LPA inhibitors and uses thereof

Abstract

Provided is an RNA inhibitor for inhibiting the expression of an LPA gene or a pharmaceutically acceptable salt thereof, comprising a complementary region of an antisense strand, the complementary region comprising at least 15 contiguous riboxic acids wherein the antisense strand comprises the following riboxic acid sequence: any one of the sequences of SEQ ID NO.414-418, a sequence having the same at least 15 contiguous riboxic acids as in the SEQ ID NO.414-418, or a sequence having the same at least 15 contiguous riboxic acids as in the SEQ ID NO.414-418, or a sequence having the same at least 15 contiguous riboxic acids as in the SEQ ID NO.414-418 as in the SEQ ID NO.414-418. Or a sequence having no more than three different riboxic acids from the aforementioned sequence. The RNA inhibitor directly degrades LPA mRNA, continuously and efficiently inhibits LPA gene expression, and can be used for treating or preventing LPA gene-mediated related cardiovascular and cerebrovascular diseases.

Description

LPA inhibitors and uses thereof

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202210241706.1, filed with the State Intellectual Property Office of China on March 11, 2022, and entitled “LPA inhibitors and their uses,” the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present application relates to the field of biomedicine, and specifically to an RNA inhibitor for inhibiting LPA gene expression and its application. Background Art

[0004] RNAi

[0005] RNAi (RNA interference) was discovered in 1998 by Andrew Z. Fire and others while conducting antisense RNA inhibition experiments in Caenorhabditis elegans. This process was named RNAi. This discovery was named one of the top ten scientific advances of 2001 by Science magazine and ranked first among the top ten scientific advances of 2002. Since then, siRNAs, which act through RNAi, have garnered widespread attention as potential gene therapy drugs. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNAi mechanisms. RNAi is triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During RNAi, an endonuclease called Dicer cuts or "dices" long dsRNA into smaller fragments of 21 to 25 nucleotides. These small fragments, called small interfering RNA (siRNA), have their antisense strands (Guide strands) loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex composed of Argonaute protein, Dicer, and dsRNA binding protein (TRBP for short). During the loading process, the positive strand (Passenger strand) is cleaved and expelled by AGO2. AGO2 then uses the antisense strand to bind to mRNA containing a completely complementary sequence and then catalyzes the cleavage of these mRNAs, causing the mRNA to split and lose its role as a translation template, thereby preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.

[0006] According to statistics, over 80% of disease-related proteins in the human body cannot be targeted by currently available small-molecule drugs or biopharmaceuticals, making them undruggable proteins. Gene therapy, which aims to treat diseases through gene expression or silencing, is considered by the industry to be the third generation of therapeutics, following small-molecule and biopharmaceutical drugs. This approach treats diseases at the genetic level, unhindered by the constraints of undruggable proteins. As the most mainstream type of gene therapy, RNAi targets diseases at the mRNA level, offering greater efficacy than small-molecule and biopharmaceutical drugs that target proteins. RNAi allows the design of highly specific and potent inhibitory siRNA sense and antisense strands based on specific gene sequences. These single-stranded sequences are synthesized through solid-phase synthesis. The sense and antisense strands are then combined in a specific annealing buffer according to base pairing principles to form siRNA. Finally, siRNA is delivered to the target site in the body via a vector system, where it degrades the target mRNA, disrupting its function as a translation template and thereby preventing the synthesis of the associated protein.

[0007] siRNA delivery system

[0008] siRNA is unstable in blood and tissues and easily degraded by nucleases. To improve siRNA stability, both the sense and antisense strands can be modified. However, these chemical modifications provide only limited protection from nuclease degradation and may ultimately affect siRNA activity. Therefore, a suitable delivery system is required to ensure the safe and efficient passage of siRNA across the cell membrane. Due to its large molecular weight, high negative charge, and high water solubility, siRNA cannot successfully cross the cell membrane and enter the cell on its own.

[0009] Liposomes, with their basic structure consisting of a hydrophilic core and a phospholipid bilayer, possess a phospholipid bilayer similar to biological membranes and possess high biocompatibility. This is why liposomes have become the most popular and widely used siRNA delivery method. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within the liposome, protecting it from nuclease degradation and enhancing its efficiency across cell membrane barriers, thereby promoting cellular uptake. Examples include anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipids. While some progress has been made, liposomes themselves are prone to inflammatory responses, necessitating the use of multiple antihistamines and hormones, such as cilitidine and dexamethasone, prior to administration to mitigate potential acute inflammatory reactions. Therefore, liposomes are not suitable for all therapeutic areas in clinical practice. This is particularly true for diseases with long treatment cycles, such as chronic hepatitis B, where the potential for cumulative toxicity with long-term use is a potential safety concern. Therefore, a safer and more effective delivery system for siRNA is needed.

[0010] The asialoglycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed on hepatocytes and is a highly efficient endocytic receptor. Because galactose residues are exposed at the penultimate end of various glycoproteins after enzymatic or acidic hydrolysis of sialic acid in the body, ASGPR specifically binds to galactosyl groups, hence its name, the galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine all have a high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as asialoglycoproteins and lipoproteins from the blood, and it is closely associated with the development and progression of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR has played a significant role in the diagnosis and treatment of liver diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Liver-derived disease therapeutic drugs containing galactose or galactosamine and their derivatives in their structures can specifically bind to ASGPR, thereby having active liver targeting and requiring no other carrier system for delivery.

[0011] LPA and Lp(a)

[0012] LPA is the name of the gene encoding apolipoprotein (a) (apo(a)). It is primarily expressed in the liver, with expression restricted to humans and non-primates. Apolipoprotein (a) is attached to apo(B)-100 via a disulfide bond, forming a lipid core that forms the lipoprotein (a) (Lp(a)) particle. Lp(a) particles are specialized, large cholesterol-rich lipoproteins with a surface coated with cholesterol and phospholipids and embedded with the hydrophilic apolipoprotein components apolipoprotein (a) and apo(B)-100. Lp(a) can enter and deposit on blood vessel walls, promoting atherosclerosis. Lp(a) shares structural homology with plasminogen (PLG) and can compete with plasminogen for binding sites on fibrin, thereby inhibiting fibrinogen hydrolysis and promoting thrombosis. Therefore, Lp(a) is closely associated with atherosclerosis and thrombosis. Studies have shown that Lp(a) levels in the blood are an independent risk factor for cardiovascular disease, stroke, and atherosclerotic stenosis.

[0013] Elevated Lp(a) levels are primarily genetic and do not significantly change with diet, exercise, or other lifestyle changes. An Lp(a) level greater than 300 mg / L in humans is considered elevated. Elevated Lp(a) levels often indicate a significantly increased risk of atherosclerosis and thrombosis. Testing Lp(a) is crucial for early identification of atherosclerosis risk. Approximately 330 million people in China currently suffer from cardiovascular disease, but public awareness, treatment, and control rates of dyslipidemia remain low. Awareness of the risks of Lp(a) is even lower. Most hospitals do not routinely include this level of lipid testing in their blood. Currently, no targeted therapeutic drugs are available clinically, domestically, or internationally. Therefore, there is an urgent need for effective treatments in this area.

[0014] Summary of the Invention

[0015] The purpose of the present application is to provide an LPA RNA inhibitor that interferes with LPA mRNA, destroying its function as a translation template and preventing the formation of Lp(a) particles. The inhibitor can continuously and efficiently inhibit LPA gene expression and effectively reduce Lp(a) levels. It is a highly effective drug for treating diseases caused by LPA gene expression.

[0016] In one aspect, the present invention provides an RNA inhibitor for inhibiting LPA gene expression, or a pharmaceutically acceptable salt thereof, comprising an antisense strand complementary region comprising at least 15 consecutive nucleotides, wherein the antisense strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 414-418, a sequence identical to any one of SEQ ID NOs. 414-418 by at least 15 consecutive nucleotides, or a sequence differing from any of the aforementioned sequences by no more than three nucleotides. It should be noted that the scope of protection of the present invention is not limited to any one of SEQ ID NOs. 414-418, but also includes sequences identical to any one of SEQ ID NOs. 414-418 by at least 15 consecutive nucleotides, or sequences differing from any of the aforementioned sequences by at most 3 nucleotides. The aforementioned sequence refers to any one of SEQ ID NOs. 414-418, or a sequence identical to any one of SEQ ID NOs. 414-418 by at least 15 consecutive nucleotides.

[0017] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the positive strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 396-400, a sequence having at least 15 consecutive nucleotides identical to those in SEQ ID NOs. 396-400, or a sequence having no more than three different nucleotides from the above sequence.

[0018] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the sense strand and the antisense strand are selected from any one or more of the following combinations:

[0019] 1) Sense strand: ugguaauggacagaguuauuu (SEQ ID NO. 396), antisense strand: auaacucuguccauuaccauu (SEQ ID NO. 414);

[0020] 2) Sense strand: acagaguuaucgaggcucatt (SEQ ID NO. 397), antisense strand: ugagccucgauaacucuguuu (SEQ ID NO. 415);

[0021] 3) Sense strand: guaauggacagaguuaucgau (SEQ ID NO. 398), antisense strand: cgauaacucuguccauuacca (SEQ ID NO. 416);

[0022] 4) sense strand: gccccuugguguuauacaa (SEQ ID NO. 399), antisense strand: uuguauaacaccaaggggcug (SEQ ID NO. 417); and

[0023] 5) Sense strand: gcuccuuauuguuauacga (SEQ ID NO. 400), antisense strand: ucguauaacaauaaggagcug (SEQ ID NO. 418).

[0024] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein one or more nucleotides on the sense strand and / or antisense strand are modified to form a modified nucleotide sequence.

[0025] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the sense strand and the antisense strand are selected from any one or more of the following combinations:

[0026] 1) Sense strand: UsGsGUfAAfUfGfGACAGAGUUAUsUsU (SEQ ID NO. 456), antisense strand: AsUsAACUfCUGUCfCAfUUACCAsUsU (SEQ ID NO. 492);

[0027] 2) Sense strand: AsCsAGfAGfUfUfAUCGAGGCUCAsTsT (SEQ ID NO. 457), antisense strand: UsGsAGCCfUCGAUfAAfCUCUGUsUsU (SEQ ID NO. 493);

[0028] 3) Sense strand: GsUsAAfUGfGfAfCAGAGUUAUCGsAsU (SEQ ID NO. 460), antisense strand: CsGsAUAAfCUCUGfUCfCAUUACsCsA (SEQ ID NO. 496);

[0029] 4) Sense strand: GsCsfCCfCUfUfGfGUfGUfUAfUACsAsA (SEQ ID NO. 463), Antisense strand: UsfUsGfUAfUAfACACCAfAGfGGGCsUsG (SEQ ID NO. 499); and

[0030] 5) Sense strand: GsCsfUCfCUfUfAfUUfGUfUAfUACsGsA (SEQ ID NO. 465), antisense strand: UsfCsGfUAfUAfACAAUAfAGfGAGCsUsG (SEQ ID NO. 501);

[0031] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate.

[0032] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is selected from one or more of Ky11-DS38, Ky11-DS39, Ky11-DS42, Ky11-DS45 and Ky11-DS47.

[0033] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof further comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0034] The aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is selected from one or more of Ky11-DS71 and Ky11-DS7101 to Ky11-DS7109.

[0035] On the other hand, the present invention also provides a pharmaceutical composition comprising the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0036] In one aspect, the present invention also provides the following technical solution: use of the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof and the aforementioned pharmaceutical composition in the preparation of a drug, wherein the drug is used to prevent or treat a disease or pathology or reduce the risk of a disease or pathology. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0038] FIG1 shows the LPA mRNA inhibition effect (%) of the RNAi inhibitor in Example 2 of the present application in HepG2 cells;

[0039] FIG2 shows the LPA mRNA inhibitory effect (%) of the RNAi inhibitor in Example 3 of the present application in HepG2 cells;

[0040] FIG3 shows a high-resolution mass spectrum of ERCd-01-c2 synthesized in Example 4, 1.1.5 of the present application;

[0041] FIG4 shows the high-resolution mass spectrum of 3'MVIP17-c1 synthesized in Example 4, 1.2.6 of the present application;

[0042] FIG5 shows the high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 synthesized in Example 4, 2.1.2 of the present application;

[0043] FIG6 shows the LPA mRNA inhibition effect (%) of the RNAi inhibitor in Example 6 of the present application in PCH cells;

[0044] FIG7 shows the LP(a) protein level (%) in cynomolgus monkeys in Example 7 of the present application;

[0045] FIG8 shows the LDL-C protein level (%) in cynomolgus monkeys in Example 7 of the present application;

[0046] FIG. 9 shows the LP(a) protein levels (%) in cynomolgus monkeys using the RNA inhibitors of different 5'MVIP / 3'MVIP combinations described in Example 8 of the present application. DETAILED DESCRIPTION

[0047] The following describes the implementation of the present invention through specific embodiments. People familiar with this technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0048] Definition of terms

[0049] In this application, the terms "iRNA," "RNAi agent," "iRNA agent," "RNA interfering agent," and "RNA inhibitor" are used interchangeably and generally refer to agents that contain RNA, as the terms are defined herein, and that can mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNAs through a process known as RNA interference (RNAi). iRNAs regulate (e.g., inhibit) expression of the LPA gene in cells (e.g., cells in a subject, such as a mammalian subject).

[0050] In certain embodiments, the RNAi agent may be a single-stranded siRNA (ssRNAi) that is introduced into a cell or organism to inhibit a target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15 to 30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150: 883-894, the entire contents of each of which are incorporated herein by reference.

