Construction method and application of LRRK2.p.N1437D point mutation mouse model

Abstract

The invention discloses a construction method of an LRRK2. P.N1437D point mutation mouse model, which is characterized in that after a segment of sequence is knocked out from a No.30 exon of a mouse LRRK2 protein by utilizing a CRISPR / Cas9 technology, the p.N1437D point mutation in Donor DNA is introduced into the No.30 exon of the mouse LRRK2 by utilizing homologous recombination repair.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to a method for constructing a LRRK2.p.N1437D point mutation mouse model and its application. Background Art

[0002] Parkinson's disease is a progressive neurodegenerative disease characterized by resting tremor, bradykinesia, rigidity and impaired postural reflexes. Pathologically, it manifests as loss of dopaminergic neurons in the substantia nigra and intracellular Lewy body deposition. LRRK2 mutations are the most common risk factor, accounting for 10-15% of familial Parkinson's disease and 1-2% of sporadic Parkinson's disease in Western countries. Among them, the seven most common LRRK2 pathogenic mutations are p.G2019S, p.R1441C, p.R1441G, p.R1441H, p.Y1699C, p.I2020T, and p.N1437H, which can cause dysfunction of the GTPase and kinase domains of the LRRK2 protein.

[0003] Although there are many LRRK2 Knock In (KI) mice or transgenic mice based on the above common mutations, the existing G2019S and R1441C LRRK2 point mutation KI mice cannot cause PD-related behavioral and pathological changes in mice until the end of the animal's life. Among the existing LRRK2 mutation model animals, only the overexpression of G2019S, R1441C and R1441G mutant LRRK2 or the induction of exogenous pressure can simulate PD-related behavioral changes and pathological phenotypes. However, the experimental results obtained under the conditions of overexpression or drug induction are very different from the actual situation of LRRK2 mutation-carrying patients. The drugs developed based on these results may give developers wrong hints. Therefore, it is particularly important to develop an LRRK2 point mutation mouse that is closer to the actual situation of patients.

[0004] Existing literature reports: A new LRRK2 pathogenic mutation N1437D (c.4309A>G; NM_98578) is extremely conservative in evolution, and compared with the adjacent R1441C mutation, the N1473D mutation has a higher level of autophosphorylation and stronger GTP binding ability. Although the N1437D site of LRRK2 seems to have a stronger pathogenicity from the results caused by the mutation, there are currently no LRRK2 point mutation mice with N1437D as the editing site. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing a LRRK2.p.N1437D point mutation mouse model.

[0006] Another object of the present invention is to provide an application of the LRRK2.p.N1437D point mutation mouse model constructed by the method in the preparation of a treatment for Parkinson's disease.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a method for constructing a LRRK2.p.N1437D point mutation mouse model, comprising the following steps:

[0009] The first step is to determine that the N1437D (c.4309A) site to be mutated is located in exon 30 of the LRRK2 gene. According to the sequence of the N1437D (c.4309A) site, Cas9 / gRNA is used to design the Guide RNA (referred to as gRNA) and the homologous repair template Donor DNA sequence;

[0010] Constructing a specific target Guide RNA for exon 30 of the LRRK2 gene and transcribed it into Guide RNA in vitro;

[0011] The sequence of Guide RNA transcribed in vitro in the first step is shown in SEQ ID NO.1:

[0012] CACCTTTGATATTGAAGAGCC AGG(SEQ ID NO.1)

[0013] The homologous repair template Donor DNA sequence in the first step is shown in SEQ ID NO.2:

[0014] CTATGATCTCAGCAAGGGGCAGGCAGAGGTGGACGCCATGAAGCCTTGGCTCTTC GATATCAAGGTGATTTCTTCTGATCACGTGGGACTAGAGTGTGATCATTGCTCAC (SEQ ID NO. 2), wherein the T at position 46 of the Donor DNA sequence is a mutated base, and the G at position 56 of the Donor DNA sequence is a synonymous mutation made to prevent secondary cutting of gRNA.

