Application of HMBOX1 inhibitor in preparation of medicine for preventing and / or treating muscular atrophy

Abstract

The invention provides application of an HMBOX1 inhibitor in preparation of a medicine for preventing and / or treating amyotrophy, and belongs to the technical field of biological medicine. In a cellular level functional experiment, it is found that muscle atrophy can be effectively inhibited by inhibiting expression of HMBOX1, and it is further found that muscle atrophy can be prevented and treated by inhibiting expression of HMBOX1 in an animal level functional experiment. Therefore, the HMBOX1 inhibitor is used for preventing and / or treating the muscle atrophy, and a thought is provided for developing the medicine for inhibiting the muscle atrophy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of an HMBOX1 inhibitor in the preparation of a drug for preventing and / or treating muscle atrophy. Background Art

[0002] As the largest organ in the human body, skeletal muscle is mainly involved in important physiological processes such as movement, metabolism and respiration. Muscle atrophy is a group of skeletal muscle cell degenerative diseases. The main manifestations of muscle atrophy are muscle fiber loss and muscle cell protein loss. Systemic diseases such as heart failure and renal failure, as well as acute physical injuries such as severe burns and major trauma, and diseases such as cancer can cause muscle atrophy. Muscle atrophy can seriously affect the quality of life of patients, increase the incidence of other related diseases in patients, seriously affect people's normal life, and bring a heavy burden to families and society. It has become one of the killer diseases that endanger the health of the people.

[0003] At present, a lot of treatment work on muscle atrophy has been carried out clinically, mainly including: sports physical therapy, surgical method, gene therapy, nutritional injection method and some extensive drug therapy. Although these treatments have achieved varying degrees of success, most of them are aimed at slowing down the development of muscle atrophy rather than accurately and specifically treating muscle atrophy. It can be seen that the current clinical treatment methods and treatment effects are limited. Therefore, it is of great clinical significance to explore the mechanism of muscle atrophy and find diagnostic indicators and intervention targets for early denervated muscle atrophy at the molecular level.

[0004] Homeobox containing 1 (HMBOX1) is a member of the Homebox family. It has a Homebox domain at the N-terminus and a DNA binding domain at the C-terminus. It is a potential transcription factor that is highly conserved in different species. HMBOX1 was first discovered in the pancreas and is also highly expressed in skeletal muscle. HMBOX1 has been reported to be involved in cell differentiation, autophagy, and apoptosis. There are currently few reports on the function of HMBOX1 in skeletal muscle. HMBOX1 is a key regulatory factor that regulates the differentiation of bone marrow stem cells and can promote the differentiation of bone marrow stem cells into endothelial cells. However, there are currently no other reports on the diagnosis and treatment of muscle atrophy with HMBOX1. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a use of an HMBOX1 inhibitor in the preparation of a drug for preventing and / or treating muscular atrophy.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an application of an HMBOX1 inhibitor in preparing a drug for preventing and / or treating muscle atrophy.

[0008] Preferably, the muscle atrophy includes one or more of denervation muscle atrophy, fixed muscle atrophy and hormone-induced muscle atrophy.

[0009] Preferably, the HMBOX1 inhibitor includes one or more of a regulator that reduces HMBOX1 expression, a protease that degrades HMBOX1 products, a nuclease, and a regulator that reduces HMBOX1 products.

[0010] Preferably, the regulator for reducing HMBOX1 expression comprises siRNA, shRNA or miRNA.

[0011] Preferably, the modulator that reduces HMBOX1 production comprises an HMBOX1 antibody.

[0012] Preferably, the nucleotide sequence of the siRNA is shown as SEQ ID No.1; the effective sequence of the shRNA is shown as SEQ ID No.1.

[0013] Preferably, the drug slows the loss of muscle mass and the reduction of muscle fiber size.

[0014] Preferably, the drug significantly inhibits the increase of muscle atrophy-specific ubiquitinating enzyme.

