiment that CFXTEN has two or more XTEN wherein, XTEN can be identical or they can be different sequences.In another embodiment, the CFXTEN fusion protein comprises a single FVIII that exhibits at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity compared to a sequence of similar length selected from Table 1 when optimally aligned, wherein each portion is identical to three, four, five, six, or more of the FVIII sequences. Interspersed and linked by the XTEN sequences are additional XTEN sequences that may be identical or different and wherein each has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity compared to a sequence selected from any one of Tables 3, 4, and 13-17, or a fragment thereof, when optimally aligned. In another embodiment, the invention provides a CFXTEN fusion protein comprising a sequence having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity to a sequence from Table 21 when optimally aligned.

[0299] 1. CFXTEN fusion protein configurations

[0300] The present invention provides CFXTEN fusion protein compositions having CF and XTEN components linked in a specific N-terminus to C-terminus configuration.

[0301] In one embodiment of the CFXTEN composition, the invention provides a fusion protein of Formula I:

[0302] (XTEN) x -CF-(XTEN) y I

[0303] Wherein, independently for each occurrence, CF is a Factor VIII as defined herein, including sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity to the sequences from Table 1; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity to the sequences set forth in Table 4. Thus, the CFXTEN fusion compositions can have XTEN-CF, XTEN-CF-XTEN, or CF-XTEN configurations.

[0304] In another embodiment of the CFXTEN composition, the invention provides a fusion protein of Formula II:

[0305] (XTEN) x -(S) x -(CF)-(XTEN) y II

[0306] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 1; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x + y ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0307] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein, wherein the fusion protein has Formula III:

[0308] (XTEN) x -(S) x -(CF)-(S) y -(XTEN) y III

[0309] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 1; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x + y ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0310] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IV:

[0311] (A1)-(XTEN) u -A2)-(XTEN) v -(B)-(XTEN) w -(A3)-XTEN) x -(C1)-(XTEN) y -(C2)-(XTEN) z

[0312] IV

[0313] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; v is 0 or 1; w is 0 or 1; x is 0 or 1; y is 0 or 1; y is 0 or 1, with the proviso that u+v+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4.

[0314] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula V:

[0315] (XTEN)1-(S)1-(Al)-(S) b -(XTEN) u -(S)b -(A2)-(S) c -(XTEN) v -(S) c -(B)-(S) a -(XTEN) w -(S) d -(A3)-(S) e -(XTEN) x -(S) e -(C1)-(S)1-(XTEN) y -(S) f -(C2)-(S) g -(XTEN) z V

[0316] wherein, independently at each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0317] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VI:

[0318] (XTEN) u -(S) a -(A1)-(S) b -(XTEN) y -(S) b -(A2)-(S) c -(XTEN) w -(S) c -(A3)-(S) d -(XTEN) x-(S) d -(C1)-(S) e -(XTEN) y -(S) e -(C2)-(S) f -(XTEN) z VI

[0319] wherein, independently at each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, with the proviso that u + v + w + x + y + z ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0320] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VII:

[0321] (SP)-(XTEN) x -(CS) x -(S) x -(FVIII_1-745)-(S) y -(XTEN) y -(S) y -(FVIII_1635-2332)-(S) z -(CS)t-(XTEN) x VII

[0322] wherein, independently at each occurrence, SP is a signal peptide, preferably having the sequence MQIELSTCFFLCLLRFCFS (SEQ ID NO: 1611), CS is a cleavage sequence listed in Table 12, S is a spacer sequence of between 1 and about 50 amino acid residues which may optionally include amino acids compatible with a restriction site, "FVIII 1-745" are residues 1-745 of Factor FVIII and "FVIII_1635-2332" are residues 1635-2332 of FVIII, x is 0 or 1, y is 0 or 1, and z is 0 or 1, wherein x+y+z>2; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0323] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VIII:

[0324] (A1)-(S) a -(XTEN) v -(S) a -(A2)-(B1)-(S) b -(XTEN) w -(S) b -(B2)-(A3)-(S) e -(XTEN) x -(S) c -(C1)-(S) u -(XTEN) y -(S) d -(C2)-(S) e -(XTEN) z VIII

[0325] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; B1 is a fragment of the B domain that can have residues 741 to 743-750 of FVIII or about residue 741 to about residue 745 of FVIII; B2 is a fragment of the B domain that can have residues 1635-1686 to 1689 of FVIII or about residue 1640 to about residue 1689 of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a fragment having between 1 and about 50 amino acid residues Optionally, a cleavage sequence or amino acid spacer sequence compatible with a restriction site may be included; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u + v + w + x + y + z ≥ 1; and the XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VIII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0326] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IX:

[0327] (A1 N )-(S) a -(XTEN) t -S) b -(A1 C )-(A2 N )-(S) c -(XTEN) u -(S) d -(A2 C )-(B N )-(S) e -(XTEN) v -(S) f -(B C )-(A3 N )-(S) g -(XTEN) w -(S) b -(A3 C )-(C1 N )-(S)i -(XTEN) x -(S) j -(C1 C )-(C2 N )-(S) k -(XTEN) y -(S) l -(C2 C )-(S) m -(XTEN) x

[0328] IX

[0329] In which, for each occurrence independently, A1 N is a fragment of the A1 domain from at least residue number 1 (numbered relative to native mature FVIII) to at most residue number 371, A1 c is a fragment of the A1 domain from at least residue number 2 to at most residue number 372; A2 N is a fragment of the A2 domain from at least residue number 373 to at most residue number 739, A2 c is a fragment of the A2 domain from at least residue number 374 to at most residue number 740; B N is a fragment of the B domain from at least residue number 741 to at most residue number 1647, B c A3 is a fragment of the B domain from at least residue number 742 to at most residue number 1648; N is a fragment of the A3 domain from at least residue number 1649 to at most residue number 2019, A3 c is a fragment of the A3 domain from at least residue number 1650 to at most residue number 2019; C1 N is a fragment of the C1 domain from at least residue number 2020 to at most residue number 2171, C1 c is a fragment of the C1 domain from at least residue number 2021 to at most residue number 2172; C2 N is a fragment of the C2 domain from at least residue number 2173 to at most residue number 2331, C2 cis a fragment of the C2 domain from at least residue number 2174 to at most residue number 2332; S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids that are compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; h is 0 or 1; i is 0 or 1; j is 0 or 1; k is 0 or 1; l is 0 or 1; m is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t + u + v + w + x + y + z ≥ 1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least 90% identity to the sequences set forth in Table 4. In one embodiment of Formula IX, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula IX, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0330] The embodiment of formula IV-VIII encompasses following CFXTEN configurations: wherein one or more lengths of XTEN in the range of about 6 amino acids to >=1000 amino acids (for example, be selected from any one of table 3,4 and 13-17 sequence or its fragment or show at least about 90-99% or the sequence of higher sequence identity thereto) are inserted and connected between the adjacent domains of factor VIII or are connected to the N-terminal or C-terminal of FVIII.In other embodiments of formula V-VIII, the present invention further provides following configurations: wherein XTEN is connected to the FVIII structural domain by optionally comprising an amino acid that can be compatible with a restriction site or can comprise a cleavage sequence (for example, the sequence of the table 11 and 12 described more fully below) spacer sequence so that the XTEN encoding sequence (in the case of a restriction site) can be incorporated into the CFXTEN construct, and in the case of a cleavage sequence, the XTEN can be released from the fusion protein under the action of a protease that is suitable for the cleavage sequence.