[0051] In certain embodiments, the "iRNA" used herein is double-stranded RNA and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target RNA (i.e., the LPA gene). In some embodiments of the present application, double-stranded RNA (dsRNA) triggers degradation of a target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0052] The duplex structure can be any length that allows for specific degradation of the desired target RNA by the RISC pathway, and can be in the range of about 19 to 36 base pairs, for example, about 19-30 base pairs in length, for example, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 base pairs in length. Ranges and lengths intermediate to the above ranges and lengths are also included as part of this application. In certain embodiments, the iRNA agent of the present application is a dsRNA having 15-23 nucleotides in each chain that interacts with a target RNA sequence (e.g., an LPA gene) to guide the cutting of the target RNA. In certain embodiments, the iRNA of the present application is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence (e.g., an LPA target mRNA sequence) to guide the cutting of the target RNA.

[0053] Typically, the majority of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each strand or both strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides or modified nucleotides. In addition, "iRNA" as used herein may include ribonucleotides having chemical modifications; iRNA may include substantial modifications at multiple nucleotides. As used herein, the term "modified nucleotide" means a nucleotide independently having a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase, or any combination thereof. Thus, the term "modified nucleotide" encompasses substitutions, additions, or removals of, for example, functional groups or atoms of an internucleotide linkage, a sugar moiety, or a nucleobase. Modifications suitable for use in the present application's agents include all types of modifications disclosed herein or known in the art.

[0054] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) of any length. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents and primers. Polynucleotides can be modified or substituted with any of the various modifications described herein or known in the art at one or more bases, sugars and / or phosphates. Polynucleotides can include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure can be modified before or after polymer assembly. The nucleotide sequence can be blocked by non-nucleotide components. Polynucleotides can be modified after polymerization, for example, by coupling with a labeling component. The term can include both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present application as a polynucleotide includes both the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.

[0055] As used herein, the term "target nucleic acid" or "target sequence" generally refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the LPA gene, including mRNAs that are RNA processing products of the primary transcription product. The target portion of the sequence should be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the LPA gene. In one embodiment, the target sequence is within the protein-coding region of LPA. The target sequence can be approximately 19-36 nucleotides in length, for example, preferably approximately 19-30 nucleotides in length. Ranges and lengths intermediate to the aforementioned ranges are also encompassed by this application.

[0056] In this application, the term "nucleotide sequence" generally refers to a series or order of nucleobases, nucleotides and / or nucleosides, whether modified or unmodified, described by a series of letters using standard nucleotide nomenclature and the symbols for modified nucleotides described in this application.

[0057] In this application, the term "oligonucleotide" generally refers to a polymer composed of a plurality of nucleotide residues (deoxyribonucleotides or ribonucleotides, or their relevant structural variants or synthetic analogs) connected by a phosphodiester bond (or their relevant structural variants or synthetic analogs). Therefore, although the term "oligonucleotide" generally refers to a naturally occurring nucleotide polymer in which the nucleotide residues and the connection therebetween are naturally occurring, it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methylphosphonates, 2-O-methylribonucleic acids, etc. The exact size of the molecule can depend on specific applications. Oligonucleotides are generally shorter in length, typically having approximately 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotides" or "nucleic acids" are generally used for larger oligonucleotides.

[0058] In certain embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides. The term "modified oligonucleotide" generally refers to an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0059] In this application, the term "modified nucleoside" generally means a nucleoside that contains at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. The modified nucleoside contains a modified sugar moiety and / or a modified nucleobase.

[0060] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Nucleotides may include modified nucleotides or nucleotide mimetics, abasic sites (Ab or X) or substitute replacement moieties. As used herein, a "nucleobase sequence" generally refers to the order of consecutive nucleobases that are independent of any sugar, linkage or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G); and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C) and uracil (U). "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.

[0061] In this application, the term "sugar moiety" generally refers to a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally refers to a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. A "modified sugar moiety" refers to a substituted sugar moiety or a sugar surrogate.

[0062] In this application, the term "internucleoside linkage" generally refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0063] As used herein, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding segment of a target nucleic acid (e.g., a target genomic sequence, mRNA precursor, or mRNA molecule). In certain embodiments, the antisense oligonucleotide is 12 to 30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to a target nucleic acid (e.g., LPA polynucleotide).

[0064] In the present application, the term "antisense strand" generally refers to a strand comprising a region that is substantially complementary to a target sequence of an RNAi agent (e.g., dsRNA). As used herein, the term "region of complementarity" generally refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence). When the region of complementarity is not fully complementary to the target sequence, mispairing can occur in the interior or terminal regions of the molecule. Typically, the most tolerated mispairing is in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' end and / or 3' end.

[0065] In this application, the term "sense strand" (S) generally refers to a strand of an RNAi agent that includes a region that is substantially complementary to the region of the antisense strand as defined herein. A "sense" strand is sometimes referred to as a "sense" strand, a "passenger" strand, or an "anti-guide" strand. By means of their sequence, the antisense strand targets the desired mRNA, while the sense strand targets different targets. Therefore, if the antisense strand is incorporated into RISC, the correct target is targeted. The incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications or using 5' end caps on the sense strand.

[0066] In this application, the term "complementary" when used to describe a first nucleotide sequence (such as an RNAi agent sense strand or LPA mRNA) with respect to a second nucleotide sequence (such as an RNAi agent antisense strand) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, as long as the above requirements for their hybridization ability are met. "Complementary" does not necessarily have nucleobase complementarity at every nucleoside. On the contrary, some mismatches can be tolerated.

[0067] As used herein, the term "fully complementary" generally means that all (100%) of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a portion of the first or second nucleotide sequence. As used herein, "partially complementary" generally means that in a hybridizing nucleobase sequence pair, at least about 70% of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. As used herein, "substantially complementary" generally means that in a hybridizing nucleobase sequence pair, at least about 90% of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. As used herein, the terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base matching between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of LPA mRNA. Sequence identity or complementarity is independent of modification. For purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A.

[0068] In this application, the term "homologous" or "homology" generally refers to the number of nucleotides of a subject nucleic acid sequence that have been matched to the same nucleotides of a reference nucleic acid sequence, typically determined by sequence analysis programs (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877), or by visual inspection. As used herein, the term "complete homology" or "complete homology" generally refers to complete (100%) homology or "identity" between a reference sequence and a subject nucleic acid sequence. As used herein, the terms "substantially homologous" or "substantial homology" generally refer to nucleotides that are at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) homologous to the subject sequence and the nucleotides at the same nucleotide position in the reference sequence.

[0069] In this application, the term "ligand" generally refers to any compound or molecule that can be covalently or otherwise chemically bound to a biologically active substance (such as an oligonucleotide). In certain embodiments, a ligand can interact directly or indirectly with another compound, such as a receptor. The receptor that interacts with the ligand can be present on the cell surface, or alternatively can be an intracellular and / or intercellular receptor. The interaction of the ligand with the receptor can result in a biochemical reaction, or can be simply a physical interaction or binding.

[0070] Throughout this application, terms such as "induce," "inhibit," "enhance," "elevate," "increase," "reduce," and "lower" generally refer to a quantitative difference between two states. For example, "an amount effective to inhibit the activity or expression of LPA" means that the level of LPA activity or expression in a treated sample will be lower than the level of LPA activity or expression in an untreated sample. These terms apply, for example, to both expression and activity levels. The terms "reduce" and "reduce" are used interchangeably and generally refer to any change that is less than the original level. "Reduce" and "reduce" are relative terms, requiring a comparison between before and after a measurement. "Reduce" and "reduce" encompass complete depletion.

[0071] In certain embodiments, the term "reduce" refers to a gene, gene product, such as a protein or biomarker, that can be detected by standard methods known in the art (such as those described herein) and an overall reduction of about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% of the expression level / amount of a gene, gene product, such as a protein or biomarker in a first sample compared to the expression level / amount of a corresponding gene, gene product, such as a protein or biomarker in a second sample. In certain embodiments, the term "reduce" refers to a reduction in the expression level / amount of a gene or biomarker in a first sample, wherein the reduction is at least about 0.9 times, 0.8 times, 0.7 times, 0.6 times, 0.5 times, 0.4 times, 0.3 times, 0.2 times, 0.1 times, 0.05 times or 0.01 times of the expression level / amount of a corresponding gene or biomarker in a second sample. In certain embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.

[0072] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (eg, splicing, polyadenylation, addition of a 5'-cap), and translation.

[0073] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0074] In this application, the term "lipid nanoparticle" or "LNP" generally refers to a nanoparticle comprising an encapsulated pharmacologically active molecule (such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which the iRNA is transcribed). LNP is described, e.g., in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0075] The term "crab-eating macaque" is also known as: crab-eating macaque (scientific name: Macaca fascicularis); also known as long-tailed macaque.

[0076] In this application, the term "prevention and / or treatment" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated therewith and / or preventing further increase in the severity of the disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by the disease, and generally any pharmacological effect that is beneficial to the patient being treated. The RNAi agent or pharmaceutical composition of the present application does not need to achieve a complete cure or eradication of any symptoms or manifestations of the disease to form a viable therapeutic agent. As recognized in the relevant art, drugs used as therapeutic agents can reduce the severity of a given disease state, but do not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a prophylactic treatment does not need to be completely effective in preventing the onset of the disease. Simply reducing the impact of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect) or reducing the likelihood of the disease occurring or worsening is sufficient.

[0077] In this application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation of a subject from the normal state, such as any change in the state of the body or certain organs that prevents or disrupts the performance of a function and / or causes symptoms such as discomfort, dysfunction, suffering or even death in the person suffering from the disease or contact therewith. A disease or condition may also be referred to as distemper, ailment, ailment, malady, disorder, sickness, illness, complaint, inderdisposion or affectation.

[0078] In this application, the term "administer" generally refers to introducing the present application's pharmaceutical preparation into a subject's body by any introduction or delivery route. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug can be used. The administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal, aerosol inhalation, or oral administration. The daily dose may be divided into one, two, or more suitable forms of dosage to be administered at one, two, or more times during a certain time period.

[0079] In the present application, the term "contact" generally refers to two or more different types of substances being contacted together in any order, in any manner, and for any length of time. Contact can occur in vivo, ex vivo, or in vitro. In certain embodiments, it may refer to making the RNAi agent or composition of the present application directly contact cells or tissues. In other embodiments, the term refers to making the RNAi agent or composition of the present application indirectly contact cells or tissues. For example, the method of the present application includes wherein the subject contacts the RNAi agent or composition of the present application, and then the RNAi agent or composition contacts cells or tissues by diffusion or any other active transport known in the art or passive transport process (compound circulates in the body through this process).

[0080] In this application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally any amount of the drug that promotes disease regression (as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or the prevention of damage or disability caused by the disease) when used alone or in combination with another therapeutic agent. A "prophylactic effective amount" or "prophylactic effective dose" of a drug generally refers to an amount of the drug that inhibits the development or recurrence of the disease when administered to a subject at risk of disease development or disease recurrence, either alone or in combination with another therapeutic agent. The ability of a therapeutic or prophylactic agent to promote disease regression or inhibit disease development or recurrence can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, in animal model systems predicting efficacy in humans, or by measuring the activity of the agent in an in vitro assay. In certain embodiments, an "effective amount" refers to the amount of the RNAi agent that produces the expected pharmacological, therapeutic or prophylactic results.

[0081] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, improvement, prevention and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs) and experimental animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents and adult subjects. Subjects include animal disease models.

[0082] In this application, the terms "include," "comprising," "having," "may," "containing," and variations thereof are generally intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of" generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present. Singular forms such as "a," "an," and "the" in English, and "one," "a," and "said / the" in Chinese generally include plural forms of the referent unless the context clearly dictates otherwise.

[0083] In this application, the term "about" generally means approximately, in the region of, roughly, or around. When the term "about" is used in reference to a numerical range, a cutoff or specific value is used to indicate that the stated value may vary from the recited value by up to 10%. Thus, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from the specified value.

[0084] It should be understood that the term "at least" preceding a number or a range of numbers includes the number adjacent to the term "at least" and all subsequent numbers or integers logically included therein, as clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 15 nucleotides of a 21-nucleotide nucleic acid molecule" means that 15, 16, 17, 18, 19, 20, or 21 nucleotides have the indicated property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range.

[0085] It should be understood that "no more than" as used herein is interchangeable with "no more than" and "less than or equal to"; it refers to the value or integer that is adjacent to the phrase and logically lower. For example, a duplex having an overhang of "no more than 3 nucleotides" has an overhang of 3, 2, 1, or 0 nucleotides. When "no more than" appears before a series of numbers or a range, it should be understood that "no more than" modifies each number in the series or range. As used herein, ranges include both upper and lower limits.

[0086] The term "ligand" refers to a ligand that is introduced into a target tissue receptor to alter the distribution, targeting, or stability of a RNAi agent. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cell or organ compartment, body tissue, organ, or region)) compared to a species in which the ligand is not present.

[0087] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Ligands can also include targeting groups, such as cell or tissue targeting agents, such as lectins, glycoproteins, lipids, or proteins, such as antibodies, that bind to a specified cell type, such as renal cells. The targeting group can be thyroid stimulating hormone, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, for example, N-acetyl-galactosamine.

[0088] Detailed Description of the Invention

[0089] Antisense strand and sense strand

[0090] In one aspect, the present application provides an RNAi agent that inhibits LPA gene expression.

[0091] In certain embodiments, the RNAi agent comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of the LPA gene in a cell, such as a cell of a subject (e.g., a mammal). The dsRNA comprises an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed during expression of the LPA gene. The complementary region is about 12-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).