[0015] In the second step, the Guide RNA, Donor DNA and Cas9 mRNA obtained in the first step are mixed to form an injection solution, which is then delivered into the nucleus of the fertilized egg of C57BL / 6J mice by fertilized egg microinjection;

[0016] The third step is to transplant the surviving fertilized eggs obtained in the second step into the reproductive system of surrogate mice, and the born mice are amplified by PCR using primers N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), and then the amplified fragments are sequenced using N1437D-P1-F (SEQ ID NO.3) as a sequencing primer, and the sequencing-positive mice are the F0 generation positive mice (LRRK2.p.N1437D point mutation-positive F0 offspring) with gene editing carrying the LRRK2.p.N1437D mutation;

[0017] The PCR primer and sequencing primer sequence of N1437D-P1-F in the third step is shown in SEQ ID NO.3:

[0018] ATACGGGGCAAAAGGAGAAAGGAC(SEQ ID NO.3)

[0019] The sequence of the PCR primer N1437D-P2-R in the third step is shown in SEQ ID NO.4:

[0020] TGGGGCAACAGACAGCAATCAC(SEQ ID NO.4)

[0021] In the fourth step, the F0 generation positive mice carrying the LRRK2.p.N1437D mutation obtained by gene editing in the third step are hybridized with C57BL / 6J wild-type mice, and then amplified by PCR using primers N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), and then the amplified fragments are sequenced using N1437D-P1-F (SEQ ID NO.3) as sequencing primers. The F1 generation (i.e., the F1 generation that stably inherits the LRRK2.p.N1437D point mutation) offspring identified as sequencing positive can stably inherit;

[0022] In the fifth step, the F1 generation LRRK2.p.N1437D mutation heterozygous mice (HET) obtained in the fourth step or the F1 generation LRRK2.p.N1437D mutation heterozygous offspring obtained by crossing with C57BL / 6J wild-type mice were self-fertilized, and after PCR amplification of N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), N1437D-P1-F (SEQ ID NO.5) was used to generate the gene. NO.3) as a sequencing primer to perform DNA sequencing on the amplified fragments, and the LRRK2 wild-type mice (WT), LRRK2.p.N1437D mutant heterozygous mice (HET) and LRRK2.p.N1437D mutant homozygous mice (HOMO) of the same litter used in research and experiments can be obtained.

[0023] The second aspect of the present invention provides an application of the LRRK2.p.N1437D point mutation mouse model constructed by the method in the preparation of a treatment for Parkinson's disease.

[0024] In the third aspect of the present invention, a kit for constructing a LRRK2.p.N1437D point mutation mouse model is provided, comprising Guide RNA, Donor DNA, Cas9 mRNA, primer N1437D-P1-F, and primer N1437D-P2-R; the sequence of the Guide RNA is SEQ ID NO.1, the sequence of the Donor DNA is SEQ ID NO.2, the sequence of the primer N1437D-P1-F is SEQ ID NO.3, and the sequence of the primer N1437D-P2-R is SEQ ID NO.4.

[0025] Due to the adoption of the above technical solution, the present invention has the following advantages and beneficial effects:

[0026] The present invention utilizes CRISPR / Cas9 technology to knock out a sequence in exon 30 of mouse LRRK2 protein, and then utilizes homologous recombination repair to introduce the point mutation p.N1437D (c.4309A>G) in Donor DNA into exon 30 of mouse LRRK2.

[0027] The present invention constructs an LRRK2.p.N1437D point mutation mouse model based on the N1437D pathogenic mutation carried by patients with LRRK2 mutation Parkinson's disease found in clinical practice. The HOMO group of mice in the LRRK2.p.N1437D point mutation mouse model constructed by the present invention achieves HOMO mouse PD-related motor impairment at 25-26 months of age, relying solely on LRRK2 background expression and not relying on external pressure stimulation induction, and the HOMO mice show PD-related pathological features of reduced dopaminergic transporters and reduced substantia nigra dopaminergic neurons at 26-27 months of age. The N1437D mouse constructed by the present invention achieves behavioral and pathological damage that occurs under natural aging conditions that the previous LRRK2 point mutation KI mice could not achieve. The present invention not only provides a new and more realistic disease mouse model for the study of LRRK2 in Parkinson's and Parkinson's syndrome, but also provides a new option for the development of LRRK2-related drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a schematic diagram of the process of constructing the LRRK2.p.N1437D point mutation mouse model in Example 1.

[0029] Figure 2 It is a schematic diagram of the sequencing sequence comparison of the F1 positive progeny obtained in Example 1.