[0331] The embodiments of Formulas VI-VIII differ from those of Formula V in that the FVIII components of Formulas VI-VIII are only B-domain deleted forms of Factor VIII that retain short remnant sequences of the B domain ("FVIII BDD"), non-limiting examples of sequences of which are provided in Table 1, wherein one or more XTEN or fragments of XTEN ranging in length from about 6 amino acids to ≥1000 amino acids (e.g., a sequence selected from any one of Tables 3, 4, and 13-17) are inserted and linked between adjacent domains of Factor VIII and / or between the remainder of the B domain residues (such as those of Table 8). The embodiments of Formula IX generally differ from those of the other formulae in that the one or more XTEN are each inserted within a domain of FVIII rather than between domains, and / or have the XTEN attached to the C-terminus of FVIII (or attached to the C-terminus of FVIII through a spacer sequence).

[0332] In some embodiments of the CFXTEN, the fusion protein comprises a B domain deleted form of FVIII, wherein about the full-length human factor VIII sequence, the B domain deletion begins at the first position at about amino acid residue numbering 745 and ends at the second position at amino acid residue numbering 1635 to about 1690, and the XTEN connects the first and second positions of the B domain deletion. In one aforementioned embodiment, the first and second positions of the B domain deletion are selected from the position of Table 8. In another aforementioned embodiment, at least one XTEN connects the first and second positions, wherein the at least one XTEN connects factor VIII amino acid residue 745 and amino acid residue 1640, or amino acid residue 741 and amino acid residue 1640, or amino acid residue 741 and amino acid residue 1690, or amino acid residue 745 and amino acid residue 1667, or amino acid residue 745 and amino acid residue 1657, or amino acid residue 745 and amino acid residue 1657, or amino acid residue 747 and amino acid residue 1642, or amino acid residue 751 and amino acid residue 1667. In one embodiment of the CFXTEN, wherein the factor VIII comprises an XTEN linked to the first and second positions of the B domain deletion described in the embodiments of this paragraph, the XTEN is a sequence having at least 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity compared to a sequence of similar length selected from any one of Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17, when optimally aligned, wherein the CFXTEN retains at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% procoagulant activity of native FVIII.

[0333] The present invention contemplates insertion of XTEN between or within the domains of FVIII or adjacent to the insertion points of Table 5, Table 6, Table 7, Table 8, and Table 9 or Figure 8-9 All possible permutations of those insertion points described in Table 12, wherein another XTEN is optionally linked to the N-terminus or C-terminus of FVIII, optionally linked through another cleavage sequence selected from Table 12, thereby generating a CFXTEN composition; non-limiting examples of which are depicted in Figure 5 and 12In one embodiment, the CFXTEN comprises a FVIII BDD sequence of Table 1, wherein one or more XTEN having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or more sequence identity compared to a sequence from any one of Tables 3, 4, and 13-17, or a fragment thereof, is inserted between any two residual B domain amino acids of the FVIII BDD sequence, thereby generating a single-chain FVIII fusion protein in which the CFXTEN retains at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% of the procoagulant activity of native FVIII. In the aforementioned embodiments, the CFXTEN can have another XTEN sequence of any one of Tables 4 and 13-17 attached to the N-terminus or C-terminus of the fusion protein. In another embodiment, the CFXTEN comprises at least the first XTEN that is inserted into the site of setting forth in Table 8, wherein said CFXTEN retains at least about 30% or at least about 40% or at least about 50% or at least about 60% or at least about 70% or at least about 80% or at least about 90% procoagulant activity of native FVIII. In one embodiment of formula VII fusion rotein, the CFXTEN comprises the FVIII BDD sequence of Table 1, wherein compared to any one sequence or its fragment from Table 3, 4 and 13-17, each having at least about 80% or at least about 90% or at least about 95% or at least about 96% or at least about 97% or at least about 98% or at least about two or more XTEN of 99% or 100% sequence identity is connected to the FVIII-BDD sequence, wherein at least one XTEN is from a FVIII In one embodiment, the present invention relates to a single-chain FVIII fusion protein comprising a CFXTEN, wherein the CFXTEN exhibits at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% of the procoagulant activity of native FVIII after release of the XTEN by cleavage of the cleavage sequence.

[0334] In one embodiment, the A3 domain comprises the a3 acidic region or a portion thereof. In another embodiment, at least one XTEN is inserted within the a3 acidic region or a portion thereof, at the N-terminus of the a3 acidic region or a portion thereof, at the C-terminus of the a3 acidic region or a portion thereof, or a combination thereof. In certain embodiments, at least one XTEN is inserted within the C2 domain, at the N-terminus of the C2 domain, at the C-terminus of the C2 domain, or a combination thereof. In other embodiments, Factor VIII comprises all or a portion of the B domain. In other embodiments, at least one XTEN is inserted within all or a portion of the B domain, at the N-terminus of the B domain, at the C-terminus of the B domain, or a combination thereof.

[0335] 2. CFXTEN fusion protein configurations with internal XTEN

[0336] On the other hand, the invention provides the CFXTEN with one or more XTEN sequence structures positioned at the interior of the FVIII sequence.In one embodiment, the invention provides the CFXTEN with one or more XTEN sequence structures positioned at the interior of the FVIII sequence to give such as but not limited to following property: compared to the FVIII without the XTEN incorporated into, stability increases, resistance to protease increases, resistance to clearance mechanisms (including but not limited to the interaction with clearance receptors or FVIII inhibitors) increases and hydrophilicity increases.