[0092] dsRNA includes two RNA chains, which can complement and hybridize to form a duplex structure (complementary region) under the conditions of dsRNA use. One chain of dsRNA (the antisense strand) includes a complementary region that is substantially complementary to the target sequence and usually completely complementary. The target sequence can be derived from the sequence of mRNA formed during LPA gene expression. The other chain (the positive strand) includes a region complementary to the antisense strand so that when combined under appropriate conditions, the two chains can hybridize and form a duplex structure. Typically, the length of the duplex structure is 12 to 30 base pairs. Similarly, the length of the complementary region to the target sequence is 12 to 30 nucleotides.

[0093] In certain embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the length of the dsRNA is sufficient to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs greater than about 21-23 nucleotides in length can be used as substrates for Dicer. It is also understood by those skilled in the art that the region of the RNA targeted for cleavage is typically a portion of a larger RNA molecule (typically an mRNA molecule). A "portion" of a target is a continuous nucleotide of an mRNA target that is long enough to allow it to be a substrate for RNAi-guided cleavage (i.e., cleavage via the RISC pathway).

[0094] Those skilled in the art will also understand that the duplex region is the main functional portion of the dsRNA, for example, a duplex region of about 19 to about 30 base pairs, for example, about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20 base pairs. Therefore, in one embodiment, in order to achieve a functional duplex (e.g., 15-30 base pairs) that targets the desired RNA for cleavage, the RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA.

[0095] In some embodiments, the sense strand of the RNA inhibitor is selected from the sequences in Table 1 below or sequences that differ from each sequence in Table 1 by one, two, or three nucleotides.

[0096] Table 1 Sense strand of RNAi agents

[0097] Wherein, g = guanylate, a = adenylate, t = thymidine deoxynucleotide, and c = cytidine.

[0098] In some embodiments, the antisense strand of the RNA inhibitor is selected from the sequences in Table 2 below or sequences that differ from each sequence in Table 2 by one, two, or three nucleotides.

[0099] Table 2 Antisense strands of RNAi agents

[0100] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate, and n = guanylate, adenylate, uridylate, or cytidylate.

[0101] In certain embodiments, the RNA inhibitor further comprises a sense strand, wherein the sense strand and the antisense strand are at least about 80% base complementary.

[0102] In certain embodiments, the sense strand and the antisense strand are each independently 15-30 nucleotides.

[0103] In certain embodiments, the sense strand and the antisense strand are each independently 17-25 nucleotides.

[0104] In certain embodiments, the sense strand and the antisense strand are each independently 19-23 nucleotides.

[0105] In some screening embodiments, the sense strand and antisense strand of the RNA inhibitor are selected from the sequences in Table 3 below or sequences that differ from each sequence in Table 3 by one, two, or three nucleotides.

[0106] Table 3 Screening RNA inhibitor sequences

[0107] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0108] For example, the sense strand may be SEQ ID NO. 396-400 or a sequence differing therefrom by one, two or three nucleotides; the antisense strand may be SEQ ID NO. 414-418 or a sequence differing therefrom by one, two or three nucleotides:

[0109] 1) Sense strand: ugguaauggacagaguuauuu (SEQ ID NO. 396), antisense strand: auaacucuguccauuaccauu (SEQ ID NO. 414);

[0110] 2) Sense strand: acagaguuaucgaggcucatt (SEQ ID NO. 397), antisense strand: ugagccucgauaacucuguuu (SEQ ID NO. 415);

[0111] 3) Sense strand: guaauggacagaguuaucgau (SEQ ID NO. 398), antisense strand: cgauaacucuguccauuacca (SEQ ID NO. 416);

[0112] 4) sense strand: gccccuugguguuauacaa (SEQ ID NO. 399), antisense strand: uuguauaacaccaaggggcug (SEQ ID NO. 417); and

[0113] 5) Sense strand: gcuccuuauuguuauacga (SEQ ID NO. 400), antisense strand: ucguauaacaauaaggagcug (SEQ ID NO. 418).

[0114] Chemical modification of nucleotides

[0115] To enhance the in vivo stability of the RNA inhibitor, the sense and antisense strands of the RNA inhibitor can be modified without affecting or even enhancing their activity. The nucleotides can have modifying groups, and the entire strand or a portion thereof can be modified. In certain embodiments, one or more nucleotides in the sense and / or antisense strands are modified to form modified nucleotides.

[0116] The sense and antisense strands in the RNA inhibitor structure provided by the present invention have a chain length of 15-30, preferably 19-23, and are at least 85% base complementary to each other. In order to enhance the stability of the sense and antisense strands in vivo, the sense and antisense strands of the RNA inhibitor can be modified without affecting the activity or even enhancing the activity, wherein the nucleotides can have a modifying group, and the entire chain or part of the chain can be modified, preferably all modified. The modification is a technique that is easy for researchers in the field to understand, and can be selected from any one or more of the following in the sugar moiety: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluorine-bearing nucleotides, morpholino nucleotides, vinyl phosphate deoxyribonucleotides, nucleotides containing vinyl phosphates, and nucleotides containing cyclopropyl phosphates. Among them, 2'-modified nucleotides include but are not limited to: 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides and 2'-alkyl nucleotides. In the RNA inhibitors provided by the present invention, both the sense strand and the antisense strand of the RNA inhibitor do not need to be uniformly modified, and more than one modification can be incorporated into a single nucleotide thereof. The modification can also occur in the base portion, and the modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 / N-6 and O-6 substituted purines, 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl of adenine and guanine, 2-alkyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil , 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogen, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0117] The sense and antisense strands of the RNA inhibitor of the present invention are partially or entirely 2'-O-methyl nucleotides and / or 2'-deoxy-2'-fluoro nucleotides, and at least two consecutive phosphorothioate bonds exist between the nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, and preferably the phosphate bonds between the three consecutive terminal nucleotides are phosphorothioated.

[0118] In certain embodiments, the modified nucleotide is selected from the group consisting of: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNA), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluorine-bearing nucleotides, morpholino nucleotides, vinyl phosphate deoxyribonucleotides, vinyl phosphate-containing nucleotides and cyclopropyl phosphate-containing nucleotides.

[0119] In certain embodiments, the 2'-modified nucleotides include 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides and / or 2'-alkyl nucleotides.

[0120] In some screening embodiments, the sense strand and antisense strand of the RNAi agent are selected from the sequences in Table 4 below or sequences that differ from each sequence in Table 4 by one, two, or three nucleotides.

[0121] Table 4 Methoxylated RNA inhibitors

[0122] Wherein, G = 2'-methoxyguanylate, A = 2'-methoxyadenosine, U = 2'-methoxyuridylate, C = 2'-methoxycytidine; u = uridylate, c = cytidine.

[0123] In some embodiments, at least one of the -OH groups at the 2' position of the sugar groups of the 2nd, 4th, 6th, 7th, 8th, 12th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand is fluorinated.

[0124] The -OH at the 2' position of the sugar group of the 7th, 12th and 14th nucleotides from the 5' end of the antisense strand is fluorinated, or the -OH at the 2' position of the sugar group of the 2nd, 4th, 6th, 8th, 14th and 16th nucleotides from the 5' end of the antisense strand is fluorinated.

[0125] In the antisense chain, except for the 7th, 12th, and 14th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group; or in the antisense chain, except for the 2nd, 4th, 6th, 8th, 14th, and 16th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group.

[0126] The -OH at the 2' position of the sugar groups at positions 7, 12, and 14 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the remaining sugar groups is replaced by a methoxy group; or the -OH at the 2' position of the sugar groups at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the remaining sugar groups is replaced by a methoxy group.

[0127] At least one of the -OH groups at the 2' position of the sugar groups of the 3rd, 5th, 7th, 8th, 9th, 11th, 13th and 15th nucleotides starting from the 5' end of the sense strand is fluorinated.

[0128] The -OH at the 2' position of the sugar group of the 5th, 7th, 8th and 9th nucleotides starting from the 5' end of the sense strand is fluorinated, or the -OH at the 2' position of the sugar group of the 3rd, 5th, 7th, 8th, 9th, 11th, 13th and 15th nucleotides starting from the 5' end of the sense strand is fluorinated.

[0129] In the sense chain, except for the 5th, 7th, 8th and 9th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group; or in the sense chain, except for the 3rd, 5th, 7th, 8th, 9th, 11th, 13th and 15th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group.

[0130] The -OH at the 2' position of the 5th, 7th, 8th and 9th nucleotide sugar groups starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group; or the -OH at the 2' position of the 3rd, 5th, 7th, 8th, 9th, 11th, 13th and 15th nucleotide sugar groups starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group.

[0131] There are at least two consecutive phosphorothioate bonds between the nucleotides of the sense strand and / or antisense strand.

[0132] The -OH at the 2' position of the sugar group of the 7th, 12th and 14th nucleotides starting from the 5' end of the antisense strand is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the antisense strand is replaced by a methoxy group, and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the antisense strand; the -OH at the 2' position of the sugar group of the 5th, 7th, 8th and 9th nucleotides starting from the 5' end of the sense strand is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the sense strand is replaced by a methoxy group; and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the sense strand; or

[0133] The -OH at the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the sugar group of the remaining nucleotides in the antisense chain is replaced by a methoxy group, and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the antisense chain; the -OH at the 2' position of the sugar group of the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the sugar group of the remaining nucleotides in the sense chain is replaced by a methoxy group; and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the sense chain.

[0134] The sense strand in the RNA inhibitor is selected from the sequences in Table 5 below or sequences that differ from the sequences in Table 5 by one, two or three nucleotides.

[0135] Table 5 Modified sense chain

[0136] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylate.

[0137] In some embodiments, the antisense strand in the RNA inhibitor is selected from the sequences in Table 6 below or sequences that differ from the sequences in Table 6 by one, two, or three nucleotides.

[0138] Table 6 Screened antisense strands

[0139] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylate.

[0140] In some embodiments, in some embodiments, the RNA inhibitor is selected from the sequences in Table 7 below.

[0141] Table 7 Modified RNA inhibitors

[0142] Ligand-coupled RNAi inhibitors

[0143] Another aspect of the RNA inhibitors of the present application relates to the manner in which the interfering nucleic acid is coupled to a ligand to enhance the stability, activity, cellular distribution or cellular uptake of the RNAi agent.

[0144] The sense strand and antisense strand comprised by the RNA inhibitor of the present application can be conveniently and routinely prepared by the well-known technology of solid phase synthesis.Can use additionally or alternatively any other method for this type of synthesis as known in the art, such as liquid phase synthesis or fermentation.Use similar technology to prepare other oligonucleotides (such as phosphorothioate and alkylated derivatives) is also known.

[0145] In certain embodiments, in addition to standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite monomers that are commercially available and routinely used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of the present application can be synthesized by an automated synthesizer using a phosphoramidite method derived from ligand-nucleoside phosphoramidite monomers.

[0146] In certain embodiments, the ligand conjugation of the present invention is achieved by coupling the ligand structure to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand.

[0147] For example, the ligand structure can be coupled to the 5' end and / or 3' end of the sense strand; or the ligand structure can be coupled to the 5' end of the antisense strand, and the ligand structure is coupled to the 3' end of the sense strand; or the ligand structure can be coupled to the 3' end of the antisense strand, and the ligand is coupled to the 5' end of the sense strand; or the ligand structure is coupled to both the 5' end and the 3' end of the sense strand.

[0148] In certain embodiments, the ligand structure includes 5'MVIP and 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand, the structure of the 5'MVIP is as shown in Formula I, and the structure of the 3'MVIP is as shown in Formula II.

[0149] (XL) n -BD-R1-,

[0150] I

[0151] (XL) m -BD-R2-,

[0152] II

[0153] in,

[0154] X is a targeting-specific ligand;

[0155] L is a branched chain;

[0156] B is the connector;

[0157] D is the connecting chain;

[0158] R1 and R2 are transfer points;

[0159] The 5'MVIP is connected to the 5' end of the sense strand or the 5' end of the antisense strand through the transition point R1, and the 3'MVIP is connected to the 3' end of the sense strand or the 3' end of the antisense strand through the transition point R2. n and m are each independently any integer of 0-4.

[0160] In certain embodiments, wherein X is a tissue-specific targeting ligand

[0161] In certain embodiments, the X liver targeting specific ligand.

[0162] In certain embodiments, the connection between R1 or R2 and the sense strand or antisense strand is through phosphate or modified phosphate, preferably through phosphate or phosphorothioate.

[0163] In certain embodiments, wherein n+m=an integer of 2-6, preferably n+m=2, 3 or 4, more preferably 4.

[0164] In certain embodiments, m or n may be 0, ie, there is no 3'MVIP or 5'MVIP.

[0165] In certain embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the 3'MVIP may be:

[0166] In certain embodiments, when n=1, the structure of the 3'MVIP can be:

[0167] In certain embodiments, when n=2, the structure of the 3'MVIP can be:

[0168] In certain embodiments, when n=3, the structure of the 3'MVIP can be:

[0169] In certain embodiments, when n=4, the structure of the 3'MVIP can be:

[0170] In certain embodiments, the n refers to the sum of n placed in the 5'MVIP at the 5' end of both the sense and antisense strands of the RNAi agent, and the m refers to the sum of m placed in the 3'MVIP at the 3' end of both the sense and antisense strands of the RNAi agent.

[0171] In certain embodiments, the transition points R1 and R2 contain -NH-, -S- and / or -O- in their structures, and R1 and R2 are connected to the connecting chain D and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, -S- or -O- in their structures, and R1 and R2 may be the same or different.

[0172] In certain embodiments, R1 and R2 are optionally linear, or linear or cyclic structures with amide, carboxyl or alkyl side chains, wherein the cyclic structure includes a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen or nitrogen atoms.

[0173] In certain embodiments, said R1 and / or R2 is -E1(CH2) x CH2E2-, wherein x is any integer from 3 to 12, and the groups E1 and E2 can be -NH-, -S- or -O-, respectively.