[0030] Figure 3 This is a schematic diagram of the electrophoresis results of PCR products for genotyping mice with the LRRK2.p.N1437D point mutation in Example 1.

[0031] Figure 4 It is a schematic diagram of the process of obtaining mice required for the LRRK2.p.N1437D point mutation mouse experiment in Example 1, genotype identification, and changes in LRRK2 protein abundance after mutation.

[0032] Figure 5 This is a diagram showing the effect of the LRRK2.p.N1437D point mutation mice in Example 1, on the motor ability of 17-18 month old and 25-26 month old mice.

[0033] Figure 6 This is a diagram showing the effect of the N1437D point mutation on the substantia nigra dopamine system in LRRK2.p.N1437D point mutation mice in Example 1 and 17-18 month old and 26-27 month old mice. DETAILED DESCRIPTION

[0034] In order to explain the present invention more clearly, the present invention is further described below in conjunction with preferred embodiments. It should be understood by those skilled in the art that the following specific description is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0035] Example 1

[0036] 1. A method for constructing a mouse model of LRRK2.p.N1437D point mutation (eg Figure 1 As shown, Figure 1 Schematic diagram of the method for constructing the LRRK2.p.N1437D point mutation mouse model in Example 1. ), comprising the following steps:

[0037] The first step is to determine that the N1437D (c.4309A) site to be mutated is located in exon 30 of the LRRK2 gene. According to the sequence of the N1437D (c.4309A) site, Cas9 / gRNA is used to design the Guide RNA (referred to as gRNA) and the homologous repair template Donor DNA sequence;

[0038] A specific target Guide RNA for exon 30 of the LRRK2 gene was constructed and transcribed into Guide RNA in vitro. The Guide RNA sequence is shown in SEQ ID NO.1:

[0039] CACCTTTGATATTGAAGAGCC AGG(SEQ ID NO.1)

[0040] The homologous repair template Donor DNA sequence is shown in SEQ ID NO.2:

[0041] CTATGATCTCAGCAAGGGGCAGGCAGAGGTGGACGCCATGAAGCCTTGGCTCTTC GATATCAAGGTGATTTCTTCTGATCACGTGGGACTAGAGTGTGATCATTGCTCAC (SEQ ID NO. 2), wherein the T at position 46 of the Donor DNA sequence is a mutated base, and the G at position 56 of the Donor DNA sequence is a synonymous mutation made to prevent secondary cutting of gRNA.

[0042] In the second step, the Guide RNA, Donor DNA and Cas9 mRNA (purchased from Shanghai Model Organisms Science Co., Ltd.) obtained in the first step were mixed to form an injection solution, which was delivered into the nucleus of the fertilized egg of C57BL / 6J mice by fertilized egg microinjection;

[0043] In the third step, the surviving fertilized eggs obtained in the second step are transplanted into the reproductive system of surrogate mice. The mice born are amplified by PCR using primers N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), and then the amplified fragments are sequenced using N1437D-P1-F (SEQ ID NO.3) as sequencing primers. The mice with positive sequencing are F0 generation positive mice (LRRK2.p.N1437D point mutation positive F0 offspring) with gene editing carrying LRRK2.p.N1437D mutation. Since the early cleavage rate of fertilized eggs is very fast, the obtained F0 generation mice are chimeras and may not have the ability of stable inheritance. Passaging is required to obtain F1 generation mice with stable inheritance.

[0044] The PCR primer and sequencing primer sequence of N1437D-P1-F is:

[0045] ATACGGGGCAAAAGGAGAAAGGAC(SEQ ID NO.3)

[0046] The sequence of the PCR primer of N1437D-P2-R is:

[0047] TGGGGCAACAGACAGCAATCAC(SEQ ID NO.4)

[0048] Sequence comparison before and after mutation is shown in Figure 2 As shown, Figure 2 This is a schematic diagram of the sequencing sequence comparison of the F1 positive progeny obtained in Example 1. Among them, Query is the wild-type genome sequence, Subject is the actual sequencing result after mutation, the boxes on the right side of the figure are the bases before and after the mutation, and the boxes on the left side of the figure are synonymous mutations made to prevent secondary cutting of gRNA.

