Molecular marker for identifying content of soluble solids in muskmelon fruits and application of molecular marker

Abstract

The invention discloses a molecular marker for identifying the content of soluble solids in muskmelon fruits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and the molecular marker is located in the second chromosome of muskmelon. The 37th site of the sequence as shown in SEQ ID NO.1 is an SNP site, and the site is binary allelic variation g / c. The allelic variation g of the SNP corresponds to the high soluble solid content, and the allelic variation c corresponds to the low soluble solid content. The invention further provides a CAPS molecular marker developed on the basis of the allelic variation and an application method thereof, the molecular marker can distinguish the content of soluble solids in muskmelon fruits, initial judgment of the sweetness of breeding materials or commercial variety fruits in the seedling stage is achieved, and the breeding cycle and the commercial variety selection time are greatly shortened. The invention further provides a specific primer pair of the CAPS molecular marker and application of a detection kit of the CAPS molecular marker.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker for identifying the soluble solid content of melon fruit and an application thereof. Background Art

[0002] melon( cucumis melo L. ) is an important crop of the Cucurbitaceae family. Its fruit is rich in vitamins and minerals and has high economic value. It is one of the top ten fruits in the world and has high nutritional and economic value. Although China has a long history of melon cultivation and ranks first in the world in terms of cultivated area and output, the quality of the fruit varies greatly, and market quality control urgently needs to be solved from the source.

[0003] The sweetness of melon fruit is an important flavor quality of melon. Sweetness is mainly determined by the soluble sugar content in the pulp, and soluble sugar is the main component of soluble solids. Visually measuring the soluble solids content in the pulp is an effective method for quickly identifying the sweetness of melon pulp. At present, there has been progress in the research on controlling the soluble solids content and sweetness of melon. Yang Yong et al. (2022) constructed an F2 population with "high sugar VZX × low sugar material HP" as parents, and used the BSA method to locate a QTL with a span of 3.29Mb on chromosome 8; using "USDa-846-1 × top Mark" as a parent to construct a recombinant inbred line, Shahwar et al. (2023) located QTLs related to soluble solids content on chromosomes 1, 2, 6, 7, 8, 9, and 10, respectively. The existing technology does not record the identification of the soluble solids content of fruit. This patent detected significant loci associated with the soluble solids content of melon fruit through whole genome association analysis, identified the genes and SNP variation sites that control the soluble solids content of melon fruit, developed a co-dominant CAPS marker, and verified it in natural melon populations. The results showed that the marker can be used to guide molecular marker-assisted breeding to identify the high and low soluble solids content of melon. Summary of the invention

[0004] The present invention provides a molecular marker for identifying the soluble solid content of melon fruit and its application, which is used to judge the soluble solid content of melon fruit in the seedling stage, preliminarily judge the sweetness of the fruit, and accelerate the breeding process of high-sugar melon.

[0005] The present invention provides a molecular marker for identifying the soluble solid content of melon fruit, named SSC-CAPS molecular marker, which is located at positions 21,807,825 to 21,808,062 of chromosome 2 of melon genome DHL92 v3.6.1, and the nucleotide sequence is shown in SEQ ID NO.1. MELO3C026992The promoter region of the gene (chr02:21802395..21807407), the coding sequence of the gene is shown in SEQ ID NO.2, and the promoter sequence is shown in SEQ ID NO.3.

[0006] As mentioned above, the SNP variation site is located at position 37 of the sequence shown in SEQ ID NO.1, and the SNP site is a c / g binary allele variation.

[0007] As mentioned above, at the SNP variation site, the average soluble solid content of the fruit of the melon material containing the allele variation c is low, while the average soluble solid content of the fruit of the melon material containing the allele variation g is high.

[0008] The present invention also provides a detection primer for a molecular marker for identifying the soluble solid content of melon fruit, the nucleotide sequence of the primer pair is shown in Table 2, and a restriction endonuclease taq1 capable of recognizing the above SNP site. The molecular marker belongs to a CAPS marker.