[0015] The present invention provides a drug for preventing and / or treating muscle atrophy, comprising an effective component of the drug and a pharmaceutically acceptable carrier, wherein the effective component is the above-mentioned shRNA.

[0016] Preferably, in the above-mentioned medicine, the muscle atrophy includes one or more of denervation-induced muscle atrophy, fixed muscle atrophy and hormone-induced muscle atrophy.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides an application of an HMBOX1 inhibitor in the preparation of a drug for preventing and / or treating muscle atrophy. The present invention finds in a functional experiment at the cell level that inhibiting the expression of HMBOX1 can effectively inhibit the occurrence of muscle atrophy, and further finds in a functional experiment at the animal level that inhibiting the expression of HMBOX1 has the effect of preventing and treating muscle atrophy. Therefore, the present invention uses the HMBOX1 inhibitor to prevent and / or treat muscle atrophy, providing a new idea for the development of drugs for inhibiting muscle atrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is the plasmid map of pLKO.1puro;

[0020] Figure 2 The results show the effect of Sh-HMBOX1 on the expression of HMBOX1;

[0021] Figure 3 The results of the effects of different treatment groups on muscle atrophy induced by dexamethasone (Dex) at the cellular level, A is the effect of different treatment groups on the diameter of myotube cells of muscle atrophy induced by dexamethasone (Dex), the scale is 100 μm; B is the effect of different treatment groups on muscle atrophy-specific ubiquitinase Atrogin-1 and MuRF-1 induced by dexamethasone (Dex); **p<0.01;

[0022] Figure 4 The results show the effect of AAV8-sh-HMBOX1 on the expression of HMBOX1;

[0023] Figure 5 The results of the effects of different treatment groups on muscle atrophy induced by denervation (Den), A is the results of the effects of different treatment groups on muscle weight of Den-induced muscle atrophy, where the muscle pictures from left to right are AAV8-sh-control+Sham, AAV8-sh-control+Den, AAV8-sh-HMBOX1+Sham and AAV8-sh-HMBOX1+Den, with a scale of 1 cm; B is the results of the effects of different treatment groups on muscle fiber changes induced by Den-induced muscle atrophy; C is the results of the effects of different treatment groups on Den-induced muscle atrophy-specific ubiquitinating enzymes Atrogin-1 and MuRF-1; **p<0.01;

[0024] Figure 6 Figure 3 shows the effects of different treatment groups on muscle atrophy induced by immobilization (Imo). A shows the effects of different treatment groups on muscle weight of Imo-induced muscle atrophy, where the muscle pictures from left to right are Sham+AAV8-sh-control, Imo+AAV8-sh-control, Sham+AAV8-sh-HMBOX1 and Imo+AAV8-sh-HMBOX1, with a scale of 1 cm; B shows the effects of different treatment groups on muscle fiber changes of Imo-induced muscle atrophy; C shows the effects of different treatment groups on Atrogin-1 and MuRF-1, the specific ubiquitinating enzymes for Imo-induced muscle atrophy; *p<0.05, **p<0.01. DETAILED DESCRIPTION

[0025] The present invention provides an application of an HMBOX1 inhibitor in preparing a drug for preventing and / or treating muscle atrophy.

[0026] In the present invention, the HMBOX1 is a protein that regulates muscle atrophy. The HMBOX1 CDS region encodes 420 amino acids. The sequence of the HMBOX1 CDS region is as follows:

[0027]

[0028] In the present invention, the inhibitor can inhibit the expression of HMBOX1 in cells and tissues, or can destroy the stability of HMBOX1 in cells and tissues, or can reduce the activity of HMBOX1 in cells and tissues, or can reduce the effective action time of HMBOX1 in cells or tissues. The HMBOX1 inhibitor preferably includes one or more of a regulator that reduces HMBOX1 expression, a protease that degrades HMBOX1 products, a nuclease, and a regulator that reduces HMBOX1 products. The regulator that reduces HMBOX1 expression preferably includes siRNA, shRNA or miRNA. The regulator that reduces HMBOX1 products preferably includes an HMBOX1 antibody. The nucleotide sequence of the siRNA is preferably as shown in SEQ ID No.1; the effective sequence of the shRNA is preferably as shown in SEQ ID No.1.