[0174] In certain embodiments, said R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) x2 E2-, wherein x1 or x2 is each independently any integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O-.

[0175] In certain embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S, or O:

[0176] In certain embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6, can be introduced by the following two phosphoramidite monomers:

[0177] i. One of the -O- or -S- groups is used to synthesize the R1 phosphoramidite monomer, which is then incorporated into the 5' end of the sense or antisense strand of the RNA inhibitor via solid-phase synthesis. In this structure, the -NH-, -S-, or -O- group is used to connect to the connecting strand D in the 5'MVIP, thereby introducing the liver-targeting-specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor. An exemplary structure of the monomer incorporated into the 5' end of the sense or antisense strand of the RNA inhibitor is as follows:

[0178] In certain embodiments, the following structures are preferred:

[0179] ii. In the R1 structure, -NH-, -S-, or -O- is first connected to the connecting chain D, and the other -NH-, -S-, or -O- is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples of the structures of the sense chain or antisense chain 5'MVIP phosphoramidite monomer are as follows:

[0180] In certain embodiments, the sense chain or antisense chain 5'MVIP phosphoramidite monomer preferably has the following structure:

[0181] When n in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the above monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense chain or antisense chain through solid phase synthesis.

[0182] In certain embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x may be an integer from 3 to 12, and preferably an integer from 4 to 6.

[0183] In certain embodiments, the 5'MVIP phosphoramidite monomer structure is selected from the following structures:

[0184] In certain embodiments, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O:

[0185] In certain embodiments, said R2 is -NH(CH2) x1CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0186] The R2 described in this application is formed by forming an ester or amide with -NH-, -S- or -O- in the R2 structure through succinic anhydride, and then coupling with -NH- in the blank Solid Support to form a 3'MVIP solid support. The 3'MVIP is then introduced into the 3' end of the sense chain or antisense chain through the phosphoramidite solid phase synthesis method.

[0187] In certain embodiments, the heterocyclic ring in the R2 structure is a pyrrole ring or a piperidine ring, which is connected to the connecting chain D of 3'MVIP via a nitrogen heteroatom in the ring. The exemplary structure of 3'MVIP solid state port is as follows:

[0188] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0189] In certain embodiments, R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, wherein x1 is an integer of 1-4, x2 is an integer of 0-4, B4 and B5 are respectively -NH-, -S- or -O-, and the exemplary general formula of the introduced 3'MVIP solid solution is as follows:

[0190] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0191] In certain embodiments, R2 is -NHCH2CH(OH)CH2O-. The exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0192] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0193] In certain embodiments, the 3'MVIP solid support structure is as follows:

[0194] In certain embodiments, the liver-targeting-specific ligand X is selected from structures used to enhance hepatocyte uptake of RNAi agents, and may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics. In the RNAi agents provided herein, the liver-targeting-specific ligands X introduced into the ends of the sense or antisense strands of the RNAi agents may be identical or different. For example, some may enhance liver targeting, some may modulate the in vivo pharmacokinetics of the RNAi agent, or some may possess in vivo lytic activity. In certain embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and their derivatives in the following structures:

[0195] In certain embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.

[0196] In certain embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its general structural formula is as follows:

[0197] Wherein, W1 is hydrogen or a hydroxyl protecting group, which may be the same or different; W is -OH, -NHCOOH or -NHCO(CH2) q CH3, wherein q is an integer of 0-4; W2 is -NH-, O, S or C.

[0198] In certain embodiments, the liver-targeting specific ligand X is N-acetylgalactosamine and its derivatives.

[0199] In certain embodiments, the liver-targeting specific ligand X is selected from the following structures:

[0200] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.

[0201] In certain embodiments, the liver-targeting specific ligand X in the same 5'MVIP or 3'MVIP structure may be the same or different.

[0202] In certain embodiments, X between 5'MVIP and 3'MVIP may be the same or different.

[0203] In certain embodiments, the branched chain L is a group containing -NH-, -C(=O)-, -O-, -S-, amide, phosphoryl, thiophosphoryl, C4-C 10 aliphatic carbocyclic group, phenyl group or a combination of these groups C4-C 18 Direct chain.

[0204] In certain embodiments, the L further has a hydroxyethyl group or a carboxylic acid side chain.

[0205] In certain embodiments, L is a C7-C6-containing amide group or a six-membered aliphatic carbocyclic group. 18 Direct chain.

[0206] In certain embodiments, L is selected from one or more of the following structures:

[0207] wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group, or an amide group.

[0208] In certain embodiments, the structure of the linker B is related to the number of Xs that can be introduced, and the linker B contains -NH-, C, O, S, amide, phosphoryl, or thiophosphoryl. When n or m is 1, it is a straight chain. When n or m is 2, 3, or 4, the number of forks is 2, 3, or 4, respectively.

[0209] In certain embodiments, B is selected from the following structures:

[0210] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.

[0211] In certain embodiments, B is selected from the following structures:

[0212] Wherein, r is any integer from 0 to 4.

[0213] In certain embodiments, B is selected from the following structures:

[0214] In certain embodiments, B is selected from the following structures:

[0215] In certain embodiments, the linker D is a group containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aromatic hydrocarbon, C4-C 10aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups; 18 Direct chain.

[0216] In certain embodiments, the D further has a side chain of a hydroxymethyl group, a methyl tert-butyl group, a methylphenol group, or a C5-C6 aliphatic ring group.

[0217] In certain embodiments, D is a C3-C ... 10 Direct chain.

[0218] In certain embodiments, D is a C3-C containing two C=O 10 Direct chain.

[0219] In certain embodiments, D is selected from the following structures:

[0220] wherein each p is independently any integer from 1 to 20; s is an integer from 2 to 13; and Z1 and Z2 are the same or different substituent groups.

[0221] In certain embodiments, D is selected from the following structures:

[0222] In certain embodiments, D is selected from the following structures:

[0223] In certain embodiments, (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:

[0224] In certain embodiments, the X, L, D, and B are the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP.

[0225] In certain embodiments, (XL) in the 5'MVIP structure n-BD- is selected from the structures shown in Table 8:

[0226] Table 8 5'MVI7P (XL) n -BD-Structure

[0227] In certain embodiments, 5'MVIP may not be present, in which case m may be an integer of 2-4.

[0228] In certain embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 9:

[0229] Table 9 3'MVIP (XL) m -BD-Structure

[0230] In certain embodiments, (XL) in the 5'MVIP ligand structure n The combinations of -BD- and R1 are shown in Table 10.

[0231] Table 10 5'MVIP Medium (XL) n -BD- and R1 combination

[0232] In certain embodiments, 3'MVIP may not be present, in which case n may be 2-4.

[0233] In certain embodiments, (XL) in the 3'MVIP ligand structure m The combinations of -BD- and R2 are shown in Table 11.

[0234] Table 11 3'MVIP (XL) m -BD- combined with R2

[0235] In certain embodiments, the 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22 in Table 10.

[0236] In certain embodiments, the 5'MVIP is selected from:

[0237] In certain embodiments, the 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27 in Table 11.

[0238] In the RNAi agent of the present application, when a single strand has 3'MVIP, the complementary strand may have 5'MVIP, 3'MVIP, or no 5'MVIP. When a single strand of the RNA inhibitor has 5'MVIP, the complementary strand may have 3'MVIP, 5'MVIP, or no 5'MVIP. 5'MVIP and 3'MVIP may also be simultaneously attached to the corresponding ends of the sense or antisense strands. That is, when the sense strand has 5'MVIP at its 5' end, it may also have 3'MVIP at its 3' end; when the antisense strand has 5'MVIP at its 5' end, it may also have 3'MVIP at its 3' end. Alternatively, 5'MVIP may be placed at the 5' end of both the sense and antisense strands. Alternatively, 3'MVIP may be placed at the 3' end of both the sense and antisense strands.

[0239] In certain embodiments, different 5'MVIP and 3'MVIP combinations in Table 12 are selected to be incorporated into different positions of the sense and / or antisense strands of the RNAi agent, including at the ends or at the ends of the RNAi agent. n -BD- is introduced into the 2' position of A, U, G and / or C sugar groups or a suitable position of the base in advance by chemical reaction to form the corresponding phosphoramidite monomer, which is introduced into the middle of the sense chain and / or antisense chain, wherein the middle refers to any position except the end.

[0240] Table 12 Combination of 5'MVIP and 3'MVIP

[0241] In some embodiments, the RNA inhibitors of the present invention or pharmaceutically acceptable salts thereof can be prepared or synthesized in the form of carboxylate salts, sodium salts, triethylamine salts or other pharmaceutically acceptable salts.

[0242] In certain embodiments, the RNA inhibitor is selected from Table 13.

[0243] Table 13 RNA inhibitors containing 5'MVIP09 / 3'MVIP09 combination

[0244] In some embodiments, the 5' end and / or 3' end of the sense strand GsUsAAfUGfGfAfCAGAGUUAUCGsAsU (SEQ ID NO. 460) of the RNA inhibitor is linked to 5'MVIP and / or 3'MVIP of different structures, and the sense strand is selected from the following Table 14:

[0245] Table 14: Ligation of the 5' and / or 3' ends of the sense strand with 5'MVIP and / or 3'MVIP of different structures

[0246] In some embodiments, the sense strand of the RNA inhibitor described herein is a sequence having at least 15 consecutive nucleotides identical to each sequence in Table 14, or a sequence having no more than three different nucleotides from each sequence in Table 14.

[0247] In some embodiments, the 5' end and / or 3' end of the antisense strand CsGsAUAAfCUCUGfUCfCAUUACsCsA (SEQ ID NO. 496) of the RNA inhibitor is linked to 5'MVIP and / or 3'MVIP of different structures, and the antisense strand is selected from Table 15 below.

[0248] Table 15: 5' end and / or 3' end of the antisense strand linked to 5'MVIP and / or 3'MVIP of different structures

[0249] In some embodiments, the antisense strand of the RNA inhibitor described herein is a sequence having at least 15 consecutive nucleotides identical to each sequence in Table 15, or a sequence having no more than three different nucleotides from each sequence in Table 15.

[0250] In certain embodiments, the RNA inhibitors described herein are formed by random pairing of the sense strands in Table 14 or sequences that differ from these sense strands by one, two, or three nucleotides and the antisense strands in Table 15 or sequences that differ from these antisense strands by one, two, or three nucleotides.

[0251] In some embodiments, the 5' end and / or 3' end of the sense strand GsUsAAfUGfGfAfCAGAGUUAUCGsAsU (SEQ ID NO. 460) of the RNA inhibitor is connected to 5'MVIP and / or 3'MVIP of different structures while adjusting the mer number of the sequence. In some embodiments, the RNA inhibitor described herein is selected from Table 16.

[0252] Table 16 RNA inhibitor codes, contained single chains and their sequence numbers

[0253] Patent CN113171371B details the effects of different X, L, B, D, R1, and R2 in the 5'MVIP and / or 3'MVIP structures on RNA inhibitor activity, and the entire text is incorporated herein by reference. When one of X, L, B, D, R1, and R2 is different, the remaining portions of the corresponding 5'MVIP and / or 3'MVIP are identical to those of 5'MVIP09 / 3'MVIP09, and the interfering nucleic acids coupled thereto are identical.

[0254] When X is galactose, galactosamine, N-acetylgalactosamine and its derivatives, the obtained RNA inhibitor preferably uses N-acetylgalactosamine and its derivatives as ligands:

[0255] The length of L significantly influences the effectiveness of RNA inhibitors. When containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or within the same 5'MVIP or 3'MVIP structure, or when the L structures of 5'MVIP and 3'MVIP differ, the resulting RNA inhibitory activity is similar within the C7-C18 chain length range.

[0256] In addition to the structural changes in linker B, when X, L, D, and R1 / R2 are consistent with those in the combination 5'MVIP09 / 3'MVIP09, A1 and A2 in the general formula of linker B are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, r is an integer from 0 to 4, and when linker B is the same or different between 5'MVIP and 3'MVIP, the resulting RNA inhibitory activity is not much different.

[0257] When X, L, D, and R1 / R2 are consistent with those in the combination 5'MVIP09 / 3'MVIP09 except for the structural change of the linker D, different linker Ds will affect the RNA inhibitor activity, among which D1, D2, and D4 have similar effects and are better than D3.

[0258] Different transfer points R1 will affect the activity of RNA inhibitors, among which R1-1 as the transfer point has the best RNA inhibitor activity.

[0259] Different transfer points R2 will affect the activity of RNA inhibitors, among which R2-1 is the best when used as the transfer point.

[0260] In certain embodiments, n+m in the RNA inhibitor is 2, 3, 4, 5, and 6, respectively. The locations of 5'MVIP and / or 3'MVIP coupling include the 5' and / or 3' ends of the antisense strand, the 5' and / or 3' ends of the sense strand, the 5' and 3' ends of the antisense strand, and the 5' and 3' ends of the sense strand. The RNA inhibitors are shown in Table 17 by random base pairing and annealing of the antisense strands in Table 15 and the sense strands in Table 14, where n+m = 2, 3, 4, 5, and 6.

[0261] Table 17 RNA inhibitors containing a combination of 5'MVIP and 3'MVIP

[0262] Pharmaceutical composition

[0263] The present application also includes a pharmaceutical composition comprising the RNAi agent of the present application or a pharmaceutically acceptable salt thereof.

[0264] In one embodiment, provided herein are pharmaceutical compositions comprising the RNAi agents described herein and pharmaceutically acceptable pharmaceutical excipients. Pharmaceutical compositions comprising RNAi agents can be used to prevent and / or treat LPA-related disorders, such as hypertension. Such pharmaceutical compositions are formulated based on the mode of delivery. One example embodiment is a composition formulated for systemic administration by parenteral delivery, for example, subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the present application can be administered at a dose sufficient to inhibit LPA gene expression.