[0049] In the fourth step, the F0 generation positive mice carrying the LRRK2.p.N1437D mutation obtained by gene editing in the third step are hybridized with C57BL / 6J wild-type mice, and then amplified by PCR with primers N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), and then the amplified fragments are sequenced using N1437D-P1-F (SEQ ID NO.3) as a sequencing primer. The F1 generation (i.e., the F1 generation that stably inherits the LRRK2.p.N1437D point mutation) identified as sequencing positive can be stably inherited by the offspring.

[0050] In the fifth step, the F1 generation LRRK2.p.N1437D mutation heterozygous mice (HET) obtained in the fourth step or the F1 generation LRRK2.p.N1437D mutation heterozygous offspring obtained by crossing with C57BL / 6J wild-type mice were self-fertilized, and after PCR amplification of N1437D-P1-F (SEQ ID NO.3) and N1437D-P2-R (SEQ ID NO.4), N1437D-P1-F (SEQ ID NO.5) was used to generate the gene. NO.3) as a sequencing primer to perform DNA sequencing on the amplified fragments, and the LRRK2 wild-type mice (WT), LRRK2.p.N1437D mutant heterozygous mice (HET) and LRRK2.p.N1437D mutant homozygous mice (HOMO) of the same litter for research and experiments can be obtained. This shows that the present invention successfully constructs a LRRK2.p.N1437D point mutation mouse model.

[0051] The breeding and use of animals required for the LRRK2.p.N1437D point mutation mice of the present invention requires sequencing of the sequence where the mutation is located by PCR and sequencing to identify the accurate genotype of the obtained offspring.

[0052] The LRRK2.p.N1437D point mutation mouse of the present invention can be used not only for the research of LRRK2 in the field of Parkinson's disease and Parkinson's syndrome, but also for the screening and development of LRRK2 gene-related drugs.

[0053] 2. The method and results of genotyping the offspring mice for the LRRK2.p.N1437D point mutation positive F0 offspring obtained in the third step, the F1 offspring mice that can stably inherit the LRRK2.p.N1437D point mutation obtained in the fourth step, and the offspring mice for the LRRK2.p.N1437D point mutation experiment obtained in the fifth step:

[0054] 1. The primer information involved in the third and fourth steps is as follows:

[0055] The sequence of the PCR primer and sequencing primer of N1437D-P1-F is:

[0056] ATACGGGGCAAAAGGAGAAAGGAC(SEQ ID NO.3)

[0057] The sequence of the PCR primer of N1437D-P2-R is:

[0058] TGGGGCAACAGACAGCAATCAC(SEQ ID NO.4)

[0059] 2. The PCR reaction conditions in the third and fourth steps are shown in Table 1:

[0060] Table 1: PCR reaction conditions for N1437D mutation identification

[0061] Step# Temp(℃) Time Note 1 94 3min - 2 98 15sec - 3 57 15sec - 4 68 1min Repeat steps 2-4 for 35 cycles 5 68 5min - 6 10 - hold

[0062] After agarose gel DNA electrophoresis using N1437D-P1-F and N1437D-P2-R as PCR primers, a band of 1313 bp was obtained. This band was the band sequenced using N1437D-P1-F as the sequencing primer in the third and fourth steps.

[0063] 3. PCR electrophoresis results are as follows Figure 3 As shown, Figure 3 This is a schematic diagram of the electrophoresis results of PCR products for genotyping mice with the LRRK2.p.N1437D point mutation in Example 1.

[0064] 4. The information of F1 generation mice that can stably inherit the LRRK2.p.N1437D point mutation is shown in Table 2:

[0065] Table 2: Basic information of F1 positive mice

[0066]

[0067]

[0068] 5. The sequencing results of the three genotype mice, WT, HET and HOMO, required for research and experiments are as follows Figure 4 As shown, the base framed by the frame is the location of the N1437D point mutation:

[0069] The sequencing result of the PCR product of WT mice was TGGCTCTTCAATATCAAG (SEQ ID NO.5)

[0070] The sequencing result of the PCR product of HET mouse was TGGCTCTTCA / GATATCAAG (SEQ ID NO.6)

[0071] The sequencing result of the HOMO mouse PCR product was TGGCTCTTCGATATCAAG (SEQ ID NO.7)

[0072] 3. Effect of LRRK2.p.N1437D point mutation mouse model

[0073] The LRRK2.p.N1437D point mutation mice prepared by the present invention were subjected to detection of LRRK2 expression abundance after mutation, PD-related behavior and pathology.