[0029] In the present invention, the drug slows down the reduction of muscle weight and the shrinkage of muscle fibers, and can also significantly inhibit the increase of muscle atrophy-specific ubiquitinating enzyme.

[0030] The present invention provides a drug for preventing and / or treating muscle atrophy, comprising an effective component of the drug and a pharmaceutically acceptable carrier, wherein the effective component is the above-mentioned shRNA.

[0031] In the drug for preventing and / or treating muscle atrophy of the present invention, the muscle atrophy includes one or more of denervated muscle atrophy, fixed muscle atrophy and hormone-induced muscle atrophy. The pharmaceutically acceptable carrier includes but is not limited to diluents, buffers, suspensions, emulsions, granules, encapsulations, excipients, fillers, adhesives, sprays, transdermal absorbents, wetting agents, disintegrants, absorption accelerators, surfactants, colorants, flavoring agents or adsorption carriers, and the final drug efficacy is to inhibit the expression of HMBOX1 in cells or tissues.

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1

[0034] 1. Dex-induced muscle atrophy after Sh-HMBOX1 lentivirus intervention

[0035] 1.1 Construction of Sh-HMBOX1 plasmid:

[0036] (S1) Vector: pLKO.1puro, the plasmid map of pLKO.1puro can be found in Figure 1 .

[0037] (S2) The shRNA sequence was designed according to the HMBOX1 siRNA sequence as follows. The nucleotide sequence of the siRNA is: GCTGGAAACCATGTCTCACTA (SEQ ID No. 1):

[0038] Upstream primer: AgeI digestion of sticky ends +Active sequence+loop+anti-Active sequence+TTTTTG, 5'- CCGG GCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGCTTTTTG-3' (SEQ ID No. 2);

[0039] Downstream primer :EcoRI digestion sticky ends +CAAAAA+activating sequence+loop+anti-activating sequence, 5'- AAT T CAAAAAGCTGGAAACCATGTCTCACTACTCGAGTAGTGAGACATGGTTTCCAGC-3' (SEQ ID No. 3);

[0040] (S3) Send the obtained shRNA sequence to the company for synthesis.

[0041] (S4) shRNA sequence annealing

[0042] Table 1 shRNA sequence annealing system

[0043]

[0044] Add the shRNA sequence annealing system in Table 1, react at 95°C for 4 min, and cool naturally to room temperature to obtain the annealing product.

[0045] (S5) Double enzyme digestion

[0046] Table 2 Double enzyme digestion system

[0047]

[0048] Add the double enzyme digestion system in Table 2, react at 37°C overnight, and obtain the digestion product.

[0049] (S6) Connection

[0050] Table 3 Connection system

[0051]

[0052]

[0053] Add according to the ligation system in Table 3, react at 16°C overnight to obtain Sh-HMBOX1 plasmid.

[0054] (S7) Conversion

[0055] a. 5 μL Sh-HMBOX1 plasmid + 50 μL competent E. coli (Stbl3), place on ice for 20 min.

[0056] b. Heat shock at 37℃ for 5 min or at 42℃ for 45 s.

[0057] c. Add 1 mL of liquid LB (without antibiotics) and shake at 37°C, 200-250 rpm for 1 h.

[0058] d. After 1 hour, centrifuge at 3000 rpm for 5 minutes.

[0059] e. Discard the supernatant and use the remaining 100-200 μL to resuspend the competent cells and spread them on an Amp+ resistant LB plate.

[0060] f. Incubate at 37°C overnight.

[0061] (S8) Pick a single clone and use it as a template to amplify the target gene, run gel verification, and select the strain with the correct band for sequencing.

[0062] 1.2 Encapsulation of Sh-HMBOX1 lentivirus:

[0063] (1) Prepare the calcium-DNA mixture in a 1.5 mL centrifuge tube. The reagents used are shown in Table 4 (taking an 8 cm cell culture dish as an example).