[0265] A pharmaceutically acceptable "excipient" or "vegetarian" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. Excipients can be liquid or solid and are selected based on the intended mode of administration to provide the desired volume, consistency, etc. when combined with the nucleic acid and other components of a given pharmaceutical composition. RNAi agents can be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0266] In certain embodiments, the pharmaceutical composition further comprises a delivery vehicle (such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems). In certain embodiments, the delivery vehicle comprises the amphiphilic lipid compound M10CL.

[0267] use

[0268] On the other hand, the present application provides the use of the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof and the aforementioned pharmaceutical composition in the preparation of a medicament for preventing or treating a disease or pathology or reducing the risk of a disease or pathology.

[0269] In certain embodiments, the disease or pathology comprises a disease or pathology associated with elevated levels of Lp(a) and / or apo(a).

[0270] In certain embodiments, the disease or pathology comprises a liver-related disease.

[0271] In certain embodiments, the disease or pathology comprises inflammatory, cardiovascular, or metabolic disease.

[0272] In certain embodiments, the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0273] In another aspect, the present application provides a method for preventing or treating a disease, condition, or syndrome, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor for inhibiting LPA gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0274] The RNA inhibitor for inhibiting LPA gene expression, its pharmaceutically acceptable salt or the pharmaceutical composition is administered to the subject subcutaneously, intravenously, orally, by aerosol inhalation, rectum or intraperitoneally.

[0275] Cells suitable for treatment using the methods of the present application can be any cell expressing an LPA gene, for example, liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells. Cells suitable for use in the methods of the present application can be mammalian cells, and when contacted with cells expressing an LPA gene, the RNAi agent inhibits the expression of the LPA gene (e.g., human, primate, non-primate, or rat LPA gene) by at least about 50%, as measured, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, Western blotting, or flow cytometry.

[0276] Inhibition of LPA gene expression can be demonstrated by a reduction in the amount of mRNA expressed by a first cell or cell population (such cells may, for example, be present in a sample derived from a subject) in which the LPA gene is transcribed and treated (e.g., by contacting one or more cells with an RNAi agent of the present invention, or by administering an RNAi agent of the present invention to a subject in which such cells are present) such that LPA gene expression is suppressed, compared to a second cell or cell population that is substantially identical to the first cell or cell population but has not been treated in this manner (control cells that have not been treated with an RNAi agent or with an RNAi agent targeting a gene of interest). In a preferred embodiment, inhibition is assessed in a cell line that highly expresses LPA using an appropriate concentration of siRNA by the method provided in Example 2, and the mRNA level in the treated cells is expressed as a percentage of the mRNA level in the non-treated control cells.

[0277] In other embodiments, inhibition of LPA gene expression can be assessed by a decrease in a parameter functionally related to LPA gene expression, such as, for example, LPA protein levels in the blood or serum of a subject.

[0278] Inhibition of LPA protein expression can be demonstrated by a decrease in the level of LPA protein expressed by a cell or cell population or a sample from a subject (e.g., protein levels in a blood sample from a subject). As described above, for evaluation of mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can be similarly expressed as a percentage of protein levels in control cells or cell populations, or as a change in protein levels in a sample from a subject (e.g., blood or serum derived therefrom). LPA gene silencing can be measured in any cell expressing LPA (endogenous or exogenous from an expression construct) and by any assay known in the art.

[0279] The level of LPA mRNA expressed by a cell or cell population can be measured using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated by any method known in the art, such as ELISA. In certain embodiments, a liver biopsy sample is used as the tissue material for monitoring a decrease in LPA gene or protein expression. In other embodiments, a blood sample is used as the subject sample for monitoring a decrease in LPA protein expression.

[0280] Specifically, this application also discloses the following specific implementation methods:

[0281] 1. An RNA inhibitor for inhibiting LPA gene expression, or a pharmaceutically acceptable salt thereof, comprising an antisense strand complementary region comprising at least 15 consecutive nucleotides, wherein the antisense strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 414-418, or a sequence having at least 15 consecutive nucleotides identical to any of SEQ ID NOs. 414-418, or a sequence having no more than three different nucleotides from any of the aforementioned sequences.

[0282] 2. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 1, wherein the complementary region comprises 12-25 consecutive nucleotide base pairs.

[0283] 3. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 1 or a pharmaceutically acceptable salt thereof, comprising an antisense strand, wherein the antisense strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 414-418, or a sequence having at least 15 consecutive nucleotides identical to any one of SEQ ID NOs. 414-418, or a sequence having no more than three different nucleotides from the above sequences.

[0284] 4. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 1, further comprising a sense strand, wherein the sense strand and the antisense strand are at least about 80% complementary in base sequence.

[0285] 5. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 4, wherein the sense strand and the antisense strand are each independently 15-30 nucleotides.

[0286] 6. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 5, wherein the sense strand and the antisense strand are each independently 17-25 nucleotides.

[0287] 7. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 6, wherein the sense strand and the antisense strand are each independently 19-23 nucleotides.

[0288] 8. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 1 or a pharmaceutically acceptable salt thereof, wherein the positive strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 396-400, or a sequence having at least 15 consecutive nucleotides identical to any one of SEQ ID NOs. 396-400, or a sequence having no more than three different nucleotides from the above sequences.

[0289] 9. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 1, wherein the sense strand and the antisense strand are selected from any one or more of the following combinations:

[0290] 1) Sense strand: ugguaauggacagaguuauuu (SEQ ID NO. 396), antisense strand: auaacucuguccauuaccauu (SEQ ID NO. 414);

[0291] 2) Sense strand: acagaguuaucgaggcucatt (SEQ ID NO. 397), antisense strand: ugagccucgauaacucuguuu (SEQ ID NO. 415);

[0292] 3) Sense strand: guaauggacagaguuaucgau (SEQ ID NO. 398), antisense strand: cgauaacucuguccauuacca (SEQ ID NO. 416);

[0293] 4) sense strand: gccccuugguguuauacaa (SEQ ID NO. 399), antisense strand: uuguauaacaccaaggggcug (SEQ ID NO. 417); and

[0294] 5) Sense strand: gcuccuuauuguuauacga (SEQ ID NO. 400), antisense strand: ucguauaacaauaaggagcug (SEQ ID NO. 418).

[0295] 10. The RNA inhibitor for inhibiting LPA gene expression according to any one of embodiments 1 to 9, or a pharmaceutically acceptable salt thereof, wherein one or more nucleotides on the sense strand and / or antisense strand are modified to form a modified nucleotide sequence.

[0296] 11. An RNA inhibitor for inhibiting LPA gene expression according to embodiment 10, or a pharmaceutically acceptable salt thereof, wherein the modified nucleotide is selected from the group consisting of deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluorine-bearing nucleotides, morpholino nucleotides, vinyl phosphate deoxyribonucleotides, vinyl phosphate-containing nucleotides, and cyclopropyl phosphate-containing nucleotides.

[0297] 12. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 11, wherein the 2'-modified nucleotides include: 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides and / or 2'-alkyl nucleotides.

[0298] 13. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 10, wherein the -OH at the 2' position of some or all nucleotide sugar groups of the sense chain and the antisense chain is substituted, wherein the substituent group is fluorine or methoxy.

[0299] 14. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 13 or a pharmaceutically acceptable salt thereof, wherein at least one of the -OH groups at the 2' position of the sugar groups of the nucleotides at positions 2, 4, 6, 7, 8, 12, 14, and 16 from the 5' end of the antisense strand is fluorinated.

[0300] 15. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 14, or a pharmaceutically acceptable salt thereof, wherein the -OH group at the 2' position of the sugar group of the nucleotides at positions 7, 12, and 14 from the 5' end of the antisense strand is fluorinated, or the -OH group at the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand is fluorinated.

[0301] 16. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 13, or a pharmaceutically acceptable salt thereof, wherein, except for nucleotides 7, 12, and 14 from the 5' end of the antisense strand, at least one of the -OH groups at the 2' position of the sugar groups of the remaining nucleotides is substituted with a methoxy group; or, except for nucleotides 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand, at least one of the -OH groups at the 2' position of the sugar groups of the remaining nucleotides is substituted with a methoxy group.

[0302] 17. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 13, or a pharmaceutically acceptable salt thereof, wherein the -OH at the 2' position of the nucleotide sugar groups at positions 7, 12, and 14 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is substituted with a methoxy group; or the -OH at the 2' position of the nucleotide sugar groups at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is substituted with a methoxy group.

[0303] 18. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 13 or a pharmaceutically acceptable salt thereof, wherein at least one of the -OH groups at the 2' position of the sugar groups of the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense strand is fluorinated.

[0304] 19. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 18, or a pharmaceutically acceptable salt thereof, wherein the -OH group at the 2' position of the sugar group of the 5th, 7th, 8th, and 9th nucleotides from the 5' end of the sense chain is fluorinated, or the -OH group at the 2' position of the sugar group of the 3rd, 5th, 7th, 8th, 9th, 11th, 13th, and 15th nucleotides from the 5' end of the sense chain is fluorinated.

[0305] 20. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 13, or a pharmaceutically acceptable salt thereof, wherein, except for the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense chain, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is substituted by a methoxy group; or, except for the 3rd, 5th, 7th, 8th, 9th, 11th, 13th, and 15th nucleotides starting from the 5' end of the sense chain, at least one of the -OH groups at the 2' position of the remaining nucleotide sugar groups is substituted by a methoxy group.

[0306] 21. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 20, or a pharmaceutically acceptable salt thereof, wherein the -OH at the 2' position of the nucleotide sugar groups at positions 5, 7, 8, and 9 starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group; or the -OH at the 2' position of the nucleotide sugar groups at positions 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the remaining nucleotide sugar groups is replaced by a methoxy group.

[0307] 22. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 10 or a pharmaceutically acceptable salt thereof, wherein at least two consecutive phosphorothioate bonds exist between the nucleotides of the sense strand and / or antisense strand.

[0308] 23. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 22, wherein at least two consecutive phosphorothioate bonds exist between three consecutive nucleotides at the end of the sense strand and / or the end of the antisense strand.

[0309] 24. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to any one of embodiment 22, wherein at least two consecutive phosphorothioate bonds exist between three consecutive nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand.

[0310] 25. The RNA inhibitor for inhibiting LPA gene expression according to any one of embodiment 10, or a pharmaceutically acceptable salt thereof, wherein the -OH at the 2' position of the sugar group of the nucleotides at positions 7, 12, and 14 starting from the 5' end of the antisense chain is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the antisense chain is substituted with a methoxy group, and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the antisense chain; the -OH at the 2' position of the sugar group of the nucleotides at positions 5, 7, 8, and 9 starting from the 5' end of the sense chain is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the sense chain is substituted with a methoxy group; and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the sense chain. There are at least two consecutive thiophosphate bonds; or the 2'-OH of the sugar group of the nucleotides at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense chain is fluorinated, and the 2'-OH of the sugar group of the remaining nucleotides of the antisense chain is replaced by a methoxy group, and there are at least two consecutive thiophosphate bonds between the three consecutive nucleotides at the end of the antisense chain; the 2'-OH of the sugar group of the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense chain is fluorinated, and the 2'-OH of the sugar group of the remaining nucleotides of the sense chain is replaced by a methoxy group; and there are at least two consecutive thiophosphate bonds between the three consecutive nucleotides at the end of the sense chain.

[0311] 26. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 25, or a pharmaceutically acceptable salt thereof, wherein the antisense strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 492, 493, 496, 499 and 501, or a sequence having at least 15 consecutive nucleotides identical to SEQ ID NOs. 492, 493, 496, 499 and 501, or a sequence having no more than three different nucleotides from the above sequences.

[0312] 27. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 26 or a pharmaceutically acceptable salt thereof, wherein the positive strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 456, 457, 460, 463 and 465, or a sequence having at least 15 consecutive nucleotides identical to SEQ ID NOs. 456, 457, 460, 463 and 465, or a sequence having no more than three different nucleotides from the above sequences.

[0313] 28. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 27 or a pharmaceutically acceptable salt thereof, wherein the sense strand and antisense strand are selected from any one or more of the following combinations: sense strand: UsGsGUfAAfUfGfGACAGAGUUAUsUsU (SEQ ID NO.456), antisense strand: AsUsAACUfCUGUCfCAfUUACCAsUsU (SEQ ID NO.492); sense strand: AsCsAGfAGfUfUfAUCGAGGCUCAsTsT (SEQ ID NO.457), antisense strand: UsGsAGCCfUCGAUfAAfCUCUGUsUsU (SEQ ID NO.493); sense strand: GsUsAAfUGfGfAfCAGAGUUAUCGsAsU (SEQ ID NO.460), antisense strand: CsGsAUAAfCUCUGfUCfCAUUACsCsA (SEQ ID NO.461). NO.496); sense strand: GsCsfCCfCUfUfGfGUfGUfUAfUACsAsA (SEQ ID NO.463), antisense strand: UsfUsGfUAfUAfACACCAfAGfGGGCsUsG (SEQ ID NO.499); and sense strand: GsCsfUCfCUfUfAfUUfGUfUAfUACsGsA (SEQ ID NO.465), antisense strand: UsfCsGfUAfUAfACAAUAfAGfGAGCsUsG (SEQ ID NO.501); wherein G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'- O-methyl-3'-thiocytidylic acid; fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid.

[0314] 29. The RNA inhibitor for inhibiting LPA gene expression according to any one of embodiment 28, or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is selected from Ky11-DS38, Ky11-DS39, Ky11-DS42, Ky11-DS45 and Ky11-DS47.