[0074] The mice used in the following tests were all LRRK2 wild-type mice (WT), LRRK2.p.N1437D mutant heterozygous mice (HET) and LRRK2.p.N1437D mutant homozygous mice (HOMO) produced by selfing of LRRK2.p.N1437D mutant heterozygous mice (HET) prepared by the present invention, hereinafter referred to as WT, HET and HOMO mice.

[0075] 1. Detection of LRRK2 expression abundance in LRRK2.p.N1437D point mutation mice

[0076] Western Blot detection of LRRK2 content experimental steps: After weighing the mouse cerebral cortex tissue, add the corresponding volume of RIPA lysis solution according to the amount of 1mg / 60μl, grind it three times on the grinder at 70Hz 30S program, with an interval of 2 minutes between each grinding. The sample was placed on ice to cool during the interval. After grinding, it was lysed on ice for 1 hour. After protein denaturation, it was electrophoresed in 4%-20% polyacrylamide gel electrophoresis (PAGE). The transfer condition of LRRK2 protein was 300ma constant current for 3 hours. After the transfer was completed, it was blocked with skim milk for 30 minutes, and the primary antibody was overnight at 4 degrees after TBST was washed off the milk, and the secondary antibody was room temperature for two hours.

[0077] Proteins in the cerebral cortex of WT, HET and HOMO mice were extracted using RIPA lysis buffer, and the content of LRRK2 protein was detected by Western Blot. Figure 4 Schematic diagram of the acquisition process, genotype identification and changes in LRRK2 protein abundance after mutation required for the LRRK2.p.N1437D point mutation mouse experiment in Example 1. Figure 4 The left picture in Figure A shows the mating strategies of WT, HET and HOMO mice used in the experiment, and the right picture shows the sequencing results after PCR amplification and sequencing identification. Figure 4 B in the figure represents the Western Blot electrophoresis of total LRRK2 protein and internal reference α-Tublin. Figure 4 C in Figure 3 represents the total LRRK2 expression level after quantification using the internal reference α-Tublin in Figure 3. Figure 4 The results of B and C show that the introduction of LRRK2.p.N1437D did not change the expression level of LRRK2 in the cortical region of the mouse, indicating that the N1437D point mutation introduced by the present invention does not affect the expression regulation of LRRK2, and subsequent behavioral experiments and pathological experiments were carried out under the background of LRRK2 background expression.

[0078] 2. Effect of N1437D point mutation on motor ability of 17-18 month old and 25-26 month old mice

[0079] The specific experimental process for detecting PD-related motor ability in aged LRRK2.p.N1437D point mutation mice is as follows:

[0080] (1) 30-minute open field test of mice's autonomous movement ability

[0081] The mice were placed in a 40 cm x 40 cm open field and allowed to move freely for 30 minutes. The total movement distance of the mice during these 30 minutes was the autonomous movement ability of the mice.

[0082] (2) Pole Test to measure the balance ability of mice

[0083] In the Pole Test, mice will undergo 3 days of pole climbing training and a pole climbing test on the last day. On the first day, the mouse is placed head down in the middle of a 60 cm long pole, and the mouse is trained to climb down from the middle of the pole; on the second day, the mouse is placed head down on the top of a 60 cm long pole, and the mouse is trained to climb down from the top of the pole; on the third day, the mouse is placed head up on the top of the pole, and the mouse is trained to turn around, reverse the direction of its head, and then climb down to the bottom of the pole. Each mouse is trained for 3 cycles every day. On the fourth day, the mouse is placed head up on the top of the pole, and the "turnover time" required for the mouse to turn its head downward until its body is straight and the "total time" required to climb to the bottom of the pole are recorded. The test on the fourth day needs to be repeated 5 times for each mouse.

[0084] (3) Mouse limb grip test

[0085] Place the mouse to be tested on the grid for testing grip strength. After the mouse grasps the grid, grab the mouse's tail and pull it back until the mouse's four paws are out of the recorded grid. The instrument will display the maximum grip strength of the mouse's limbs when it grasps the grid. Repeat the measurement of the grip strength of the limbs of each mouse 5 times.