[0009] The present invention also provides a method for identifying the soluble solid content of melon fruit, which comprises the step of applying the above-mentioned molecular marker.

[0010] The above method for identifying the soluble solids content of melon fruit comprises the following steps: (1) Extracting genomic DNA from the melon sample to be tested; (2) Using the DNA obtained in step (1) as a template, PCR amplification is performed using the above-mentioned specific primers, and the amplified product is digested with Taq1 enzyme, subjected to electrophoresis and / or genomic sequencing.

[0011] (3) Determine the results of electrophoresis and / or genome sequencing according to step (2). The criteria are: If the electrophoresis product has a characteristic band with a length of 237bp, or a sequence as shown in SEQ ID NO.1, the sample has the trait of high soluble solids content of the fruit; if the electrophoresis product has a characteristic band with a length of 201bp, or a sequence as shown in SEQ ID NO.4, the sample has the trait of low soluble solids content of the fruit; if the electrophoresis product has two characteristic bands with lengths of 201bp and 237bp respectively, it means that the genotype of the sample is heterozygous.

[0012] Effect: The nucleotide sequence of the molecular marker provided by the present invention is shown in SEQ ID NO.1, the SNP site is located at the 37th position of the sequence shown in SEQ ID NO.1, the SNP site is c / g, the allele variation of the fruit with high soluble solid content is g, and the allele variation of the fruit with low soluble solid content is c, and a CAPS marker capable of identifying the SNP site is developed. The molecular marker provided by the present invention can be used to identify the high and low soluble solid content of melons, distinguish between melons with high soluble solid content and melons with low soluble solid content, realize the judgment of melon materials with high soluble solid content at the seedling stage, preliminarily screen high-sugar melon materials, and accelerate the breeding process of high-sugar melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the SNP density distribution map of melon germplasm used for genome-wide association analysis.

[0014] Figure 2 This is the Manhattan plot of the genome-wide association analysis of the soluble solids content trait of melon fruit, where the horizontal axis represents the genomic position of each variant site; the vertical axis represents each marker site under the MLM model P The negative logarithm of the value with base 10; the red horizontal dotted line represents the threshold; the red box represents the significant association site mined.

[0015] Figure 3 This is the QQ plot of the genome-wide association analysis of the soluble solids content trait of melon fruit, where the horizontal axis represents the negative logarithm of the expected observed P value with the assumption that the P value follows a uniform [0, 1] distribution with the base 10; the vertical axis represents the negative logarithm of the observed P value with the base 10.

[0016] Figure 4 Schematic diagram of the structure of the associated gene and the SNP variation site in the promoter region of the gene (chr02_21807861).

[0017] Figure 5 It is the restriction endonuclease cleavage site of the SSC-CAPS molecular marker.

[0018] Figure 6 This is a box plot of the soluble solid content of the three genotypes of the sample fruits corresponding to the SNP variant site chr02_21807861; *** represents p <0.001.

[0019] Figure 7 Sequence alignment of SSC-CAPS labeled primer e-PCR products of five de novo sequencing materials.

[0020] Figure 8This is a gel image of the polyacrylamide gel electrophoresis separation of the PCR product of the SSC-CAPS molecule marker after digestion with the restriction endonuclease taq1, wherein the M lane represents the Marker (2000×), lanes 1-7 are melon samples with high soluble solid content; lanes 8-14 are melon samples with low soluble solid content.

[0021] In the sequence list: SEQ ID NO.1 is the nucleotide sequence (237 bp) of the SSC-CAPS molecular marker.

[0022] SEQ ID NO.2 is the gene MELO3c026992 Coding sequence (1569 bp).

[0023] SEQ ID NO.3 is gene MELO3c026992 Promoter sequence (2000bp).