[0064] Table 4 Sh-HMBOX1 lentiviral coating reagents

[0065] Reagents Dosage pMD2.G 1.25 μg psPAX2 3.75 μg Sh-HMBOX1 Plasmid 5μg <![CDATA[CaCl2(2.5mol / L)]]> 50μL Distilled water Make up to 500 μL

[0066] (2) Take another 2.0 mL centrifuge tube and add 500 μL 2× HEPES.

[0067] (3) Place a 2.0 mL centrifuge tube containing 500 μL of 2×HEPES on a vortex oscillator. Add the calcium-DNA mixture dropwise when the liquid in the centrifuge tube is vortexing. The whole process takes about 1 min. After adding, rotate and vortex a few times and let it stand for 20 min.

[0068] (4) During this period, replace the 293T cells with fresh 37°C preheated culture medium (DMEM + 10% FBS + 1% penicillin-streptomycin), blow the calcium phosphate-DNA precipitate vigorously with a gun for about 8 times, and then immediately add the calcium phosphate-DNA suspension dropwise to the cell culture medium of the above cells, gently mix the culture medium, and the culture medium turns orange-yellow. Under the microscope, there are precipitates of different sizes in the cell dish.

[0069] (5) Place in an incubator at 37°C and 5% CO2 saturated humidity.

[0070] (6) After 24 h, discard the old culture medium and add 10 mL of new culture medium (DMEM + 10% FBS) preheated at 37°C to continue culturing.

[0071] (7) After 48 h, the culture medium containing the lentivirus was collected and temporarily stored in a 4°C refrigerator, and 10 mL of new 37°C preheated culture medium (DMEM + 10% FBS) was added to continue the culture.

[0072] (8) After 72 hours, collect the culture medium containing lentivirus.

[0073] (9) Filter the culture medium containing the lentivirus with a 0.45 μm filter, divide the medium into smaller portions and store them in a −80° C. refrigerator to obtain the Sh-HMBOX1-coated lentivirus.

[0074] At the same time, referring to the above-mentioned method for packaging Sh-HMBOX1 lentivirus, the control lentivirus was packaged with the addition of scramble plasmid. The packaged Sh-HMBOX1 lentivirus and the control lentivirus were transfected into differentiated myotube cells. The transfection time was 72 h and the transfection titer was 1×10 8 TU / mL. Afterwards, fluorescence quantitative PCR was used to detect the expression of HMBOX1. The results are shown in Figure 2 .

[0075] Figure 2 The results showed that compared with the HMBOX1 expression in cells transfected with Scramble control lentivirus, the HMBOX1 expression was significantly reduced after cells were treated with Sh-HMBOX1 lentivirus.

[0076] 1.3 The constructed Sh-HMBOX1 plasmid was packaged into lentivirus with the assistance of psPAX2 and PMD2.G vectors to achieve the purpose of inhibiting HMBOX1. After 48 hours, a Dex-induced muscle atrophy model was constructed at the cellular level.

[0077] The specific operations are:

[0078] (1) C2C12 myoblast differentiation culture: The cells were cultured in a high-density broth medium containing 10% FBS. When the cell density reached about 70%, the culture medium was replaced with a differentiation medium containing 2% horse serum. Mature myotubes were observed after 4 to 5 days of differentiation, and differentiated myotube cells were obtained.

[0079] (2) Experimental groups

[0080] Treatment of transfection control group + muscular atrophy model control group (Scramble+Con): Differentiated myotube cells were transfected with Scramble control lentivirus for 72 hours, and the transfection titer was 1×10 8 TU / mL.

[0081] Treatment of transfection control group + muscle atrophy model Dex group (Scramble+Dex): differentiated myotube cells were transfected with Scramble control lentivirus, and the transfection titer was 1×10 8 TU / mL, 48h after transfection, 50μM Dex was added to induce muscle atrophy, and the experiment was terminated after 24h of Dex treatment.