[0337] The present invention contemplates that different configurations or sequence variants of FVIII can be used as platforms into which one or more XTEN are inserted. These configurations include, but are not limited to, native FVIII, FVIII BDD, and single-chain FVIII (scFVIII), as well as variants of those configurations. In the case of scFVIII, the present invention provides CFXTEN that can be constructed by replacing one or more amino acids in the processing site of FVIII. In one embodiment, the scFVIII used in the CFXTEN is generated by replacing R1648 in the FVIII sequence RHQREITR (SEQ ID NO: 1698) with glycine or alanine to prevent proteolytic processing into a heterodimeric form. It is expressly contemplated that any CFXTEN embodiment disclosed herein having the 1648 FVIII residue can have a glycine or alanine substituted for the arginine at position 1648. In some embodiments, the present invention provides CFXTEN comprising scFVIII in which the sequence portion surrounding the R1648 processing site is replaced with XTEN, such as Figure 10In one embodiment, at least about 60% or about 70% or about 80% or about 90% or about 95% or about 97% or more of the B domain replaces with an XTEN sequence disclosed herein (comprising one or more of R740, R1648 or R1689 cracking sites). In another embodiment, the FVIII B domain sequence of CFXTEN that is between the FXIa cracking sites at R740 and R1689 (wherein also retaining at least 1-5 contiguous B domain amino acid between the cleavage site and the start site of XTEN to allow protease to enter the cleavage site) is replaced by XTEN. In another embodiment, the FVIII B domain sequence of CFXTEN that is between the FXIa cracking sites at N745 and P1640 is replaced by XTEN. In other embodiments, the invention provides CFXTEN FVIIIBDD sequence variants in which portions of the B domain are deleted but only one FXI R740 or R1689 activation site (and 1-5 adjacent amino acids of the B domain) remains within the construct, wherein after cleavage by FXIa, the XTEN remains attached to one end of the light or heavy chain, e.g., Figure 5 In one of the foregoing embodiments, the CFXTEN comprises a FVIII BDD sequence wherein amino acids between N745 to P1640, or between S743 to Q1638, or between P747 to V1642, or between N745 and Q1656, or between N745 and S1657, or between N745 and T1667, or between N745 and Q1686, or between R747 and V1642, or between T751 and T1667 are deleted and the XTEN sequence is linked between these amino acids, thereby linking the heavy and light chains, and may further comprise insertions in external surface loops, between FVIII domains, or at the N-terminus or C-terminus of the FVIII BDD sequence (e.g., one or more insertion sites or Figure 8-9 In another of the foregoing embodiments, the CFXTEN comprises a FVIII BDD sequence wherein the amino acids between K713 and Q1686 or between residues 741 and 1648 are deleted and the XTEN is linked between the two amino acids, and the other XTEN can be inserted in a surface loop, between FVIII domains, or at the N-terminus or C-terminus of the FVIII BDD sequence, including but not limited to one or more insertion sites from Table 5, Table 6, Table 7, Table 8, and Table 9 or Figure 8-9In some embodiments, the CFXTEN sequence can have one or more XTEN that exhibits at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to an XTEN sequence from any one of Tables 4 and 13-17.

[0338] The invention encompasses other CFXTEN with internal XTEN in various configurations; schematic diagrams of exemplary configurations are illustrated in Figure 5 and 10 Regions suitable for XTEN insertion sites include known domain boundaries of FVIII, exon boundaries, known surface (external) loops and solvent accessible surface area sites identified by X-ray crystallographic analysis and structural models obtained by molecular dynamic simulation of FVIII, and sites with low order (through Figure 7 In one embodiment, the XTEN is inserted into a region of the FVIII epitope that is not closely adjacent to a mutation listed in the Haemophilia A Mutation, Search, Test and Resource Site (HAMSTeRS) database implicated in hemophilia A. In another embodiment, the XTEN is inserted into a region of the FVIII epitope that is not closely adjacent to a mutation listed in the Haemophilia A Mutation, Search, Test and Resource Site (HAMSTeRS) database ... Regions and / or sites that are considered for exclusion as XTEN insertion sites include residues / regions of Factor VIII that are important in various interactions, including other coagulation proteins, residues surrounding the respective arginine activation / inactivation cleavage sites acted upon by the proteases thrombin, factor Xa, activated protein C, residues surrounding the signal peptide processing site (residue 1) (if the construct contains a signal peptide), regions known to interact with other proteins such as FIXa, FX / FXa, thrombin, activated protein C, protein S cofactor of protein C, von Willebrand factor, sites known to interact with phospholipid cofactors in coagulation, residues involved in domain interactions, the coordination of Ca 2+, and the like.++ or Cu ++ ion residues, cysteine ​​residues involved in SS intramolecular bonding, documented amino acid insertions and point mutation sites affecting procoagulant activity in FVIII produced in subjects with hemophilia A, and mutation sites affecting procoagulant activity produced in FVIII in research laboratories. Sites considered for insertion (to extend half-life) or for exclusion (required for removal of spent FVIIIa or FXa) include regions known to interact with heparan sulfate proteoglycans (HSPGs) or low-density lipoprotein receptor-related proteins (LPRs).

[0339] By analyzing the aforementioned criteria as described in Example 34, different insertion sites or ranges of insertion sites spanning the FVIII BDD sequence have been identified and / or validated as candidate sites for insertion of XTEN, non-limiting examples of which are listed in Tables 5, 6, 7, 8, and 9 and schematically shown in Figure 8 and 9In one embodiment, CFXTEN comprises the XTEN inset between the individual structural domains of FVIII, i.e. between A1 and A2 or between A2 and B or between B and A3 or between A3 and C1 or between C1 and C2 structural domains. In another embodiment, CFXTEN comprises the XTEN that is inserted in the B structural domain or between the remaining residues of the BDD sequence. In another embodiment, CFXTEN comprises the XTEN that is inserted in the known exon boundary of the coding FVIII gene, because exon represents the evolutionary conservative sequence module with high probability of working under the situation of other protein sequences. In another embodiment, CFXTEN comprises the XTEN that is inserted in the surface loop identified according to the x-ray structure of FVIII. In another embodiment, CFXTEN comprises the XTEN that is inserted in the low-order region that is accredited as having low or not having detection electron density by X-ray structural analysis. In another embodiment, CFXTEN comprises the XTEN that is inserted in the low-order region that is predicted by structure prediction algorithm (such as but not limited to FoldIndex, RONN and Kyte and Doolittle algorithm). In another embodiment, the CFXTEN comprises an XTEN that is inserted in a sequence region where the frequency of hydrophilic amino acids is higher. In another embodiment, the CFXTEN comprises an XTEN that is inserted in an epitope that can be bound by naturally occurring anti-FVIII antibodies in sensitized hemophiliacs. In another embodiment, the CFXTEN comprises an XTEN that is inserted in a sequence region that has low sequence conservation and / or sequence segment length differences between FVIII sequences from different species. In another embodiment, the CFXTEN comprises an XTEN that is connected to the N-terminus and / or the C-terminus. In another embodiment, the invention provides CFXTEN configurations with an insertion XTEN selected from two or more criteria from the embodiments listed above. In another embodiment, the invention provides CFXTEN configurations with an XTEN that is inserted in a factor VIII sequence, wherein the insertion point is at or adjacent to an insertion residue amino acid or residues selected from table 5, table 6, table 7, table 8, and table 9. Figure 8-9 or within one, two, three, four, five, or six amino acids of the insertion residue amino acids from Tables 5, 6, 7, 8, and 9; or Figure 9 The insertion residues are schematically depicted at various spacings of amino acids for an exemplary FVIII BDD sequence.