[0086] (4) Measurement of step length and limb length during walking of mice

[0087] In this experiment, the catwalk XT gait analyzer of Noldus company was used to measure the step length and the length of the four limbs when the mice walked. The length of the walkway for the mouse gait analysis in the experiment was 10cm. When the mouse passed through the circled walkway, the trail with a speed change rate of less than 60% was recorded as a qualified record. At least 6 qualified trails were counted for each mouse. After the experiment, the software automatically calculated the required experimental parameters.

[0088] The experimental results are as follows Figure 5 As shown, Figure 5This is a diagram showing the effect of the LRRK2.p.N1437D point mutation mice in Example 1, on the motor ability of 17-18 month old and 25-26 month old mice.

[0089] Figure 5 A represents the movement distance of the aged mice in the open field for 30 minutes; B represents the time taken by the aged mice to turn their heads to a completely straight body in the pole climbing test; C represents the total time taken by the aged mice from the start of the experiment to the bottom of the pole climbing test; D represents the gripping strength of 25-26 month old mice; E represents a representative diagram of the footprints of the aged mice during the walking process in the gait analysis experiment; F represents the length of the footprints of the 17-18 month old mice on all fours while walking; G represents the length of the footprints of the 25-26 month old mice on all fours while walking; H represents the step length of each step of the 17-18 month old mice on all fours while walking; I represents the step length of each step of the 25-26 month old mice on all fours while walking.

[0090] exist Figure 5 In the figure, RF is the abbreviation of Right front, RH is the abbreviation of right hind, LF is the abbreviation of left front, and LH is the abbreviation of left hind.

[0091] Figure 5The results of A show that at 17-18 months, there is no difference in the movement distance of WT, HET and HOMO in the open field in 30 minutes, but the movement distance of HOMO mice at 25-26 months is significantly less than that of WT mice of the same age, indicating that the N1437D pure and mice of the present invention have a decrease in autonomous movement at 25-26 months. The results of B show that HOMO mice aged 25-26 months need longer time to turn the direction of their heads in the climbing pole test; the results of C show that HOMO mice aged 25-26 months will take longer than WT mice to climb from the top of the climbing pole to the bottom in the climbing pole test, and the deterioration of the results of the climbing pole experiment means the damage of the balance ability of mice. The results of D show that the gripping force of the limbs of HOMO mice aged 25-26 months is significantly weaker than that of WT mice. E is a pattern diagram of the footprints of elderly mice during walking, and the results suggest that the length of the left and right hind limbs of HOMO mice aged 25-26 months is longer. The result of F indicates that there is no significant difference in the length of the four limbs touching the ground when the 17-18 month old mice are walking; the result of G indicates that the distance of the left and right hind limbs of the 25-26 month old HOMO group old mice touching the ground is significantly longer than that of the WT mice; the result of H indicates that there is no significant difference in the step length of the 17-18 month old WT, HET and HOMO old mice during walking; the result of I indicates that the step length of the right forelimb and left hind limb of the 25-26 month old HOMO mice during walking is significantly shorter than that of the WT mice. Among them, the significant difference between HOMO and WT in G and I indicates that HOMO mice have gait impairment during walking at the age of 25-26 months.

[0092] Figure 5 The results mean that at 25-26 months of age, the homozygous mice carrying the LRRK2.p.N1437D point mutation showed a decrease in autonomous movement distance, worse balance ability, decreased limb grip strength, and gait impairment during walking compared with WT mice of the same age, indicating that the homozygous mice carrying the LRRK2.p.N1437D point mutation prepared by the present invention did indeed show PD-related motor impairment.

[0093] 3. Effects of the N1437D point mutation on the substantia nigra dopamine system in 17-18-month-old and 26-27-month-old mice

[0094] The specific experimental process for detecting the function of the substantia nigra dopamine system in aged LRRK2.p.N1437D point mutation mice is as follows:

[0095] (1) In vivo imaging of dopamine transporters

[0096] The mice were fasted from food and water from 17:00 to 18:00 the day before the experiment, and DAT-PET-CT was performed from 9:00 to 12:00 on the day of the experiment. The mice were intraperitoneally injected with 11C-CFT at a dose of 100mCi / 10g body weight, and PET scans were performed 30 minutes after injection. Each mouse underwent 10-min PET and 10-min CT scans, and the SUVR values ​​of the striatum and cerebellum were calculated using PMOD v4.0 software.