[0024] SEQ ID NO.4 is the nucleotide sequence (201 bp) after SSC-CAPS molecular marker digestion. DETAILED DESCRIPTION

[0025] The present invention is further described below with reference to the examples. The experimental methods in the following examples without specifying specific conditions are generally carried out according to the known methods in the art. The reagents and consumables in the examples, unless otherwise specified, can be purchased from commercial sources. Example 1 Mining SNP sites significantly associated with soluble solids content in melon fruit

[0026] 1. Acquisition of phenotypic data: The research materials are 200 core melon germplasm materials with rich polymorphism, including 164 cultivated varieties and 36 wild materials, selected from the National Watermelon and Melon Germplasm Mid-term Bank (Zhengzhou, China). They were planted in the scientific research base of Maozhuang Science and Education Park of Henan Agricultural University in Zhengzhou in 2017, 2018 and 2023, respectively. Each year, 5-10 plants of each material were planted in spring and autumn. After the fruit matured, well-developed mature fruits were selected to determine their pulp soluble solid content (SSC), with three biological replicates. The 6 phenotypic data were fitted and used for subsequent genome-wide association analysis (GWAS analysis) (Table 1).

[0027]

[0028] 2. Acquisition of SNP genotype data: 200 core germplasm materials of melon were used as the GWAS analysis population. The total DNA of the population materials was extracted using the modified CTAB method. After ultrasonic disruption, fragments of 300 bp were screened by electrophoresis. The library was constructed by PCR amplification, and the libraries that passed the quality inspection were sequenced (Illumina). After obtaining the raw data, Raw Reads adapters, random primers were removed, and low-quality reads were filtered. The processed clean-Reads were aligned to the melon DHL92 v3.6.1 reference genome to obtain whole-genome variation information. The variation information was quality controlled, and the quality control standards were: the maximum SNP deletion rate was greater than 80% and the minimum allele frequency was greater than 5%. After quality control, 2,538,320 valid SNPs were obtained, and the effective length of the whole genome was 375,356,489 bp. On average, there was 1 SNP variation for every 147 bases on the chromosome. The density and distribution of whole-genome variation information markers are as follows: Figure 1 , Table 2. Based on this, the data were standardized by IDAK software to calculate the covariance matrix and decompose the eigenvalues ​​to finally obtain the data after dimensionality reduction. The data with the principal component of 5 was used as covariates. At the same time, IDAK was used to estimate the kinship between two individuals in the population and establish the kinship K-matrix for subsequent GWAS analysis.

[0029]

[0030] 3. Discovery of SNP loci significantly associated with soluble solids content in melon: GWAS analysis was performed using the mixed linear model (MLM) of TASSEL 5.0 software, combining the above phenotypic data and SNP genotype data. When the P value of the detected variant loci was less than 3.94×10 -7 When the gene is found, it is considered to be a significant association site. The Manhattan plot (Figure 2) and QQ plot (Figure 3) of the P value of the whole genome site were drawn using R packages. The results showed that the soluble solids content trait of melon fruit formed a peak on chromosome 2, and the QQ plot fitting was consistent, proving that the results of the association analysis were accurate. The site of the Lead_SNP peak on chromosome 2 is: chr02_21469098. Through gene function annotation, a gene candidate was found near 0.34 Mb of Lead_SNP. MELO3C02699 (chr02:21802395..21807407). This gene encodes sugar transporter protein, STP Gene (Figure 4), which plays an important role in plant sugar transport, growth and development. STP The gene was sequenced and a SNP mutation was found in its promoter region (chr02_21807861:c>g, Figure 5 ).