[0340] In one embodiment, the XTEN of one or more inner positionings or the fragment of XTEN can have at least about 6 to 1000 amino acid residues.In some embodiments, the CFXTEN has one or two or three or four or five or more XTEN sequences inside FVIII, and said XTEN sequence can be identical or different.In one embodiment, when optimal comparison, compared to similar length or fragment or the motif of any one XTEN that is selected from table 3,4 and 13-17, the XTEN of each inner positioning has at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. In another embodiment, the invention provides a CFXTEN constructed with one or more XTEN inserted internally within a FVIII BDD sequence having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity compared to a sequence of Table 1, wherein the insertion is within a sequence of Table 5, Table 6, Table 7, Table 8, and Table 9. Figure 8 At the insertion point or range of insertion points indicated in or as Figure 9 Those skilled in the art will appreciate that an XTEN inserted within the FVIII sequence at the insertion points of Tables 5, 6, 7, 8, and 9 is linked to the flanking FVIII amino acids (or through a linker spacer or cleavage sequence as described above) via its N- and C-termini, whereas an XTEN linked to the N- or C-terminus of FVIII will only be linked to a single FVIII amino acid (or to a linker spacer or cleavage sequence amino acid as described above). By way of example only, variations of the CFXTEN with three internal XTEN can have: an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 18 and 19, and residues 1656 and 1657 (as described herein); or an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 1900 and 1901, and at the C-terminus at residue 2332; or an XTEN incorporated between FVIII BDD residues 26 and 27, residues 1656 and 1657, and residues 1900 and 1901; or an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 1900 and 1901, and at the C-terminus at residue 2332.

[0341] In the time that assessment has the CFXTEN fusion rotein of the XTEN that inserts the position from Table 5, find that in certain region, insert FVIII sequence and produce the CFXTEN with good expression and procoagulant activity maintenance.Therefore, in preferred embodiments, the invention provides the CFXTEN fusion rotein of the XTEN that inserts inside FVIII BDD sequence or is connected to FVIII BDD sequence, described XTEN has at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity separately compared to any one XTEN that is selected from Table 4 and 13-17 The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to the sequence of Table 1, wherein the insertion is at one or two or three or four or five or six or more insertion points set forth in Table 7. In the foregoing embodiments, the CFXTEN fusion protein with the XTEN insert retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more procoagulant activity compared to the corresponding FVIII not linked to the XTEN.

[0342] In evaluating CFXTEN fusion proteins with XTEN inserted into one or more positions from Table 5, it was surprisingly found that a high percentage of the fusion proteins with XTEN inserts retained procoagulant activity, as described in Example 25. Thus, the invention provides CFXTEN fusion proteins constructed with one, two, three, four, five, six or more XTEN, wherein the resulting fusion proteins exhibit at least about 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90% or more procoagulant activity compared to the corresponding FVIII not linked to XTEN when assayed by the coagulation assays described herein. In a preferred embodiment, the invention provides CFXTEN fusion proteins comprising one or two or three or four or five or six or more XTEN linked to a FVIII BDD sequence, each having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to an XTEN selected from any one of Tables 4 and 13-17, wherein the FVIII The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to the sequence of Table 1, wherein the insertion is at one or more insertion points selected from Table 5, Table 6, Table 7, Table 8, and Table 9, and wherein the resulting fusion protein exhibits at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70% or more procoagulant activity compared to the corresponding FVIII not linked to XTEN when assayed in vitro by an assay described herein (e.g., a chromogenic assay). Because the subject CFXTEN fusion proteins generally exhibit an increased terminal half-life compared to native FVIII, one skilled in the art will appreciate that a CFXTEN with lower procoagulant activity relative to an equimolar amount of native FVIII would nonetheless be acceptable when administered as a therapeutic composition to a subject in need thereof.In another embodiment, the CFXTEN fusion protein comprises one or two or three or four or five or more XTEN connected to a FVIII BDD sequence, each of which has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to any one XTEN selected from Tables 4 and 13-17. The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to a sequence of Table 1, wherein the insertion is at one or more insertion points or a range of insertion points selected from Table 5, Table 6, Table 7, Table 8 and Table 9, wherein when expressed in cell culture medium and in a chromogenic assay The resulting fusion protein exhibits at least about 0.5 IU / ml, or at least about 0.75 IU / ml, or at least about 1.0 IU / ml, or at least about 1.5 IU / ml, or at least about 2.0 IU / ml, or at least about 2.5 IU / ml, or at least about 3 IU / ml, or at least about 4 IU / ml, or at least about 5 IU / ml, or at least about 7 IU / ml, or at least about 10 IU / ml, or at least about 20 IU / ml, or at least about 30 IU / ml FVIII activity when assayed in a standard manner, wherein culturing and expression are according to the methods described herein; e.g., the methods of Example 25.

[0343] It is believed that finding an insertion site in which FVIII retains at least a portion of its procoagulant activity will also allow for the insertion of other peptides and polypeptides that have unstructured or structured features associated with an extension of half-life when fused to the FVIII protein at one or more of those same sites. Non-limiting examples include albumin, albumin fragments, Fc fragments of immunoglobulins, the beta subunit of the C-terminal peptide (CTP) of human chorionic gonadotropin, HAP sequences, transferrin, the PAS polypeptide of U.S. Patent Application No. 20100292130, polyglycine linkers, polyserine linkers, peptides and short polypeptides having 6-40 amino acids selected from two amino acid types of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) with varying degrees of secondary structure, especially from less than 50% to greater than 50%, which will be suitable for insertion into the identified active insertion site of FVIII.

