SNP (Single Nucleotide Polymorphism) molecular marker related to pig feed conversion rate as well as detection primer and application of SNP molecular marker
By genotyping and genome-wide association analysis of the big white pigs, SNP sites related to feed conversion were screened out, primers were designed and strains with genotype T/T were selected for breeding, which solved the low efficiency of traditional breeding methods. The problem of this has achieved the effect of improving pig feed conversion rate and reducing feed consumption.
Patent Information
- Application Number
- CN202411582213.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2025-01-03
- Estimated Expiration
- 2044-11-07
AI Technical Summary
Traditional breeding methods are inefficient, have long cycles and inaccurate estimates of breeding values in improving pig feed conversion rates, resulting in limited progress in pig breeding, making it difficult to effectively reduce feed consumption and improve economic benefits.
By genotyping and genome-wide association analysis of 5256 large white pigs, the SNP site located at the chr8:129423208 site in Ensembl Sscrofa 11.1 was screened as a molecular marker, and corresponding detection primers were designed to select the genotype T/T The strains of the product are selected to improve feed conversion.
It provides an efficient molecular marking and detection method to help select excellent pig breeds, reduce feed consumption, improve feed utilization, and significantly improve breeding cost-effectiveness.
Smart Images
Figure CN119242820A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular markers, and more particularly to a SNP molecular marker related to pig feed conversion rate, a detection primer and application thereof. Background Art
[0002] my country is the world's largest producer and consumer of live pigs. The pig farming industry is not only an important part of my country's animal husbandry, but also a pillar industry of agriculture. In recent years, with the advancement of science and technology and the improvement of management level, the overall production capacity of my country's pig farming industry has increased significantly, but there is still a certain gap compared with foreign countries with developed pig industries. To achieve the healthy and rapid development of the industry, further reduce breeding costs, and improve industrial efficiency, breeding excellent pig breeds is a top priority. Breeds have always been the core and key to determining the production capacity of the pig industry. Nowadays, thanks to the rapid development of science and technology, molecular technologies represented by genome-wide association study (GWAS) have been widely used in the field of livestock and poultry breeding. GWAS was first proposed by Risch et al. It uses the genetic variation information in the population to associate with the phenotypic information, and then explores the potential variation sites and candidate genes related to the target traits, in order to reveal the genetic mechanism of important traits. It was originally used to assist in the study of complex human diseases, but now it has been gradually expanded to the identification of single nucleotide polymorphism (SNP) sites of complex economic traits of many animals and plants including livestock and poultry, and has made a series of significant progress.
[0003] Feed Conversion Ratio (FCR) is an important economic trait of pigs. It reflects the efficiency of pigs in using nutrients in feed to maintain metabolism, promote muscle growth and fat accumulation. It is a key indicator to measure pig growth traits. The feed conversion rate directly affects the cost and economic benefits of breeding. According to statistics, in the breeding process, feed costs account for more than 60% of the total production costs. If the feed conversion rate of meat pigs in my country is reduced from 2.8:1 to 2.6:1, at least about 13 million tons of feed can be saved in the production process, which is equivalent to 10% of my country’s annual grain imports, effectively alleviating the current situation of "people and animals competing for food". Therefore, reducing feed consumption in the production process and improving feed utilization have always been one of the goals of breeding pigs. In the breeding process, due to the long cycle, low efficiency, inaccurate breeding value estimation and other problems of traditional breeding methods, the breeding progress achieved is very limited. The GWAS method can efficiently obtain SNP sites related to feed conversion rate in the whole genome, and use them as molecular markers for subsequent breed selection of feed conversion rate traits, providing a theoretical basis for the selection of pig breeds.
[0004] Therefore, providing a SNP molecular marker related to pig feed conversion rate and its detection primers and uses is an urgent problem to be solved by those skilled in the art. Summary of the invention
[0005] In view of this, the present invention provides a SNP molecular marker related to the feed conversion rate of pigs, its detection primers and uses, with the aim of screening out a molecular marker related to the feed conversion rate trait of Large White pigs, and providing a detection method for the corresponding SNP loci, so as to provide new loci and theoretical basis for marker-assisted selection of the feed conversion rate trait of Large White pigs.