[0082] Treatment of Sh-HMBOX1 lentivirus transfection group + muscular atrophy model control group (Sh-HMBOX1+Con): Differentiated myotube cells were transfected with Sh-HMBOX1 lentivirus for 72 hours, and the transfection titer was 1×10 8 TU / mL.

[0083] Treatment of Sh-HMBOX1 lentivirus transfection group + muscular atrophy model Dex group (Sh-HMBOX1+Dex): Differentiated myotube cells were transfected with Sh-HMBOX1 lentivirus, and the transfection titer was 1×10 8 TU / mL, 50 μM Dex was added 48 h after transfection to induce muscle atrophy, and the experiment was terminated after 24 h of Dex treatment.

[0084] (3) After the experiment, immunofluorescence staining was performed using the antibody MF-20 (DSHB) that specifically marks myotubes to count the diameter of the myotubes. Then, RNA from myotube cells was extracted and quantitative PCR was used to detect the expression changes of muscle atrophy-specific genes Atrogin-1 and MuRF-1. This was done to determine whether inhibiting the expression of HMBOX1 could inhibit the occurrence of Dex-induced muscle atrophy at the cellular level.

[0085] Figure 3 The results showed that inhibiting the expression of HMBOX1 could significantly increase the diameter of myotube cells and significantly inhibit the increase of muscle atrophy-specific ubiquitinating enzymes (such as Atrogin-1 and MuRF-1), indicating that inhibiting the expression of HMBOX1 can inhibit the occurrence of dexamethasone-induced muscle atrophy at the cellular level.

[0086] Example 2 Den-induced muscle atrophy in mice after AAV8-Sh-HMBOX1 adeno-associated virus intervention

[0087] (1) The Sh-HMBOX1 plasmid constructed in Example 1 was packaged into adeno-associated virus with the assistance of Helper and AAV shuttle vector. Specifically, 10 μg of serum-free AAV8 virus packaging plasmid (AAVConstruct, Helper, serotype8, PEI MAX) was transfected into 293T cells, and the complete culture medium was replaced after 10 hours, and the AAV8 virus was collected after 48 hours. The virus in the culture medium was concentrated by 40% PEG-8000 precipitation, stirred at 4°C for 1 hour, left to stand overnight, and centrifuged at 4000rpm at 4°C for 30 minutes. 5mL of cell lysis buffer (lysis buffer: 150mMNaCl, 20mM tris pH8.0) was added to the virus precipitate and resuspended. The virus in the cell was concentrated by repeated freeze-thaw lysis of the broken cells. 1mM MgCl2 and 250U / mL Benzonase nuclease were added to the above two parts of the virus, mixed and incubated at 37°C for 45 minutes. Centrifuged at 4000rpm at 4°C for 30 minutes to obtain the supernatant. 60%, 40%, 25%, and 17% iodixanol were added in sequence for density gradient centrifugation to purify the virus, and AAV8-sh-HMBOX1 adeno-associated virus was obtained. The virus was concentrated by high-speed centrifugation at 60,000 rpm and 4°C for 2 h, and the virus titer was determined by qRT-PCR. At the same time, referring to the above method, AAV8-sh-control adeno-associated virus was constructed with the addition of vector plasmid. The packaged AAV8-sh-HMBOX1 adeno-associated virus and control virus were mixed at 5×10 11 The titer of GC / mouse was directly injected into the gastrocnemius muscle of mice. Four weeks later, the gastrocnemius muscle tissue of mice was taken and the expression of HMBOX1 was detected by fluorescence quantitative PCR. The results are shown in Figure 4 .

[0088] Figure 4 The results showed that compared with the HMBOX1 expression in the gastrocnemius muscle after injection of AAV8-sh-control adeno-associated virus, the HMBOX1 expression in the gastrocnemius muscle was significantly reduced after injection of AAV8-sh-HMBOX1 adeno-associated virus in the gastrocnemius muscle.