[0344] In fusion rotein embodiment as herein described; The CFXTEN fusion rotein can further comprise one or more cleavage sequences from table 12 or other sequence as known in the art; Said cleavage sequence is between 6 amino-acid residues of the cross point of FVIII and XTEN sequence or interior, and said cleavage sequence can comprise two cleavage sequences in the given inner XTEN sequence.In one embodiment, the CFXTEN that comprises cleavage sequence has two identical cleavage sequences, is positioned at the respective end of one or more inner XTEN separately or near said respective end so that when by the proteolytic cracking of combination and that sequence of cracking, XTEN discharges from fusion rotein.Below more fully describe can be cleavable sequence and exemplary sequence and be provided in the table 12.

[0345] Table 5: Insertion positions of XTEN linked to FVIII BDD sequence

[0346]

[0347]

[0348]

[0349]

[0350] Insertion points of XTEN based on the amino acid numbering of mature full-length human FVIII are indicated, where the insertion can be on the N-terminal or C-terminal side of the indicated amino acid.

[0351] Downstream sequence in FVIII BDD with 746-1639 deletion

[0352] Table 6. Exemplary insertion positions of XTEN linked to FVIII polypeptides

[0353]

[0354]

[0355] The distance from the insertion residue refers to the relative number of amino acids from the N-terminus (negative numbers) or C-terminus (positive numbers) of the designated insertion residue (residue "0") at which insertion can occur. The symbol "-x" indicates that the insertion site is x amino acids from the N-terminus of the designated insertion residue. Similarly, the symbol "+x" indicates that the insertion site is x amino acids from the C-terminus of the designated insertion residue.

[0356] For example, "-1, +2" indicates that the insertion is made at the N-terminus or C-terminus of the amino acid residue indicated as -1, 0, +1, or +2.

[0357] Table 7. Additional exemplary insertion positions for XTEN linked to FVIII polypeptides

[0358]

[0359] Indicates the extent of the insertion sites numbered relative to the amino acid numbering of mature human FVIII

[0360] Table 8. Exemplary XTEN insertion locations within B domain deleted variants of FVIII polypeptides

[0361]

[0362]

[0363] The amino acids linked to the B domain deleted variant and the adjacent A3 domain are indicated, where the amino acids are numbered relative to the amino acid numbering of mature human FVIII.

[0364] Indicates the amino acids linked by the XTEN inserted into BDD-FVIII

[0365] Table 9. Exemplary insertion positions of XTEN linked to FVIII polypeptides that produce procoagulant activity

[0366]

[0367]

[0368] Downstream sequence in FVIII BDD with 746-1639 deletion

[0369] On the other hand, the invention provides libraries of components and methods for producing libraries of nucleotides from the FVIII segments encoding the XTEN and the genes that are suitable for preparing the encoding subject CFXTEN that are connected to the XTEN. In a first step, the coding insertions identified or Figure 8-9 The invention also provides a library of genes for FVIII and XTEN in various single sites within 1-6 amino acids of the insertion site described in or within , and the CFXTEN are recovered and evaluated for activity and pharmacokinetics, as described in Figure 15 Those CFXTEN that showed enhanced properties were then used to generate genes encoding FVIII segments and insertion sites plus XTEN, where components from each enhanced insertion were represented in the library, as shown. Figure 11 In one embodiment, standard recombinant techniques are used to Figure 11 The library components were assembled in a combinatorial manner as described in Table 5, Table 6, Table 7, Table 8, and Table 9, thereby generating each arrangement of CFXTEN with multiple internal and N- and C-terminal XTENs that can include Table 5, Table 6, Table 7, Table 8, and Table 9, or Table 9. Figure 8-9The pharmacokinetics of the activity and the enhancement of the construct will then be assessed, and further assessment will be performed compared to the FVIII not being connected to XTEN to produce properties with enhancement, such as those substances standed for of the active removal of the reduction, the resistance to protease, the immunogenicity of the reduction and the pharmacokinetics of the enhanced CFXTEN.

[0370] 3. XTEN permissive rings

[0371] As described in detail elsewhere herein and as Figures 33-36 As described in the , the inventors have recognized that each FVIII "A" domain contains at least two "XTEN-permissive loops" into which XTEN sequences can be inserted without abolishing the procoagulant activity of the recombinant protein or the ability of the recombinant protein to be expressed in host cells in vivo or in vitro. The inventors have identified XTEN-permissive loops as regions that have, among other properties, high surface or solvent exposure and high conformational flexibility. The A1 domain contains an XTEN-permissive loop-1 (A1-1) region and an XTEN-permissive loop-2 (A1-2) region, the A2 domain contains an XTEN-permissive loop-1 (A2-1) region and an XTEN-permissive loop-2 (A2-2) region, and the A3 domain contains an XTEN-permissive loop-1 (A3-1) region and an XTEN-permissive loop-2 (A3-2) region.

[0372] In some aspects, the recombinant FVIII protein as described above comprises at least one XTEN sequence inserted into at least one of the XTEN permissive loops A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In some aspects, the recombinant FVIII protein as described above comprises at least two XTEN sequences inserted into FVIII, e.g., inserted into two different XTEN permissive loops A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. Alternatively, the recombinant FVIII protein as described above can comprise two or more XTEN sequences inserted into a single XTEN permissive loop, with or without XTEN sequences inserted into other XTEN permissive loops, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In certain aspects, the recombinant FVIII protein as described above can comprise at least one XTEN sequence inserted into at least one XTEN permissive loop as described above, and can further comprise one or more XTEN sequences inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In certain aspects, the recombinant FVIII protein of the invention can comprise three, four, five, six or more XTEN sequences inserted into one or more XTEN permissive loops or inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro.

[0373] In certain aspects, the recombinant FVIII protein as described above comprises at least one XTEN sequence inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In certain aspects, the recombinant FVIII protein of the present invention comprises at least one XTEN sequence inserted into a3, and further comprises one or more XTEN sequences inserted into one or more XTEN permissive loops as described above, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro.

[0374] The inventors have recognized that the recombinant FVIII protein of the present invention contains at least two XTEN permissive loops in each of the FVIII A domain regions, which allows the insertion of XTEN sequences while having procoagulant activity and still being able to be expressed by host cells in vivo or in vitro. Various crystal structures of FVIII with varying degrees of resolution have been determined. These structures of FVIII and FVIIIa determined by X-ray crystallography and molecular dynamics simulations were used to generate models of the accessible surface area and conformational flexibility of FVIII. For example, the crystal structure of human FVIII has been determined by Shen et al. Blood 111: 1240-1247 (2008) and Ngo et al. Structure 16: 597-606 (2008). Data for these structures can be obtained from the Protein Data Bank (pdb.org) under accession numbers 2R7E and 3CDZ, respectively.