[0315] 30. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 1, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0316] 31. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 30, or a pharmaceutically acceptable salt thereof, wherein the ligand is conjugated to the 5' end and the 3' end of the antisense chain, or the ligand is conjugated to one or more of the 5' end of the antisense chain or the 3' end of the antisense chain.

[0317] 32. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to any one of embodiment 31, wherein the ligand is conjugated to the 5' end and the 3' end of the sense chain, and the ligand is conjugated to one or more of the 5' end of the sense chain or the 3' end of the sense chain.

[0318] 33. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 32, wherein the ligand is conjugated to the 5' end of the antisense strand, and the ligand is conjugated to the 3' end of the sense strand.

[0319] 34. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 32, wherein the ligand is conjugated to the 3' end of the antisense strand, and the ligand is conjugated to the 5' end of the sense strand.

[0320] 35. The RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to embodiment 32, wherein the ligand is conjugated to the 5' end and the 3' end of the sense strand.

[0321] 36. An RNA inhibitor or a pharmaceutically acceptable salt thereof, comprising: a drug; a ligand coupled to the drug, wherein the ligand comprises 5'MVIP (5'MultiValent Import Platform) and 3'MVIP (3'MultiValent Import Platform), wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand, wherein the structure of the 5'MVIP is as shown in Formula I, and the structure of the 3'MVIP is as shown in Formula II.

[0322] (XL) n -BD-R1-,

[0323] I

[0324] (XL) m-BD-R2-,

[0325] II

[0326] in,

[0327] n and m are each independently any integer from 0 to 4, preferably any integer from 1 to 3,

[0328] X is a targeting-specific ligand;

[0329] L is a branched chain;

[0330] B is the connector;

[0331] D is the connecting chain;

[0332] R1 and R2 are transition points, which are connected to the sense chain or antisense chain via phosphate or modified phosphate, preferably phosphate or phosphorothioate.

[0333] 37. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to embodiment 36, wherein the structure is shown in Formula IIIa, IIIb or IIIc:

[0334] n and m are each independently any integer from 0 to 4.

[0335] 38. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein n+m=an integer of 2-6, preferably n+m=2, 3 or 4, more preferably 4.

[0336] 39. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition points R1 and R2 have -NH-, sulfur atoms and / or oxygen atoms in their structures, and R1 and R2 are connected to the connecting chain D and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, sulfur atoms or oxygen atoms in the structures, and R1 and R2 are the same or different.

[0337] 40. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition points R1 and R2 are optionally linear chains, or linear chains or cyclic structures with amide, carboxyl or alkyl side chains, and the cyclic structure includes a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen or nitrogen atoms.

[0338] 41. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R1 and / or R2 is -E1(CH2) xCH2E2-, wherein x is any integer from 3 to 12, and the groups E1 and E2 can be -NH-, a sulfur atom or an oxygen atom, respectively.

[0339] 42. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) X2 E2-, wherein x1 or x2 are each independently any integer from 3 to 10, and E1 and E2 can be -NH-, a sulfur atom or an oxygen atom.

[0340] 43. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R1 is a heterocyclic or carbocyclic structure containing a nitrogen, sulfur or oxygen atom:

[0341] 44. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6.

[0342] 45. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R2 is a heterocyclic or carbocyclic structure containing a nitrogen, sulfur or oxygen atom:

[0343] 46. ​​The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0344] 47. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the liver-targeting specific ligand X is selected from structures for enhancing cellular uptake of the RNA inhibitor.

[0345] 48. The RNA inhibitor according to embodiment 47 or a pharmaceutically acceptable salt thereof, wherein the targeting-specific ligand X comprises: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose, mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, galactose, galactosamine, N-acetylgalactosamine, galactosamine derivatives, N-acetylgalactosamine derivatives, folic acid, folic acid derivatives, and peptide chains.

[0346] 49. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the targeting-specific ligand X is selected from the following structures:

[0347]

[0348] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.

[0349] 50. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the side chain L is a group containing -NH-, -C(=O)-, -O-, -S-, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C 10 aliphatic carbocyclic group, phenyl group or a combination of these groups C4-C 18 Direct chain.

[0350] 51. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to embodiment 50, wherein the branched chain L further has a hydroxyethyl or carboxylic acid side chain.

[0351] 52. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the branched chain L is a C7-C8 containing an amide group or a six-membered aliphatic carbocyclic group. 18 Direct chain.

[0352] 53. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the branched chain L is selected from one or more of the following structures:

[0353] wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group, or an amide group.

[0354] 54. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the structure of the linker B is related to the number of targeting-specific ligands X that can be introduced, and the linker B contains -NH-, C, O, S, amide, phosphoryl, or thiophosphoryl. When n or m is 1, it is a straight chain. When n or m is 2, 3 or 4, the number of branches is 2, 3 or 4, respectively.

[0355] 55. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the linker B is selected from the following structures:

[0356] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.

[0357] 56. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the linker B is selected from the following structures:

[0358] Wherein, r is any integer from 0 to 4.

[0359] 57. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the linker B is selected from the following structures:

[0360] 58. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the linker B is selected from the following structures:

[0361] 59. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the linker D is a compound containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C 10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups; 18 Direct chain.

[0362] 60. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the connecting chain D further has a side chain of a hydroxymethyl group, a methyl tert-butyl group, a methylphenol group, or a C5-C6 aliphatic ring group.

[0363] 61. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the connecting chain D is a C3-C ... 10 Direct chain.

[0364] 62. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the connecting chain D is a C3-C containing two C=O. 10 Direct chain.

[0365] 63. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the connecting chain D is selected from the following structures:

[0366] wherein each p is independently any integer from 1 to 20; s is an integer from 2 to 13; and Z1 and Z2 are the same or different substituent groups.

[0367] 64. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the connecting chain D is selected from the following structures:

[0368] 65. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the connecting chain D is selected from the following structures:

[0369] 66. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:

[0370] 67. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the targeting-specific ligand X, branch chain L, connecting chain D, and linker B are the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP.

[0371] 68. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22.

[0372] 69. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the 5'MVIP is selected from any one of 5'MVIP 01, 5'MVIP 09, and 5'MVIP 17.

[0373] 70. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27.

[0374] 71. The RNA inhibitor according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the 3'MVIP is selected from any one of 3'MVIP01, 3'MVIP 09, and 3'MVIP 17.

[0375] 72. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09; or the combination of the antisense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

[0376] 73. The RNA inhibitor for inhibiting LPA gene expression according to embodiment 36 or 37, or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is selected from any one of Ky11-DS67, Ky11-DS68, Ky11-DS71, Ky11-DS73, Ky11-DS74, Ky11-DS7101, Ky11-DS7102, Ky11-DS7104, Ky11-DS7106 and Ky11-DS7108.

[0377] 74. The RNA inhibitor or pharmaceutically acceptable salt thereof according to embodiment 36 or 37, wherein the drug comprises one or more of a nucleic acid drug, a chemical drug, and an antibody drug.

[0378] 75. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to embodiment 74, wherein the nucleic acid drug is an siRNA drug.

[0379] 76. The RNA inhibitor of embodiment 75 or a pharmaceutically acceptable salt thereof, wherein the antisense strand is selected from any one or more of Table 15.

[0380] 77. The RNA inhibitor according to embodiment 75 or a pharmaceutically acceptable salt thereof, wherein the sense strand is selected from any one or more of Table 14.

[0381] 78. A pharmaceutical composition comprising the RNA inhibitor of any one of embodiments 1-77, further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0382] 79. The pharmaceutical composition of embodiment 78, wherein the delivery vehicle comprises one or more of: nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems.

[0383] 80. The use according to embodiment 78, wherein the disease or pathology comprises a disease or pathology associated with elevated levels of Lp(a) or apo(a).

[0384] 81. The use according to embodiment 78, wherein the disease or pathology comprises a hepatic disease.

[0385] 82. The use according to embodiment 78, wherein the disease or pathology comprises an inflammatory, cardiovascular or metabolic disease.

[0386] 83. The use according to embodiment 78, wherein the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0387] 84. A method for preventing or treating a disease, condition, or syndrome, comprising administering to a subject in need thereof an effective amount of an RNA inhibitor of LPA gene expression or a pharmaceutically acceptable salt thereof according to any one of embodiments 1-37, an RNA inhibitor according to embodiments 38-77, or a pharmaceutical composition according to any one of embodiments 78 or 79.

[0388] 85. The method of embodiment 84, wherein the RNA inhibitor, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject subcutaneously, intravenously, orally, by aerosol inhalation, rectally, or intraperitoneally.

[0389] 86. A method for inhibiting LPA mRNA or Lp(a) expression, comprising administering to a subject in need thereof an effective amount of an RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof according to any one of embodiments 1-37, an RNA inhibitor or a pharmaceutically acceptable salt thereof according to embodiments 38-77, or a pharmaceutical composition according to any one of embodiments 78 or 79.

[0390] Without intending to be bound by any theory, the following examples are merely intended to illustrate the RNA inhibitors, preparation methods, and uses of the present invention, and are not intended to limit the scope of the present invention.

[0391] Example

[0392] illustrate:

[0393] The Chinese name of DMSO is dimethyl sulfoxide;

[0394] The Chinese name of DMF is N,N-dimethylformamide;

[0395] The Chinese name of HOBt is 1-hydroxybenzotriazole;

[0396] The Chinese name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate;

[0397] The Chinese name of DIPEA (DIEA) is N,N-diisopropylethylamine;

[0398] The Chinese name of DCM is dichloromethane;

[0399] The Chinese name of DMAP is 4-dimethylaminopyridine;

[0400] The Chinese name of DMT-CL is 4,4'-dimethoxytriphenylmethane;

[0401] The Chinese name for MEOH is methanol;

[0402] The Chinese name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate;

[0403] The name of the solid phase carrier is macroporous aminomethyl resin (Resin).

[0404] Example 1 Synthesis of RNA Inhibitors

[0405] The sense strand and the antisense strand are synthesized by the solid-phase phosphoramidite method known in the art, and the sense strand and the corresponding antisense strand are complementary annealed to obtain the corresponding RNA inhibitor.

[0406] The basic steps of the solid phase phosphoramidite method include:

[0407] 1) Deprotection: removing the hydroxyl protecting group (DMTr) of the starting monomer Solid Support;

[0408] 2) Coupling: Add the first phosphoramidite monomer and the coupling reaction occurs in the 3' to 5' direction;

[0409] 3) Oxidation: oxidizing the resulting nucleoside phosphite to a more stable nucleoside phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus);

[0410] 4) Blocking: The 5'-OH group of the unreacted nucleotide monomer from the previous step is blocked with a cap to prevent it from further participating in the reaction; the above steps are repeated until the last phosphoramidite monomer is added; then, the ester bond between the Solid Support and the starting monomer is cleaved with aqueous methylamine and ammonia, and the protecting groups such as cyanoethyl (P), benzoyl (mA, fA), and acetyl (mC) on the bases and phosphates on the resulting oligonucleotide are removed; after separation and purification by HPLC, the corresponding sense chain or antisense chain is obtained by filtration and lyophilization.

[0411] Annealing: Accurately measure the concentrations of the reconstituted sense and antisense strands, mix them at equimolar concentrations, and add 1 / 20 the volume of 1M PBS solution to mix again. Heat the mixture to 95°C for 5 minutes, then cool it naturally to 40°C or room temperature for 3 hours. Perform HPLC analysis. The reaction is considered complete if the residual single strands are <5%.

[0412] Example 2 In vitro inhibition of LPA gene expression by liposome-delivered RNAi agents

[0413] The RNA inhibitors prepared according to the method described in Example 1 (Ky11-DS01 to Ky11-DS18 in Table 3) were mixed with an aqueous solution of the RNA inhibitor and an organic solution of DOTMA to form a water-insoluble precipitate. The precipitate was separated, dried, dissolved in chloroform, and further mixed with chloroform solutions of other lipids, including M10CL and PEG600-cholesterol. The mixture was evaporated and dried overnight by vacuum centrifugation to obtain a nanolipid-encapsulated RNAi agent, wherein the weight ratios of DOTMA, M10CL, and PEG600-cholesterol to the RNA inhibitor were 1-1.6, 1.5-2.5, and 2.5-3.5.

[0414] The RNA inhibitor sample solution of nanolipid encapsulated with the corresponding concentration was prepared in DMEM containing 10% fetal bovine serum. 5Seed HepG2 cells at a given cell density and incubate in DMEM with 10% fetal bovine serum at 37°C in 5% CO2 for 24 hours. Add the sample intervention at 10 nM, 1 nM, and 0.1 nM. After 72 hours of incubation, collect the cell samples and add 1 ml of Ezol Lysis Buffer to the collected cell samples. Vortex to mix thoroughly. Add 0.2 ml of chloroform and shake vigorously for 10 seconds. Incubate at room temperature for 1 minute. Centrifuge at 12,000 x g for 15 minutes at 4°C. Transfer the supernatant to a fresh RNase-free centrifuge tube and add an equal volume of 100% ethanol. Aspirate the entire sample and transfer it to a mini-spin column with a 2 ml collection tube. Centrifuge at 8,000 x g at room temperature for 15 seconds. Discard the flow-through. Transfer the remaining sample to the spin column and repeat the previous step. Add 700 μl of Western blotting buffer to the spin column, gently cap, and centrifuge at 8,000 × g for 15 seconds at room temperature. Discard the flow-through and repeat the previous step, washing the spin column twice with 500 μl of Western blotting buffer. LPA mRNA levels were measured by qRT-PCR. The relative percentage of LPA mRNA in the treated samples was determined by comparison with the supernatant of untreated HepG2 cells. The results are shown in Figure 1.