[0031] 4. Genotype and phenotype analysis: Allelic variation analysis was performed on the SNP site chr02_21807861 in the GWAS analysis population, and it was found that the site was a binary allele variation c / g. There were three genotypes at this site in the population, namely gg, cg and cc. Among them, the gg and cc genotypes accounted for 91%, which were the main genotypes in the population, indicating that the population had a high degree of homozygosity at this SNP site. The SSC phenotypes of the materials corresponding to the three genotypes of this site were analyzed. The results showed that the average soluble solids content of the cc genotype was 6.43%, the average soluble solids content of the gg genotype was 8.17%, and the average soluble solids content of the cg genotype was 7.15%. The one-way ANOVA test method was used to analyze the significance of the difference in soluble solids content, and it was found that the soluble solids content of the fruit of the material with the genotype of gg was significantly higher than that of the fruit of the material with the genotype of cc ( p <0.001) (Figure 6). Further analysis showed that the average soluble solids content of melon fruits containing only allele g at SNP site chr02_21807861 was 8.12%, while the average soluble solids content of melon fruits containing only allele c was 6.49%.

[0032] The SNP site chr02_21807861 provided in this example is related to the soluble solid content trait of melon, and the nucleotide sequence is shown in SEQ ID NO.1. At the same time, the molecular marker is located on the chromosome MELO3C026992 The promoter region of the gene (chr02:21802395..21807407), the coding sequence of the gene is shown in SEQ ID NO.2, and the promoter sequence is shown in SEQ ID NO.3. Example 2 Verification of the binary variation g / c of ​​SNP site chr02_21807861 in high-quality sequencing materials

[0033] 1. Collect 5 melon materials that have completed de novo sequencing, namely, high sucrose accumulation materials DHL92, Harukei-3, Payzawat and charmono (http: / / cucurbitgenomics.org / v2), low sucrose accumulation material IVF77 (http: / / cucurbitgenomics.org / v2), these 5 materials have obvious differences in fruit soluble solid content, as shown in Table 3. The ePCR reaction of the marker primers for the soluble solid content of melon fruit was performed on their genomes, and the amplification products are shown in Figure 7. The ePCR amplification results showed that there was a c / g variation at the 37th SNP site, proving that the marker can distinguish high-sugar and low-sugar melon materials.

[0034] Example 3 Analysis of SNP mutation site-specific restriction sites and development of CAPS markers

[0035] 1. Specific restriction site analysis: According to the SNP variation site (chr02_21807861) obtained in Example 1, the sequence of the site was extracted (200 bp at each end): tttatttaattcctaatttcatgatttaccataattttaaccttgatttttaattgaaatattcattatctttttgtttttaaaatgtctttctgatttttgtatgttttacttcataaatgaaaaggattatttgttgtttggttgatgtgtattttaaaatcgatgat tttggtcactctttacaaagagggtctttt[c / g]gaaagtatactgtggggggtttaatttgtaaagttagaagaattgtttagtctctgcataactcaaattcaagactaaggagtcataaaattgaggggtttaatttgtaaagttagaagaattgtttagtctctgcataactcaaattcaagactaaggagtcataaaattgatatttattactgacgggatcaacacct. The restriction endonuclease information caused by chr02_21807861 was searched by using the online enzyme recognition software dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html), and the endonuclease taq1 was selected, and the enzyme recognition sequence of the enzyme was tcga.

[0036] 2. Primer design: PCR primers were designed using Primer3 (v.0.4.0) (https: / / bioinfo.ut.ee / primer3-0.4.0 / ) software. The product length was 80-400 bp. Based on this, a pair of specific primers were designed, as shown in Table 4.

[0037] Example 4 Application of CAPS molecular markers in other melon materials

[0038] 1. Preparation of samples to be tested: 14 randomly selected melon breeding materials were used as samples, of which 7 were high soluble solid content materials and 7 were low soluble solid content materials (Table 5). Seeds of the 14 melon materials were taken and germinated and raised according to conventional methods. When the seedlings grew to the two-leaf and one-heart stage, the heart leaves were removed and their genomic DNA was extracted using the modified CTAB method for later use.