[0375] The secondary structures of the heavy and light chains of human FVIII, predicted from the crystal structure of Shen et al., are reproduced in Figure 38 and 39 According to the crystal structure predictions of Shen et al., various β chains are Figure 38 and 39 In certain embodiments, the XTEN allows loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 to be contained within a surface-exposed flexible loop structure in the A domain of FVIII. Figure 38 and 39 In the secondary structure shown in , A1-1 is located between β strand 1 and β strand 2, A1-2 is located between β strand 11 and β strand 12, A2-1 is located between β strand 22 and β strand 23, A2-2 is located between β strand 32 and β strand 33, A3-1 is located between β strand 38 and β strand 39, and A3-2 is located between β strand 45 and β strand 46. Figure 38 and 39 The secondary structure of PDB accession number 2R7E shown in corresponds to the standardized secondary structure assignment according to the DSSP program (Kabsch and Sander, Biopolymers, 22: 2577-2637 (1983)). The DSSP secondary structure of mature FVIII, stored under PDB accession number 2R7E, can be obtained from the DSSP database available at the World Wide Web site swift.cmbi.ru.nl / gv / dssp / (last accessed on February 9, 2012) (Joosten et al., 39 (Suppl 1): D411-D419 (2010)).

[0376] In certain aspects, the surface-exposed flexible loop structure comprising A1-1 corresponds to the region of native mature human FVIII from about amino acid 15 to about amino acid 45 of Figure 30. In certain aspects, A1-1 corresponds to the region of native mature human FVIII from about amino acid 18 to about amino acid 41 of Figure 30. In certain aspects, the surface-exposed flexible loop structure comprising A1-2 corresponds to the region of native mature human FVIII from about amino acid 201 to about amino acid 232 of Figure 30. In certain aspects, A1-2 corresponds to the region of native mature human FVIII from about amino acid 218 to about amino acid 229 of Figure 30. In certain aspects, the surface-exposed flexible loop structure comprising A2-1 corresponds to the region of native mature human FVIII from about amino acid 395 to about amino acid 421 of Figure 30. In certain aspects, A2-1 corresponds to the region of native mature human FVIII from about amino acid 397 to about amino acid 418 of Figure 30. In certain aspects, the surface-exposed flexible loop structure comprising A2-2 corresponds to the region of natural mature human FVIII from about amino acid 577 to about amino acid 635 of Figure 30. In certain aspects, A2-2 corresponds to the region of natural mature human FVIII from about amino acid 595 to about amino acid 607 of Figure 30. In certain aspects, the surface-exposed flexible loop structure comprising A3-1 corresponds to the region of natural mature human FVIII from about amino acid 1705 to about amino acid 1732 of Figure 30. In certain aspects, A3-1 corresponds to the region of natural mature human FVIII from about amino acid 1711 to about amino acid 1725 of Figure 30. In certain aspects, the surface-exposed flexible loop structure comprising A3-2 corresponds to the region of natural mature human FVIII from about amino acid 1705 to about amino acid 1732 of Figure 30. Figure 3 30 . In certain aspects, A3-2 corresponds to a region from about amino acid 1884 to about amino acid 1917 of native mature human FVIII.

[0377] In certain aspects, the recombinant FVIII proteins of the present invention comprise one or more XTEN sequences inserted into one or more XTEN permissive loops of FVIII, or inserted into the a3 region, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. The XTEN sequences to be inserted include those that increase the in vivo half-life or in vivo or in vitro stability of FVIII.

[0378] In certain aspects, the recombinant FVIII proteins of the invention comprise an XTEN sequence inserted immediately downstream of one or more amino acids corresponding to one or more amino acids in mature native human FVIII, including but not limited to amino acid 18 of Figure 30, amino acid 26 of Figure 30, amino acid 40 of Figure 30, amino acid 220 of Figure 30, amino acid 224 of Figure 30, amino acid 399 of Figure 30, amino acid 403 of Figure 30, amino acid 599 of Figure 30, amino acid 603 of Figure 30, amino acid 1711 of Figure 30, amino acid 1720 of Figure 30, amino acid 1725 of Figure 30, amino acid 1900 of Figure 30, amino acid 1905 of Figure 30, amino acid 1910 of Figure 30, or any combination thereof; including corresponding insertions in the BDD variants of FVIII described herein.

[0379] In certain aspects, the recombinant FVIII protein of the present invention comprises at least one XTEN sequence inserted into the a3 region of FVIII, alone or in combination with an XTEN sequence inserted into one or more XTEN permissive loops (e.g., A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2 as described above) of the A domain, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In certain aspects, at least one XTEN sequence is inserted into the a3 region immediately downstream of the amino acid corresponding to amino acid 1656 of Figure 30. In certain aspects, the recombinant FVIII proteins of the invention comprise an XTEN sequence inserted into the a3 region as described, and further comprise one or more XTEN sequences inserted immediately downstream of one or more amino acids corresponding to one or more amino acids in mature native human FVIII, including but not limited to: amino acid 18 of Figure 30, amino acid 26 of Figure 30, amino acid 40 of Figure 30, amino acid 220 of Figure 30, amino acid 224 of Figure 30, amino acid 399 of Figure 30, amino acid 403 of Figure 30, amino acid 599 of Figure 30, amino acid 603 of Figure 30, amino acid 1711 of Figure 30, amino acid 1720 of Figure 30, amino acid 1725 of Figure 30, amino acid 1900 of Figure 30, amino acid 1905 of Figure 30, amino acid 1910 of Figure 30, or any combination thereof.

[0380] Those skilled in the art will appreciate that the aforementioned aspects of the permissible loops of the native FVIII protein into which heterologous proteins can be inserted also apply to the B-domain deleted FVIII variants described herein; for example, the sequences set forth in Table 1. In practicing the present invention, it will be appreciated that the BDD-FVIII sequences of Table 1 can be substituted for the recombinant FVIII proteins of the various embodiments described above, and it is believed that the resulting constructs will similarly retain procoagulant activity.