[0415] Experimental results: When the dosage was 10 nM, Ky11-DS08 to Ky11-DS12 had a significant effect on inhibiting the expression level of LPA mRNA in HepG2 cell line.

[0416] As can be seen from Table 3, compared with the sequences of SEQ ID NO. 411 and SEQ ID NO. 422, the two sequences have the same 18 consecutive nucleotides and differ in 3 nucleotides. From the experimental results in Figure 1, it can be seen that the inhibitory effect of Ky11-DS16 corresponding to SEQ ID NO. 422 on LPA mRNA expression levels is similar to that of Ky11-DS05 corresponding to SEQ ID NO. 411; SEQ ID NO. 416 and SEQ ID NO. 419 have the same 17 consecutive nucleotides, and although the corresponding Ky11-DS10 and Ky11-DS13 have quite different inhibitory effects on LPA mRNA expression levels, the effect of Ky11-DS13 is also applicable. Similarly, SEQ ID NOs. 415, 420, and 421 share the same 17 consecutive nucleotides, and their inhibitory effects on LPA mRNA expression levels are all applicable; they are not listed here one by one. It can be seen from this that any sequence in SEQ ID NO.414-418, including a sequence having at least 15 consecutive nucleotides identical to the sequence in SEQ ID NO.414-418, or a sequence having no more than three different nucleotides from the above sequence is within the scope of protection of the present invention.

[0417] It should be noted that this is not the result of a limited number of experiments, but a design idea. Any sequence obtained by transforming multiple nucleotides or a sequence designed by intercepting 15 or more consecutive identical nucleotides belongs to this design idea and is within the scope of protection of the present invention.

[0418] Example 3 Investigating the in vitro effects of RNA inhibitors using HepG2 cells

[0419] This invention investigates the in vitro activity of the modified sequences screened in Example 2, wherein the modification methods include: the -OH at the 2' position of the sugar group of the nucleotides at positions 7, 12, and 14 starting from the 5' end of the antisense chain is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the antisense chain is replaced by a methoxy group, and at least two consecutive phosphorothioate bonds exist between the three consecutive nucleotides at the end of the antisense chain; the -OH at the 2' position of the sugar group of the nucleotides at positions 5, 7, 8, and 9 starting from the 5' end of the sense chain is fluorinated, the -OH at the 2' position of the sugar group of the remaining nucleotides of the sense chain is replaced by a methoxy group; and at least two consecutive phosphorothioate bonds exist between the three consecutive nucleotides at the end of the sense chain; or

[0420] The -OH at the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense chain is fluorinated, and the -OH at the 2' position of the sugar group of the remaining nucleotides in the antisense chain is replaced by a methoxy group, and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the antisense chain; the -OH at the 2' position of the sugar group of the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense chain is fluorinated, and the -OH at the 2' position of the sugar group of the remaining nucleotides in the sense chain is replaced by a methoxy group; and there are at least two consecutive phosphorothioate bonds between the three consecutive nucleotides at the end of the sense chain.

[0421] Take the RNA inhibitor in Table 7 prepared according to the method described in Example 1. Prepare DMEM culture medium containing 10% fetal bovine serum. Culture the cells (HepG2) in 10 cm culture dishes until they are 80-90% confluent, and then inoculate into 6-well plates. Pour off the culture medium and wash the cells twice with 2 ml PBS. Add 2 ml of Trypsin-EDTA solution (trypsin cell digestion solution), mix well, and place at 37°C for 3-5 minutes. Carefully aspirate the trypsin solution, add 2 ml of DMEM culture medium containing 10% FBS, and blow to form a single cell suspension. Count the cells using a hemocytometer and dilute the cells to 1.5×10 7 cells / ml. According to 1.5×10 6Seed cells at a concentration of 100 cells / well in a 6-well plate, mix thoroughly, and incubate at 37°C, 5% CO₂ for 24 hours. Dissolve siRNA oligo in 120 μl of DEPC-H₂O per OD₂⁶⁶ of siRNA oligo to a final concentration of approximately 20 μM. To transfect one well of a 6-well plate, add 250 μl of serum-free DMEM medium to a 1.5 ml EP tube, add 30 μl of siRNA oligo, and mix thoroughly. In another 1.5 ml EP tube, add 250 μl of serum-free DMEM and 5 μl of GP-Transfect-Mate (GenePharma), mix thoroughly, and incubate at room temperature for 5 minutes. Combine the two tubes and incubate at room temperature for 20 minutes. Aspirate the culture medium from the 6-well plate and add the transfection mixture dropwise to the 6-well plate. Mix thoroughly and incubate in an incubator for 5 hours. Aspirate the transfection solution and add 1 ml of DMEM supplemented with 10% FBS. The cells were cultured at 37°C and 5% CO2 for 24 or 48 hours, and samples were collected. The obtained cells were used to detect the mRNA expression level of the LPA gene by PCR.

[0422] Experimental results: As shown in Figure 2, when the dosage was 1 nM or 10 nM, Ky11-DS38, Ky11-DS39, Ky11-DS41, Ky11-DS42, Ky11-DS45, Ky11-DS47, Ky11-DS54, Ky11-DS62, and Ky11-DS64 had a significant effect on inhibiting the expression level of LPA mRNA in HepG2 cell lines.

[0423] Example 4 Synthesis of 5'MVIP and 3'MVIP Compounds

[0424] When the 3' end of the sense strand or antisense strand of the RNA inhibitor of the present invention has 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid phase synthesis. The general formula of the solid support of 3'MVIP is as follows:

[0425] When m is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding Solid Support of 3'MVIP.

[0426] When m is 1, the obtained Solid Support is used as the starting monomer for the solid-phase synthesis of the sense chains of RNA inhibitors Ky11-DS7102 and Ky11-DS7103 and the antisense chains of Ky11-DS7106 and Ky11-DS7107; when m is 2, the obtained Solid Support is used as the starting monomer for the solid-phase synthesis of the sense chains of RNA inhibitors Ky11-DS7104 and Ky11-DS7105 and the antisense chains of Ky11-DS71 and Ky11-DS7101;

[0427] When m is 3, the obtained Solid Support is used as the starting monomer for the solid-phase synthesis of the antisense strand of RNA inhibitors Ky11-DS7108 and Ky11-DS7109.

[0428] When the 5' end of the sense strand or antisense strand of the RNA inhibitor of the present invention has 5'MVIP, the 5'MVIP phosphoramidite monomer is the last phosphoramidite monomer in the solid phase synthesis of the sense strand or antisense strand. The general formula of the 5'MVIP phosphoramidite monomer is as follows:

[0429] When n is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding 5'MVIP phosphoramidite monomer.

[0430] When n is 1, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer in the solid-phase synthesis of the positive chain of RNA inhibitors Ky11-DS7104, Ky11-DS7105, Ky11-DS7106, Ky11-DS7107, Ky11-DS7108, and Ky11-DS7109; when n is 2, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer in the solid-phase synthesis of the positive chain of Ky11-DS71, Ky11-DS7101, Ky11-DS7102, and Ky11-DS7103.

[0431] When n is equal to 3, the resulting 5'MVIP phosphoramidite monomer with three ligands X can be used as the last monomer in the solid-phase synthesis of the sense chain or antisense chain.

[0432] Before the solid-phase synthesis of the sense and antisense strands of the RNA inhibitors described in the present invention, the corresponding 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers need to be chemically synthesized. The chemical synthesis process is described as follows:

[0433] 1.3 Synthesis of MVIP Solid Support

[0434] 1.1 Synthesis of 3'MVIP09 Solid Support for the Sense Strands of RNA Inhibitors Ky11-DS71 and Ky11-DS7101 and the Antisense Strands of Ky11-DS7104 and Ky11-DS7105

[0435] 3'MVIP09's Solid Support

[0436] Description of the synthesis process:

[0437] 1.1.1 Synthesis of ERC-01-c1

[0438] Weigh 5.0 g of 2-amino-1,3-propanediol (54.9 mmol) and add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL). Cool to 0°C and add tert-butyl acrylate (20 mL, 137.8 mol) dropwise over 2 hours. Allow to react at room temperature for 48 hours. Add petroleum ether (100 mL), wash twice with saturated brine, and dry the organic layer. Pass the mixture through a chromatography column (crab food extract: ethyl acetate: petroleum ether = 25%-75%). Add 0.05% triethylamine to the column to obtain 6.2 g of a colorless oil.

[0439] 1.1.2 Synthesis of ERC-01-c2

[0440] Weigh ERC-01-c1 (6.2 g, 17.9 mmol), add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add benzyl chloroformate (8.2 mL, 57.4 mmol) dropwise at room temperature for 2 hours. React at room temperature overnight, wash three times with saturated brine, dry over anhydrous sodium sulfate, evaporate the solvent, and pass through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of an oil.

[0441] 1.1.3 Synthesis of ERC-01-c3

[0442] ERC-01-c2 (4.0 g, 8.3 mmol) was added with 12 mL of formic acid, and the mixture was reacted at room temperature overnight. The solvent was evaporated under reduced pressure to obtain 2.8 g of the product.

[0443] 1.1.4 Synthesis of ERCd-01-c1

[0444] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (crab extract: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.

[0445] 1.1.5 Synthesis of ERCd-01-c2

[0446] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogenation was then added under normal pressure, and the reaction was allowed to proceed overnight. The reaction solution was filtered through celite, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of ERCd-01-c2 as an oil. Its high-resolution mass spectrum is shown in Figure 3.

[0447] 1.1.6 Synthesis of 3'MVIP09-c1

[0448] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to the reaction flask in sequence, and then 10 mL of DCM was added and stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added in sequence, and the reaction was allowed to proceed overnight. Water was added and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column to obtain 1.3 g of the product.

[0449] 1.1.7 Synthesis of 3'MVIP09-c2

[0450] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to the reaction flask in sequence, stirred at room temperature to dissolve, and then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence. The reaction was stirred at room temperature and analyzed by TLC. If the reaction was qualified, DCM was concentrated and water was added. The mixture was extracted with DCM, and the organic phase was washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column to obtain 1.55 g of the product.

[0451] 1.1.8 Solid Support Synthesis of 3'MVIP09

[0452] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to the reaction flask in sequence and dissolved. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were then added in sequence. The mixture was shaken for 24 h and filtered. The resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.

[0453] 1.2 Synthesis of the Solid Support for 3'MVIP17 of the Antisense Strand of RNA Inhibitors Ky11-DS7108 and Ky11-DS7109

[0454] 1.2.1 Synthesis of SANC-01-c1

[0455] The synthesis steps refer to the synthesis of 1.1.1.ERC-01-c1.

[0456] 1.2.2 Synthesis of SANC-01-c2

[0457] The synthesis steps refer to 1.1.2. Synthesis of ERC-01-c2.

[0458] 1.2.3 Synthesis of SANC-01-c3

[0459] The synthesis steps refer to 1.1.3. Synthesis of ERC-01-c3.

[0460] 1.2.4 Synthesis of SANCd-01-c1

[0461] The synthesis steps refer to 1.1.4. Synthesis of ERCd-01-c1.

[0462] 1.2.5 Synthesis of SANCd-01-c2

[0463] The synthesis steps refer to 1.1.5. Synthesis of ERCd-01-c2.

[0464] 1.2.6 Synthesis of 3'MVIP17-c1

[0465] The synthesis steps were similar to those described in 1.1.6. Synthesis of 3'MVIP09-c1. The high-resolution mass spectrum of the synthesized 3'MVIP17-c1 is shown in Figure 4 .

[0466] 1.2.7 Synthesis of 3'MVIP17-c2

[0467] The synthesis steps refer to 1.1.7.3'MVIP09-c2 synthesis.

[0468] 1.2.8 Solid Support Synthesis of 3'MVIP17

[0469] The synthesis steps refer to 1.1.8 Solid Support Synthesis of 3'MVIP09.

[0470] 1.3 Synthesis of the Solid Support for 3'MVIP01 of the Antisense Strands of the RNA Inhibitors Ky11-DS7106 and Ky11-DS7107 and the Sense Strands of Ky11-DS7102 and Ky11-DS7103:

[0471] 3'MVIP01Solid Support

[0472] Description of the synthesis process:

[0473] 1.3.1 Synthesis of 3'MVIP01-c1

[0474] The synthesis steps refer to 1.1.6.3'MVIP09-c1 synthesis.

[0475] 1.3.2 Synthesis of 3'MVIP01-c2

[0476] The synthesis steps refer to 1.1.7.3'MVIP09-c2 synthesis.

[0477] 1.3.3 Solid Support Synthesis of 3'MVIP01

[0478] The synthesis steps refer to 1.1.8.3'MVIP09 Solid Support Synthesis.

[0479] 2. Synthesis of 5'MVIP Phosphoramidite Monomer

[0480] 2.1 When n is 2, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer 5'MVIP09 phosphoramidite monomer in the solid phase synthesis of the positive chain of Ky11-DS71, Ky11-DS7101, Ky11-DS7102, and Ky11-DS7103:

[0481] 5'MVIP09 phosphoramidite monomer

[0482] 2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1

[0483] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Benzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added and stirred at room temperature overnight. The mixture was quenched with water (50 mL) and extracted with DCM (30 mL*3). The mixture was washed with 10% citric acid (50 mL*3), saturated sodium bicarbonate (50 mL) and pyridine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0484] 2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2

[0485] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, methanol (50 mL) was added, and hydrogenation was carried out at room temperature with stirring overnight. After the reaction, the palladium on carbon was filtered through celite and rotary evaporation was performed to obtain a crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 5.