[0089] (2) Calculate the virus titer, 5×10 11 The virus was directly injected into the gastrocnemius muscle of GC / mice, and the denervation (Den) muscle atrophy model was constructed three weeks later. The specific groups and operations were as follows:

[0090] Treatment of the control group virus + muscular atrophy model control group (AAV8-sh-control + Sham): AAV8-sh-control control adeno-associated virus was injected into the gastrocnemius muscle of mice, with an injection titer of 5×10 11GC / mouse, injected once. Sham surgery was performed three weeks later, and the experiment was terminated one week after the sham surgery;

[0091] Treatment of the control group virus injection + muscular atrophy model Den group (AAV8-sh-control+Den): AAV8-sh-control control adeno-associated virus was injected into the gastrocnemius muscle of mice, with an injection titer of 5×10 11 GC / mouse, injected once. Den surgery was performed three weeks later, and the experiment was terminated one week after Den surgery;

[0092] Treatment of AAV8-sh-HMBOX1 adeno-associated virus injection group + muscular atrophy model control group (AAV8-sh-HMBOX1+Sham): AAV8-sh-HMBOX1 adeno-associated virus was injected into the gastrocnemius muscle of mice, with an injection titer of 5×10 11 GC / mouse, injected once. Sham surgery was performed three weeks later, and the experiment was terminated one week after the sham surgery;

[0093] Treatment of AAV8-sh-HMBOX1 adeno-associated virus injection group + muscular atrophy model Den group (AAV8-sh-HMBOX1+Den): AAV8-sh-HMBOX1 adeno-associated virus was injected into the gastrocnemius muscle of mice, with an injection titer of 5×10 11 GC / mouse, injected once. Den surgery was performed three weeks later, and the experiment was terminated one week after Den surgery.

[0094] The Den surgery was performed by using microscissors to cut 3 to 5 mm of the sciatic nerve of the right hind limb of C57BL / 6 mice to ensure that there was no possibility of kissing when the nerve was cut. The sham surgery group performed the same operation but did not cut the nerve.

[0095] (3) After the experiment, the gastrocnemius muscle of the mice was isolated, and the weight changes of the gastrocnemius muscle of the mice were first analyzed using an analytical balance; then, the muscle samples embedded in OCT were frozen and sectioned, and WGA staining was used to statistically analyze the changes in the size of the muscle fibers; finally, RNA was extracted from the gastrocnemius muscle tissue, and fluorescent quantitative PCR was used to detect the expression changes of the muscle atrophy-specific genes Atrogin-1 and MuRF-1. In this way, it was determined whether inhibiting the expression of HMBOX1 could prevent and treat the occurrence of Den-induced muscle atrophy at the animal level.

[0096] Figure 5 The results showed that inhibiting the expression of HMBOX1 could slow down the loss of muscle weight, slow down the shrinkage of muscle fibers, and inhibit the increase of muscle atrophy-specific ubiquitinating enzymes (such as Atrogin-1 and MuRF-1), indicating that inhibiting the expression of HMBOX1 by injecting AAV8-sh-HMBOX1 adeno-associated virus into the gastrocnemius muscle of mice could inhibit the occurrence of denervation (Den)-induced muscle atrophy.

[0097] Example 3: AAV8-sh-HMBOX1 adeno-associated virus intervention after Imo-induced muscle atrophy in mice

[0098] This example uses the AAV8-sh-HMBOX1 adeno-associated virus and the AAV8-sh-control adeno-associated virus prepared in Example 2.