[0381] 4. Interference with FVIII binders

[0382] A goal of the present invention is to provide the accelerator blood coagulation CFXTEN fusion protein compositions for the people's patient suffering from the coagulopathy of hemophilia A, described patient has the activity of the influence CFXTEN fusion rotein of FVIII or natural or acquired antibody, inhibitor or other protein or molecule of half-life, and wherein CFXTEN retains a large amount of accelerator blood coagulation activity compared to the corresponding FVIII that is not connected to XTEN.As used herein, " FVIII binding agent " refers to any molecule that can combine natural FVIII or the recombinant factor VIII fusion rotein that comprises natural, derived or recombinant generation or its segmental of natural FVIII or the present invention.Clearly encompassed is that the FVIII binding agent comprises anti-FVIII antibodies and FVIII inhibitors and can specifically bind other proteins of FVIII.On the one hand, the present invention provides the accelerator blood coagulation CFXTEN fusion rotein that is combined with the anti-FVIII antibodies or FVIII inhibitors that interfere with the accelerator blood coagulation activity of FVIII. As used herein, "anti-FVIII antibody" or "anti-factor VIII antibody" refers to an antibody that can bind the FVIII component of FVIII or CFXTEN of the present invention, including but not limited to the antibodies of Table 10 or polyclonal antibodies from hemophilia A patients with FVIII inhibitors. The term antibody includes monoclonal antibodies, polyclonal antibodies, antibody fragments, and antibody fragment clones. As used herein, "FVIII inhibitor" or "anti-FVIII inhibitor antibody" refers to an antibody that can bind the FVIII component of FVIII or CFXTEN of the present invention and reduce the procoagulant activity of the FVIII component of FVIII or CFXTEN by any means. On the other hand, the invention provides CFXTEN fusion proteins that retain procoagulant activity in the presence of a FVIII inhibitor. On the other hand, the invention provides CFXTEN fusion proteins that comprise FVIII that exhibits an increased terminal half-life in the presence of a FVIII binding agent compared to the FVIII not connected to XTEN.

[0383] Most inhibitory antibodies against human factor VIII act by binding to epitopes located in the A2 domain or the C2 domain of factor VIII, thereby disrupting specific functions associated with these domains (U.S. Pat. No. 6,770,744; Fulcher et al. Localization of human factor FVIII inhibitor epitopes to two polypeptide fragments. Proc. Natl. Acad. Sci. USA (1985) 82: 7728-7732; Scandella et al. Epitope mapping of human factor VIII inhibitor-antibodies by deletion analysis of fVIII fragments expressed in Escherichia coli. Proc. Natl. Acad. Sci. USA (1988) 85: 6152-6156). Although 68% of inhibitory antibodies are reported to be directed against the A2 and / or C2 domains, 3% are directed against the A1 domain and 46% are directed against the a3 acidic region (Lavigne-Lissalde, G et al. Characteristics, mechanisms of action, and epitope mapping of anti-factor VIII antibodies. Clin Rev Allergy Immunol (2009) 37:67-79). For example, certain heavy chain-specific inhibitors react with the 18.3 kD amino-terminal segment of the A2 domain (Scandella D et al. 1988; Lollar P et al. Inhibition of human factor VIIIa by anti-A2 subunit antibodies. J Clin Invest 1994;93:2497). FVIII contains a phospholipid binding site between amino acids 2302 and 2332 in the C2 domain, and there is also a von Willebrand factor binding site in the C2 domain that works together with amino acids 1649-1689 in the A3 domain. The C2 domain also has an epitope that, when bound by an inhibitor, blocks activation of FVIII by thrombin or Factor Xa.Inhibitors that specifically bind to the light chain recognize an epitope in the A3 domain or a major antigenic region in the C2 domain and can lead to a decrease in procoagulant activity by preventing FVIII from binding to phospholipids or reducing the rate of dissociation of FVIII from von Willebrand factor (Gilles JG et al. Anti-factor VIII antibodies of hemophiliac patients are frequently directed towards nonfunctional determinants and do not exhibit isotypic restriction. Blood (1993) 82: 2452; Shima M et al. A factor VIII neutralizing monoclonal antibody and a human inhibitor alloantibody recognizing epitopes in the C2 domain inhibit factor VIII binding to von Willebrand factor and tophosphatidylserine. Thromb Haemost (1993) 69: 240). Non-limiting examples of monoclonal FVIII inhibitors are listed in Table 9. In patients with high titer inhibitors, there is an increased risk of developing recurrent bleeding in specific joints, which can ultimately lead to reduced quality of life, disability, or death from excessive blood loss (U.S. Patent Application No. 20120065077; Zhang et al., Clinic. Rev. Allerg. Immunol., 37: 114-124 (2009); Gouw and van den Berg, Semin. Thromb. Hemost., 35: 723-734 (2009)).

[0384] Without intending to be bound by any particular theory, it is believed that the unstructured characteristics of the XTEN incorporated into the CFXTEN fusion protein allow the XTEN to adopt a conformation that results in steric hindrance for inhibitors that would otherwise bind to the FVIII epitope. Figure 6 As described in , when the incorporated XTEN adopts various random coil conformations, it sterically covers various regions of the FVIII component of the fusion protein and sterically interferes with the ability of the inhibitor to bind to the FVIII epitope.

[0385] In one embodiment, the invention provides CFXTEN that demonstrates procoagulant activity and combines with reduction in the presence of an antibody that binds the C2 domain of factor VIII compared to the corresponding factor VIII and / or natural FVIII that are not connected to XTEN. In another embodiment, the invention provides CFXTEN that demonstrates procoagulant activity and combines with reduction in the presence of an antibody that binds the A2 domain of factor VIII compared to the corresponding factor VIII or natural FVIII that are not connected to XTEN. In another embodiment, the invention provides CFXTEN that demonstrates procoagulant activity and combines with reduction in the presence of an antibody that binds the A2 and C2 domains of factor VIII compared to the corresponding factor VIII or natural FVIII that are not connected to XTEN. In one embodiment, the invention provides CFXTEN that demonstrates procoagulant activity and combines with reduction in the presence of an antibody that is selected from the group of antibodies of Table 10 compared to the corresponding FVIII that are not connected to XTEN. In one embodiment, the CFXTEN fusion protein demonstrates reduction in combination with antibody GMA8021. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody GMA8008. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody ESH4. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody ESH8. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody B02C11. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody B02C11 compared to the corresponding FVIII not linked to XTEN, in the presence of plasma from hemophilia A subjects with a polyclonal antibody FVIII inhibitor, the CFXTEN fusion protein exhibits reduced binding and greater procoagulant activity, wherein the greater procoagulant activity is measured by in vitro assays such as the Bettis DA assay or other assays described herein.