[0486] 2.1.3 Synthesis of 5'MVIP09-ERCd-PFP

[0487] The crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL). DIPEA (1.33 g) was added and cooled. Pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added and stirred at room temperature for 2 h. The product was then rotary evaporated and dissolved in DCM (60 mL). The product was washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1). The product was dried over anhydrous sodium sulfate, filtered, and rotary evaporated to obtain the crude product of 5'MVIP09-ERCd-PFP (2.35 g). The product was dried and used directly in the next reaction without purification.

[0488] 2.1.4 Synthesis of 5'MVIP09 phosphoramidite monomer-c1

[0489] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL) and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added and the mixture was extracted with DCM (30 mL x 3). The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain 5'MVIP09 monomer-c1 (1.73 g).

[0490] 2.1.5 5'MVIP09 phosphoramidite monomer

[0491] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL). Diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise under ice bath. The reaction was carried out at room temperature for 4 h. The reaction was controlled by HPLC. After the reaction was qualified, the product 5'MVIP09 monomer (1.2 g) was obtained by concentration and column purification.

[0492] 2.2 When n is 1, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer 5'MVIP01 phosphoramidite monomer in the solid phase synthesis of the positive strand of Ky11-DS7104, Ky11-DS7105, Ky11-DS7106, Ky11-DS7107, Ky11-DS7108, and Ky11-DS7109:

[0493] 5'MVIP01 phosphoramidite monomer

[0494] 5'MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) was weighed, and the remaining operations were carried out according to 2.1.1. to 2.1.5.

[0495] Example 5 Synthesis of RNAi Agents Conjugated with 5'MVIP09 / 3'MVIP 09 and Different siRNAs

[0496] Synthesis of the ligand-coupled antisense strand in Table 13: Purge the reagent bottle with argon for at least 2 minutes. Add the phosphoramidite monomer and acetonitrile to the bottle in sequence. Tighten the cap and shake until the solid is visually dissolved. Then, add 3A molecular sieves and let stand for at least 8 hours before use. Purge the reagent bottle with argon for at least 2 minutes. Add hydrogenated xanthan gum and dry pyridine to the bottle in sequence. Tighten the cap and shake until the solid is visually dissolved. Store for later use. Ensure that the following procedures are performed at room temperature (20-30°C): Weigh the 3'MVIP ligand and add it to the bottle. Add acetonitrile and shake to mix thoroughly. Transfer the ligand to a synthesis column and elute any remaining ligand in the bottle with acetonitrile. After elution, fill the column with acetonitrile, recording the amount of acetonitrile used. Install and secure the synthesis column according to the instrument instructions.

[0497] Connect the prepared monomer solution, CAP A, CAP B, oxidant, thiolation reagent, activator, decapping agent and acetonitrile to the corresponding tubing of AKTA PILOT100, ensuring that the tubing is inserted into the bottom of the reagent bottle.

[0498] Once the synthesis method is set up and the instrument is ready, click Run to begin the synthesis. Observe and record the area of ​​each detritylation peak online. During the synthesis, add additional deprotection reagent based on the actual amount used.

[0499] After the synthesis is completed, argon is purged into the synthesis column for ≥2h, and the synthesis column is unloaded according to the operating procedures. The solid phase carrier in the synthesis column is transferred to the reaction bottle, methylamine aqueous solution and ammonia water are added, and the reaction bottle is placed in a shaker at 35°C for 2-3 hours. The solution is filtered into a round-bottom flask, and the residual solid phase is washed with 50% ethanol aqueous solution, filtered again and combined with the previous filtrate, the round-bottom flask is connected to a rotary evaporator, the water temperature is set to 50°C and evaporated until no distillate is produced, ethanol is added to the round-bottom flask, mixed, and evaporated again until no distillate is produced. Repeat the operation until white powder appears at the bottom of the bottle. The obtained white powder is prepared into a solution, purified using a reverse chromatography column, and samples are taken to detect OD260 and purity. The purified antisense chain solution is divided into vials and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.

[0500] The synthesis of the ligand-coupled sense strand in Table 13 follows the same procedure as for the antisense strand, except that the column was loaded with a Universal support. Add DIPEA to the resulting intermediate to create a solution, then add the 5'MVIP phosphoramidite monomer. Mix thoroughly, and incubate the reaction flask in a shaker at 35°C for 2-3 hours.

[0501] Table 13 Description of the synthesis annealing process of RNA inhibitors:

[0502] Take the sense chain and antisense chain in Table 13, mix them in a reaction bottle at an equimolar ratio of 1:1, and after 5 minutes in a water bath at 95°C, turn off the power of the water bath and let it cool naturally to below 40°C. Add 3M sodium acetate aqueous solution to the double-stranded solution, mix evenly, then add an appropriate volume of anhydrous ethanol, mix evenly, and place the reaction solution in a -20°C refrigerator for 45 minutes. Set the refrigerated high-speed centrifuge to 4°C for pre-cooling. After the temperature is reached, add the double-stranded solution and start the centrifuge. Take out the double-stranded solution after centrifugation, remove the supernatant, add ultrapure water to completely dissolve the solid, take samples to test OD260 and purity, and obtain the RNAi agent in Table 14. The purified finished solution is divided into syringe bottles for freeze-drying for later use, and the product is sealed and stored in a -20°C refrigerator.

[0503] Example 6: Application of PCH to evaluate the activity of RNA inhibitors containing 5'MVIP09 / 3'MVIP09 structures

[0504] Primary Cynomolgus Monkey Hepatocytes (PCH) were used to evaluate the effect of the combined vector structure 5'MVIP09 / 3'MVIP09 coupled to the ends of the sense and / or antisense strands of RNA inhibitors on the in vitro activity of the modified sequences.

[0505] On day 0, PCH cells were plated in 48-well plates, and the RNAi agent was allowed to freely uptake into the cells while the cells were seeded. On day 1, PCH cells were added, and on day 2, fresh culture medium was replaced. Fresh culture medium containing RNA inhibitors was replaced every two days, and the test compounds were tested at three concentrations (500nM, 100nM, and 10nM) in triplicate. On day 8, the supernatant was collected and the LPA mRNA levels were analyzed by qPCR. The results are shown in Figure 6. Ky11-DS67-Ky11-DS72 and Ky11-DS74-Ky11-DS76 significantly inhibited the expression of LPA mRNA in PCH cells.

[0506] Example 7 In vivo efficacy study of RNA inhibitors in cynomolgus monkey model

[0507] The combined construct 5'MVIP09 / 3'MVIP09 was coupled to the ends of the sense and / or antisense strands of an RNA inhibitor to determine the effect on the in vivo activity of the modified sequence. The corresponding RNA inhibitors Ky11-DS67, Ky11-DS68, Ky11-DS71, Ky11-DS73, and Ky11-DS74 were prepared according to the method described in Example 5.

[0508] Twelve male cynomolgus macaques aged 4 to 7 years were randomly divided into a control group and a treatment group based on body weight after acclimation. The dose was 3 mg / kg. The day of grouping and dosing was defined as day 0, and dosing took place in the morning of that day. Each RNA inhibitor was added to normal saline to prepare a solution. Blood was collected 7, 14, 21, 28, and 35 days after the first dose. Plasma was separated and lipoprotein (LP(a)) and LDL-C levels were measured.

[0509] Normalized to d0 and the control group, the change rates of LP(a) levels and LDL-C in the blood of cynomolgus monkeys after RNA inhibitor intervention are shown in Figures 7 and 8.

[0510] The experimental results showed that Ky11-DS67, Ky11-DS68, Ky11-DS71, Ky11-DS73, and Ky11-DS74 all showed significant and sustained effects in inhibiting LP(a) and LDL-C levels in crab-eating macaques.

[0511] Example 8 Exploratory Study on the Efficacy of RNA Inhibitors Formed by Different 5'MVIP / 3'MVIP Combinations in Cynomolgus Monkeys

[0512] This example investigates the effects of different 5'MVIP / 3'MVIP combinations on the in vivo activity of RNA inhibitors when coupled to the sense and / or antisense ends of the RNA inhibitors. s U s AAfUGfGfAfCAGAGUUAUCG s A s The 5' end and / or 3' end of U (SEQ ID NO. 460) were coupled with 5'MVIP and / or 3'MVIP of different structures, and the antisense strand C s G s AUAAfCUCUGfUCfCAUUAC s C s The 5' and / or 3' ends of A (SEQ ID NO. 496) were conjugated with 5'MVIP and / or 3'MVIP of different structures. Representative RNA inhibitors Ky11-DS7101, Ky11-DS7102, Ky11-DS7104, Ky11-DS7106, and Ky11-DS7108 listed in Table 17 were prepared according to the method described in Example 5. Twelve male cynomolgus monkeys aged 4 to 7 years were randomly divided into a control group (n=2) and a treatment group (n=2) based on body weight after adaptive feeding. The dose was 3 mg / kg. The day of group administration was defined as d0, and administration was performed in the morning of the same day. Each RNA inhibitor was prepared by adding physiological saline to a solution. Blood was collected 7, 14, 21, 28, and 35 days after the first administration. Plasma was separated and LP(a) levels were measured.

[0513] Normalized to d0 and the control group, the LP(a) levels in the blood of cynomolgus monkeys after RNA inhibitor intervention are shown in Figure 9.

[0514] Experimental results showed that the RNA inhibitors Ky11-DS7101, Ky11-DS7102, Ky11-DS7104, Ky11-DS7106, and Ky11-DS7108 all showed a greater than 90% reduction in LP(a) levels on day 7 after administration. The vector combinations shown in Table 17 can effectively deliver the modified RNA inhibitors.

[0515] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.

Claims

1. An RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, comprising a complementary region to an antisense strand, wherein the complementary region comprises at least 15 consecutive nucleotides, wherein: The antisense strand comprises the following nucleotide sequence: any one of SEQ ID NOs. 414-418, a sequence having at least 15 consecutive nucleotides identical to any one of SEQ ID NOs. 414-418, or a sequence having no more than three different nucleotides from the above sequence.

2. The RNA inhibitor for inhibiting LPA gene expression according to claim 1 or a pharmaceutically acceptable salt thereof, wherein: The positive strand comprises the following nucleotide sequences: any one of SEQ ID NOs. 396-400, a sequence having at least 15 consecutive nucleotides identical to those in SEQ ID NOs. 396-400, or a sequence having no more than three different nucleotides from the above sequences.

3. The RNA inhibitor for inhibiting LPA gene expression according to claim 2 or a pharmaceutically acceptable salt thereof, wherein: The sense strand and antisense strand are selected from any one or more of the following combinations: 1) Sense strand: ugguaauggacagaguuauuu (SEQ ID NO. 396), antisense strand: auaacucuguccauuaccauu (SEQ ID NO. 414); 2) Sense strand: acagaguuaucgaggcucatt (SEQ ID NO. 397), antisense strand: ugagccucgauaacucuguuu (SEQ ID NO. 415); 3) Sense strand: guaauggacagaguuaucgau (SEQ ID NO. 398), antisense strand: cgauaacucuguccauuacca (SEQ ID NO. 416); 4) sense strand: gccccuugguguuauacaa (SEQ ID NO. 399), antisense strand: uuguauaacaccaaggggcug (SEQ ID NO. 417); and 5) Sense strand: gcuccuuauuguuauacga (SEQ ID NO. 400), antisense strand: ucguauaacaauaaggagcug (SEQ ID NO. 418).

4. The RNA inhibitor for inhibiting LPA gene expression according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein: One or more nucleotides on the sense strand and / or antisense strand are modified to form a modified nucleotide sequence.

5. The RNA inhibitor for inhibiting LPA gene expression according to claim 4 or a pharmaceutically acceptable salt thereof, wherein: The sense strand and antisense strand are selected from any one or more of the following combinations: 1) Sense strand: UsGsGUfAAfUfGfGACAGAGUUAUsUsU (SEQ ID NO. 456), antisense strand: AsUsAACUfCUGUCfCAfUUACCAsUsU (SEQ ID NO. 492); 2) Sense strand: AsCsAGfAGfUfUfAUCGAGGCUCAsTsT (SEQ ID NO. 457), antisense strand: UsGsAGCCfUCGAUfAAfCUCUGUsUsU (SEQ ID NO. 493); 3) Sense strand: GsUsAAfUGfGfAfCAGAGUUAUCGsAsU (SEQ ID NO. 460), antisense strand: CsGsAUAAfCUCUGfUCfCAUUACsCsA (SEQ ID NO. 496); 4) Sense strand: GsCsfCCfCUfUfGfGUfGUfUAfUACsAsA (SEQ ID NO. 463), Antisense strand: UsfUsGfUAfUAfACACCAfAGfGGGCsUsG (SEQ ID NO. 499); and 5) Sense strand: GsCsfUCfCUfUfAfUUfGUfUAfUACsGsA (SEQ ID NO. 465), antisense strand: UsfCsGfUAfUAfACAAUAfAGfGAGCsUsG (SEQ ID NO. 501); Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate.

6. The RNA inhibitor for inhibiting LPA gene expression according to claim 1 or a pharmaceutically acceptable salt thereof, wherein: The RNA inhibitor is selected from one or more of Ky11-DS38, Ky11-DS39, Ky11-DS42, Ky11-DS45 and Ky11-DS47.

7. The RNA inhibitor for inhibiting LPA gene expression according to claim 1 or a pharmaceutically acceptable salt thereof, further comprising a ligand, wherein: The ligand is conjugated to the sense strand and / or the antisense strand.

8. The RNA inhibitor for inhibiting LPA gene expression according to claim 7 or a pharmaceutically acceptable salt thereof, wherein: The RNA inhibitor is selected from one or more of Ky11-DS71 and Ky11-DS7101 to Ky11-DS7109.

9. A pharmaceutical composition comprising the RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

10. Use of the RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof and the pharmaceutical composition according to claim 9 in the preparation of a medicament for preventing or treating a disease or pathology or reducing the risk of a disease or pathology.

Images