[0097] (2) Staining of dopaminergic neurons in substantia nigra

[0098] After the mice were anesthetized with 1% sodium pentobarbital, they were perfused with 20 ml of pre-cooled 1xPBS, and then the brain was removed and the left and right hemispheres of the mice were cut from the sagittal plane. The left hemisphere was decomposed and stored in a -80 refrigerator as a sample for Western Blot, while the right hemisphere was quickly transferred to pre-cooled 4% PFA and fixed in a 4°C refrigerator for 2 days. After fixation, the hemispheres were dehydrated in 15 ml of 30% sucrose solution at 4°C for 2 days. After dehydration, they were embedded in OCT and subjected to 40 μm continuous frozen sections. After sectioning, the sections of the substantia nigra were first washed 3 times with 1xPBS for 10 minutes each time. After washing, the sections were blocked with donkey serum blocking solution at room temperature for 2 hours, and then incubated with TH antibody (Abcam, ab112, 1:500) at 4°C overnight. After washing 3 times with 1xPBS, the sections were then incubated with secondary antibody incubation solution supplemented with DAPI (1:10,000 of 5 mg / ml) and Donkey anti-rabbit 488 (1:500) at 4°C overnight. After the secondary antibody incubation, the sections were washed 3 times with 1xPBS and sealed with fluorescent mounting medium.

[0099] The results are as follows Figure 6 As shown, Figure 6 This is a diagram showing the effect of the N1437D point mutation on the substantia nigra dopamine system in LRRK2.p.N1437D point mutation mice in Example 1 and 17-18 month old and 26-27 month old mice. Figure 6 A is a representative image of DAT-PET of 17-18 month old mice; B is a representative image of DAT-PET of 26-27 month old mice; C is a relative quantitative image of dopamine transporter levels in striatum relative to cerebellum of 17-18 month old mice; D is a relative quantitative image of DAT-PET of striatum relative to cerebellum of 26-27 month old mice; E is a representative image of TH neuron staining in substantia nigra of 17-18 month old mice; F is a graph of TH neuron counts in substantia nigra of 17-18 month old mice; G is a representative image of TH neuron staining in substantia nigra of 26-27 month old mice; H is a graph of TH neuron counts in substantia nigra of 26-27 month old mice.

[0100] Figure 6In the figure, the results of A and C together indicate that there is no significant difference in the DAT-PET imaging results of 17-18 month old mice among WT, HET and HOMO mice; the results of B and D indicate that the dopamine transporter level in the dopamine system of HOMO mice aged 26-27 months was significantly decreased compared with that of WT mice; E and F indicate that the number of TH neurons in the substantia nigra of WT, HET and HOMO mice aged 17-18 months did not change significantly; G and H indicate that the number of TH neurons in the substantia nigra of HOMO mice aged 26-27 months was significantly decreased compared with that of WT mice. Figure 6 The PET imaging of dopamine transporters and the counting of TH neurons in the substantia nigra together indicate that the homozygous mice of the LRRK2.p.N1437D point mutation of the present invention do develop PD-related substantia nigra dopamine system damage at 26-27 months of age.

[0101] Based on the N1437D mutation (c.4309A>G; NM_98578) found in LRRK2 mutant PD patients, the present invention successfully constructed LRRK2.p.N1437D point mutation mice by introducing the N1437D mutation into mice using CRISPR / Cas9 technology, and the introduction of the N1437D point mutation does not change the expression abundance of LRRK2. The N1437D homozygous mice constructed by the present invention showed PD-related motor impairment such as decreased autonomous movement distance, weakened balance ability, decreased grip strength and walking gait degeneration at 25-26 months of age, and decreased dopamine transporters and reduced substantia nigra TH neurons were detected in HOMO mice at 26-27 months of age. For the first time, the PD-related motor impairment and PD pathological damage of LRRK2 point mutation KI mice were achieved without changing the expression abundance of LRRK2 and without relying on external pressure induction. Therefore, the present invention is not only a new LRRK2 point mutation mouse KI model, but also has an unparalleled advantage in simulation authenticity compared to the previous G2019S and R1441C KI models and LRRK2 mutation overexpression mouse models. This model can not only be used for the study of LRRK2 protein in Parkinson's disease and Parkinson's syndrome, but also provides a better research model for the development of LRRK2-related drugs.