[0386] The CFXTEN that shows the combination reduction by the FVIII inhibitor can have one or two or three or four or five or six or more individual XTEN, and its embodiment is disclosed in this article.In the aforementioned embodiment of this paragraph, when in vitro when assessing in the mensuration (as mensuration as described below herein or those mensuration as known in the art) that can measure the combination of antibody and FVIII, CFXTEN shows at least 5% or 10% or 15% or 20% or 30% or 40% or 50% or 60% or 70% or still less with the combination of antibody.Or, can be as described in the embodiment, by compared to the FVIII that is not connected in XTEN, in the presence of antibody, keep the accelerometer activity of higher degree to assess the combination reduction of theme CFXTEN and FVIII in conjunction with antibody. Thus, in embodiments with respect to reduced binding by a FVIII inhibitor as described herein, the CFXTEN exhibits at least 5%, or 10%, or 15%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 100%, or 200%, or 300%, or 400%, or 500% or more activity in a coagulation assay (as described herein below) when reacted with an anti-FVIII antibody compared to the corresponding FVIII not linked to the XTEN and reacted with the antibody. In the foregoing, the anti-FVIII antibody can be an antibody from Table 9 or a circulating anti-FVIII antibody from a subject with hemophilia A. In another embodiment, the invention provides CFXTEN wherein the fusion protein produces a Bethesda titer that is at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units less when assayed using the Bethesda assay and an anti-FVIII antibody or polyclonal anti-FVIII antibody preparation selected from Table 10 (such as, but not limited to, plasma from a hemophilia A subject with a FVIII inhibitor). In another embodiment, the invention provides CFXTEN wherein the fusion protein assayed produces less than 50%, or less than 40%, or less than 30%, or less than 25%, or less than 20%, or less than 15%, or less than 14%, or less than 13%, or less than 12%, or less than 11%, or less than 10% Bethesda units compared to FVIII not linked to the XTEN when assayed under similar conditions utilizing the Bethesda assay and a polyclonal anti-FVIII antibody preparation (such as, but not limited to, plasma from hemophilia A subjects with FVIII inhibitors).

[0387] Table 10: Anti-Factor VIII Antibodies

[0388]

[0389]

[0390]

[0391] The American Diagnostica Inc. Internet site, URL located on the World Wide Web at americandiagnostica.com / htmUProduct_Detail.asp?idCategory=5&idSubCategory=104&idpro=ESH-8, as it was on January 12, 2012

[0392] The Green Mountain Antibodies Internet site, the URL of which is located on the World Wide Web at greenmoab.com / product_details / 16316 / 21582.html, is as it appears on January 12, 2012.

[0393] Inhibitor and antibody binding assays

[0394] Fusion protein of the present invention can be measured using methods known in the art to confirm that the combination by FVIII inhibitors is reduced. Useable assays include but are not limited to competitive and non-competitive assay systems, radioimmunoassays, ELISAs, " sandwich " immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, immunoradiometric assays, fluorescent immunoassays, coagulation assays, factor VIII inhibitor assays, etc., using the technology of Western blotting. The assays are conventional and well known in the art (see, for example, Ausubel et al., 1994, Current Protocols in Molecular Biology, Volume 1, John Wiley & Sons, Inc., New York, which are incorporated herein by reference in their entirety). Examples are briefly described below but are not intended to be restrictive.

[0395] The Bethesda assay and the Nijmegen modified version of the Bethesda assay are factor VIII inhibitor assays that are well known as methods for detecting FVIII inhibitors (Kasper CK et al. Proceedings: A more uniform measurement of factor VIII inhibitors. Thromb Diath Haemorrh. (1975) 34(2): 612). However, the assay can be modified to measure the binding of inhibitors to FVIII compositions using inhibitors such as polyclonal or monoclonal anti-FVIII antibodies (including the antibodies of Table 10) and the method described in Example 52. Briefly, the modified Bethesda assay involves mixing a titrated volume of a test sample with an equal volume of an inhibitor at a set concentration. The mixture is incubated at 37°C for 2 hours and then analyzed for factor concentration by a coagulation assay such as a chromogenic assay. Similarly, a reference plasma with native factor VIII levels is incubated and then assayed as a positive control. The endpoint is a titer that produces 50% of the FVIII activity of the positive control, reported in Bethesda units. In the Nijmegen modification of the Bethesda assay, the assay sample is stabilized with imidazole buffer and the control sample is mixed with incomplete plasma instead of buffer (Verbruggen B et al. The Nijmegen modification of the Bethesda assay for factor VIII:C inhibitors: improved specificity and reliability. Thromb Haemost. (1995) 73(2): 247-251).

[0396] Western blot analysis generally includes preparing a protein sample, electrophoresing the protein sample in a polyacrylamide gel (e.g., 8%-20% SDS-PAGE, depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF, or nylon, blocking the membrane in a blocking solution (e.g., PBS with 3% BSA or skim milk), washing the membrane in a wash buffer (e.g., PBS-Tween 20), blocking the membrane with a primary antibody (antibody of interest) diluted in the blocking buffer, washing the membrane in a wash buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzyme substrate (e.g., horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (e.g., 32P or 125I) diluted in the blocking buffer, washing the membrane in a wash buffer, and detecting the presence of the antigen. Those skilled in the art will appreciate that the parameters can be modified to increase the signal detected and reduce background noi...

Claims

1. A recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide fused to at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain, an A2 domain, an A3 domain, an a3 domain, a C1 domain, a C2 domain, and optionally a B domain or a portion of the B domain.

2. The recombinant factor VIII fusion protein of claim 1, wherein the at least one XTEN is inserted within at least one domain selected from the A1 domain, the A2 domain, the A3 domain, the B domain, the a3 domain, the C1 domain, or the C2 domain, or the at least one XTEN is fused to the C-terminus of the factor VIII polypeptide.

3. The recombinant Factor VIII fusion protein of claim 1, wherein the at least one XTEN is either inserted into the B domain or a portion of the B domain, or fused to the C-terminus of the Factor VIII polypeptide, or both.

4. The recombinant Factor VIII fusion protein of claim 1, wherein the at least one XTEN is inserted in the A1 domain, the A2 domain, the A3 domain, the a3 domain, or any combination thereof.

5. The recombinant Factor VIII fusion protein of claim 2 or 4, wherein the A1 domain comprises a permissive loop-1 (A1-1) region and a permissive loop-2 (A1-2) region, wherein the at least one XTEN is inserted in A1-1, A1-2, or both.

6. The recombinant factor VIII fusion protein of claim 2 or 4, wherein the A2 domain comprises a permissive loop-1 (A2-1) region and a permissive loop-2 (A2-2) region, wherein the at least one XTEN is inserted in A2-1, A2-2, or both.

7. The recombinant factor VIII fusion protein of claim 2 or 4, wherein the A3 domain comprises a permissive loop-1 (A3-1) region and a permissive loop-2 (A3-2) region, wherein the at least one XTEN is inserted in A3-1, A3-2, or both.

8. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-1 (A1-1) region corresponds to the region from about amino acid 15 to about amino acid 45 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-1.

9. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-1 (A1-1) region corresponds to the region from about amino acid 18 to about amino acid 32 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-1.

10. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-2 (A1-2) region corresponds to the region from about amino acid 201 to about amino acid 232 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-2.

Images