[0039]

[0040] 2. PCR amplification: The specific primers designed in Example 2 were used to perform PCR amplification on the 14 melon sample DNAs in Table 4. The amplification system was 10 μL, including: 1 μL DNA template, 0.5 μL of the forward and reverse primers of the SSC-CAPS molecular marker, 5 μL of 2× Phanta Flash Master Mix, and 3 μL of ddH2O. The PCR amplification program was: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 50°C annealing for 5 s, 72°C extension for 5 s, for a total of 33 cycles; 72°C extension for 1 min. The PCR product was detected by agarose gel electrophoresis, and a single band was obtained, indicating that the primer specificity was good, and the length of the PCR amplification product was 237 bp.

[0041] 3. Enzyme digestion of amplified products: The above PCR amplified products were digested with restriction endonuclease taq1. The digestion system was 10 μL, including: 1 μL restriction endonuclease taq1, 5 μL PCR amplified products, 2 μL 10×NEBuffer, and 2 μL ddH2O. The digestion procedure was: incubate at 65℃ for 3 hours. The digested products were electrophoresed on a 7% polyacrylamide gel. The electrophoresis results were as follows: Figure 8As shown. The electrophoresis results showed that there were differences in electrophoretic bands between melon materials with high soluble solid content and low soluble solid content. In melon materials with low soluble solid content, the PCR amplification products could form two bands of 201 bp and 36 bp after enzyme digestion, but only the 201 bp band was detected by electrophoresis (the 36 bp band was too short and migrated out of the gel in a very short time during electrophoresis and could not be detected). In melon materials with high soluble solid content, the PCR amplification products could not be digested by enzymes, and the electrophoresis showed that the band size was 237 bp.

[0042] Therefore, by using the SSC-CAPS molecular marker provided in Example 3, it is possible to distinguish the high and low soluble solids content of melon fruits at the seedling stage, realize the rapid screening of high-sweetness melon breeding materials, and accelerate the breeding process of melon varieties.

[0043] In summary, the above implementation scheme is only a general description of the present invention, but the protection scope of the present invention is not limited thereto. Improvements and changes can be made without departing from the essence of the present invention, but they should fall within the scope of protection required by the present invention.

Claims

1. A molecular marker for identifying the soluble solids content of melon fruit, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, which is located on chromosome 2 of melon. The 37th SNP of the nucleotide sequence shown in SEQ ID NO.1 has a c / g binary polymorphism.

2. The molecular marker for identifying the soluble solids content of melon fruit according to claim 1, characterized in that: Molecular marker loci are located at MELO3C026992 The promoter sequence of the gene, the coding sequence of the gene is shown as SEQ ID NO.2, and the promoter sequence is shown as SEQ ID NO.

3.

3. The molecular marker for identifying the soluble solids content of melon fruit according to claim 1, characterized in that: The molecule is labeled with a CAPS marker; The forward primer sequence was 5′-gatgattttggtcactctttacaa-3′; The reverse primer sequence was 5′-aggtgttgatcccgtcagtaa-3′; The restriction endonuclease was taq1.

4. Use of the molecular marker according to claim 1 in identifying the soluble solids content of melon fruit.

5. An identification method using the molecular marker according to claim 1, characterized in that: The following steps are involved: Step 1: Extraction of genomic DNA from the tested melon samples; Step 2: Using the DNA obtained in step 1 as a template, performing PCR amplification using the CAPS molecular marker primers described in claim 3, and performing enzyme digestion, electrophoresis and / or genome sequencing on the amplified product using Taq1 enzyme; Step 3: Determine the results of electrophoresis and / or genome sequencing according to step 2. The criteria are: If the electrophoresis product has a characteristic band with a length of 237bp, or a sequence as shown in SEQ ID NO.1, the sample has the trait of high soluble solids content of the fruit; if the electrophoresis product has a characteristic band with a length of 201bp, or a sequence as shown in SEQ ID NO.4, the sample has the trait of low soluble solids content of the fruit; if the electrophoresis product has two characteristic bands with lengths of 201bp and 237bp respectively, it means that the genotype of the sample is heterozygous.

6. A kit for identifying the soluble solids content of melon fruit, characterized in that: Comprising the molecular marker described in claim 3.

Images