[0099] The Imo-induced muscle atrophy model was established in mice. One week later, 1×10 12 GC / mice were injected with AAV8-sh-HMBOX1 adeno-associated virus directly into the gastrocnemius muscle. The specific groups and operations were as follows:

[0100] The treatment method of the muscular atrophy model control group + injection control virus (Sham + AAV8-sh-control) was as follows: one week after the mice underwent sham surgery, the gastrocnemius muscle was injected with AAV8-sh-control control adeno-associated virus with an injection titer of 1×10 12 GC / mice, injected once, and the experiment was terminated three weeks later;

[0101] The treatment method of the muscular atrophy model Imo group + injection control virus (Imo+AAV8-sh-control) was as follows: one week after the Imo surgery, the gastrocnemius muscle was injected with AAV8-sh-control control adeno-associated virus with an injection titer of 1×10 12 GC / mice, injected once, and the experiment was terminated three weeks later;

[0102] The treatment method of the muscular atrophy model control group + AAV8-sh-HMBOX1 adeno-associated virus injection group (Sham+AAV8-sh-HMBOX1) was as follows: one week after the mice underwent sham surgery, the gastrocnemius muscle was injected with AAV8-sh-HMBOX1 adeno-associated virus at an injection titer of 1×10 12 GC / mice, injected once, and the experiment was terminated three weeks later;

[0103] The treatment method of the muscular atrophy model Imo group + AAV8-sh-HMBOX1 adeno-associated virus injection group (Imo+AAV8-sh-HMBOX1) was as follows: one week after the Imo surgery, the gastrocnemius muscle was injected with AAV8-sh-HMBOX1 adeno-associated virus at a titer of 1×10 12 GC / mice were injected once, and the experiment was terminated three weeks later.

[0104] (3) After the experiment, the gastrocnemius muscle of the mice was isolated, and the weight changes of the gastrocnemius muscle of the mice were first analyzed using an analytical balance; then, the muscle samples embedded in OCT were frozen and sectioned, and WGA staining was used to statistically analyze the changes in the size of the muscle fibers; finally, RNA of the gastrocnemius tissue was extracted, and fluorescent quantitative PCR was used to detect the expression changes of the muscle atrophy-specific genes Atrogin-1 and MuRF-1. In this way, it was determined whether inhibiting the expression of HMBOX1 could treat the occurrence of Imo-induced muscle atrophy at the animal level.

[0105] Figure 6 The results showed that inhibiting the expression of HMBOX1 could slow down the reduction of muscle weight and the shrinkage of muscle fibers induced by immobilization (Imo), and could also inhibit the increase of muscle atrophy-specific ubiquitinating enzymes (such as Atrogin-1 and MuRF-1). It can be seen that inhibiting the expression of HMBOX1 could treat the occurrence of immobilization (Imo)-induced muscle atrophy.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of HMBOX1 inhibitors in the preparation of drugs for preventing and / or treating muscular atrophy.

2. The use according to claim 1, characterized in that: The muscle atrophy includes one or more of denervation muscle atrophy, fixed muscle atrophy and hormone drug-induced muscle atrophy.

3. The use according to claim 1, characterized in that: The HMBOX1 inhibitor includes one or more of a regulator that reduces HMBOX1 expression, a protease that degrades HMBOX1 products, a nuclease, and a regulator that reduces HMBOX1 products.

4. The use according to claim 3, characterized in that: The regulator for reducing HMBOX1 expression includes siRNA, shRNA or miRNA.

5. The use according to claim 3, characterized in that: The modulators that reduce HMBOX1 production include HMBOX1 antibodies.

6. The use according to claim 4, characterized in that: The nucleotide sequence of the siRNA is shown in SEQ ID No.1; the effective sequence of the shRNA is shown in SEQ ID No.

1.

7. The use according to any one of claims 1 to 6, characterized in that: The drug slows the loss of muscle mass and the reduction in size of muscle fibers.

8. The use according to any one of claims 1 to 6, characterized in that: The drug significantly inhibits the increase of muscle atrophy-specific ubiquitinating enzyme.

9. A drug for preventing and / or treating muscle atrophy, characterized in that: The active ingredient of the medicine and the pharmaceutically acceptable carrier, the active ingredient is the shRNA according to claim 4 or 6.

10. The drug according to claim 9, characterized in that The muscle atrophy includes one or more of denervation muscle atrophy, fixed muscle atrophy and hormone drug-induced muscle atrophy.

Images