[0102] The embodiment of the present invention also provides a kit for constructing a LRRK2.p.N1437D point mutation mouse model, comprising Guide RNA, Donor DNA, Cas9 mRNA, primer N1437D-P1-F, and primer N1437D-P2-R; the sequence of the Guide RNA is SEQ ID NO.1, the sequence of the Donor DNA is SEQ ID NO.2, the sequence of the primer N1437D-P1-F is SEQID NO.3, and the sequence of the primer N1437D-P2-R is SEQ ID NO.4.

[0103] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment, it is not used to limit the present invention. Any technician familiar with this patent can make some changes or modify the technical contents suggested above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the solution of the present invention.

Claims

1. A method for constructing a LRRK2.p.N1437D point mutation mouse model, characterized in that: The following steps are involved: The first step is to determine that the N1437D site to be mutated is located in exon 30 of the LRRK2 gene. According to the sequence of the N1437D site, Cas9 / gRNA is used to design the Guide RNA and the homologous repair template Donor DNA sequence; Constructing a specific target Guide RNA for exon 30 of the LRRK2 gene and transcribed it into Guide RNA in vitro; The sequence of Guide RNA transcribed in vitro in the first step is shown in SEQ ID NO.1; The homologous repair template Donor DNA sequence in the first step is shown as SEQ ID NO.2; In the second step, the Guide RNA, Donor DNA and Cas9 mRNA obtained in the first step are mixed to form an injection solution, which is then delivered into the nucleus of the fertilized egg of C57BL / 6J mice by fertilized egg microinjection; The third step is to transplant the surviving fertilized eggs obtained in the second step into the reproductive system of surrogate mice. The born mice are amplified by PCR using primers N1437D-P1-F and N1437D-P2-R, and then the amplified fragments are sequenced using N1437D-P1-F as a sequencing primer. The mice with positive sequencing are the F0 generation positive mice with gene editing carrying the LRRK2.p.N1437D mutation; The PCR primer and sequencing primer sequence of N1437D-P1-F in the third step is shown in SEQ ID NO.3; The sequence of the PCR primer N1437D-P2-R in the third step is shown in SEQ ID NO.4; In the fourth step, the F0 generation positive mice carrying the LRRK2.p.N1437D mutation obtained by gene editing in the third step are hybridized with C57BL / 6J wild-type mice, and then the amplified fragments are amplified by PCR using primers N1437D-P1-F and N1437D-P2-R, and then DNA sequencing is performed on the amplified fragments using N1437D-P1-F as a sequencing primer. The F1 generation offspring identified as sequencing positive can stably inherit; The fifth step is to self-pollinate the F1 generation heterozygous mice carrying the LRRK2.p.N1437D mutation stably obtained in the fourth step, or the F1 generation heterozygous mice carrying the LRRK2.p.N1437D mutation stably obtained in the fourth step, or the heterozygous offspring carrying the LRRK2.p.N1437D mutation obtained by crossing with C57BL / 6J wild-type mice, and after PCR amplification of N1437D-P1-F and N1437D-P2-R, use N1437D-P1-F as a sequencing primer to perform DNA sequencing on the amplified fragments, thereby obtaining LRRK2 wild-type mice, LRRK2.p.N1437D mutant heterozygous mice, and LRRK2.p.N1437D mutant homozygous mice of the same litter used for research and experiments.

2. Use of the LRRK2.p.N1437D point mutation mouse model constructed by the method of claim 1 in the preparation of a treatment for Parkinson's disease.

3. A kit for constructing a LRRK2.p.N1437D point mutation mouse model, comprising Guide RNA, Donor DNA, Cas9 mRNA, primer N1437D-P1-F, and primer N1437D-P2-R; the sequence of the Guide RNA is SEQ ID NO.1, the sequence of the Donor DNA is SEQ ID NO.2, the sequence of the primer N1437D-P1-F is SEQ ID NO.3, and the sequence of the primer N1437D-P2-R is SEQ ID NO.4.

Images