[0006] In order to achieve the above object, the present invention adopts the following technical solution:
[0007] The feed conversion rate of 5256 large white pigs was measured and recorded. The collected DNA was genotyped and genotype quality controlled by Porcine 80K SNP high-density functional site chip. The SNP sites that passed the quality control were combined with the phenotypic data of the experimental population for GWAS, and then the SNP sites significantly related to the feed conversion efficiency of pigs were screened. According to the Ensemble database Sus Scrofa 11.1 version pig reference genome, a significant SNP site located at the 129423208 nucleotide site of chromosome 8 was finally identified. The nucleotide sequence is shown in SEQ ID NO.1, the SNP marker is located at the 97th position of the sequence, and the polymorphic site is T or G. The SNP screened by the present invention can be used as a molecular marker for the feed conversion rate of pigs. For the chr8:129423208 site, a strain with a genotype of T / T should be selected for breeding.
[0008] ATCGAAGGAGCCAGGAAATAGACTTATACAAGGATTGTACCTCTAGTACCTAGATCTCATCAGAGGAAGGAAGGGGAGCAGATTTAGAGGAAAAGATCATACTTCCTTTTGTGTCCCCAGCTTCTATTATGTAGCCATCTAT CCTCCAGCACTCAACACACGCATGTTCTATTCTGACAGAGCCAACAAAATGATCCCTTTATAAATAAGAACAAATCATTCCAGGATTCTGCTCCAAATCTGGTCTTCCCATAGCTCAAAGTCAAACTCATTGCAGCAGC; SEQ ID NO.1.
[0009] A SNP molecular marker associated with pig feed conversion rate, wherein the SNP molecular marker is located at chr8:129423208 of the genome version Ensembl Sscrofa 11.1, and the polymorphic site is T or G.
[0010] Furthermore, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at the 97th position of the nucleotide sequence shown in SEQ ID NO.1.
[0011] Further, a primer for detecting the SNP molecular marker, the primer sequence is as follows:
[0012] Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO.2;
[0013] Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.3.
[0014] Furthermore, the SNP molecular marker or the primer is used in detecting the feed conversion rate trait of pigs.
[0015] Furthermore, strains with a genotype of T / T at the chr8:129423208 locus were selected for breeding, and strains with a genotype of T / T had a high feed utilization rate.
[0016] Furthermore, the breed of the pig is Large White pig.
[0017] Furthermore, the SNP molecular marker or the primer is used in pig genetic breeding.
[0018] Furthermore, a kit for detecting the SNP molecular marker is provided, characterized in that it comprises the primer.
[0019] Furthermore, a method for improving pig breeds comprises the following steps: detecting the SNP molecular markers on pig chromosome 8, selecting strains with a genotype of T / T for breeding, thereby reducing the feed consumption of offspring pigs during the production process, improving feed conversion rate traits, and increasing feed utilization.
[0020] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses a SNP molecular marker related to the feed conversion rate of pigs, its detection primers and uses. The present invention collects DNA from 5256 Large White pigs in an experimental group, uses the Porcine 80K SNP high-density functional site chip for genotyping, and combines the feed conversion rate phenotype of the experimental group to perform GWAS analysis based on the MLM model, thereby screening out SNP sites that are significantly correlated with the feed conversion rate trait, providing new molecular markers for the improvement of the feed conversion rate trait of Large White pigs. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0022] Figure 1 The attached figure shows the distribution of feed conversion rate phenotypes of the experimental group of Large White pigs; the abscissa is the phenotypic value of the experimental group;
[0023] Figure 2 The attached figure is a Manhattan plot of the genome-wide association analysis of the feed conversion rate trait; the present invention selects the SNP located at the chr8:129423208 site with a smaller P value on the threshold line for subsequent further analysis;
[0024] Figure 3 The attached figure is a QQ plot of the genome-wide association analysis of feed conversion rate traits;
[0025] Figure 4 The attached figure shows the genotyping of the SNP sites screened by the present invention for 5256 Large White pigs; the ordinate in the figure is the phenotypic value of FCR, and the abscissa is the genotypes of the three groups, TT, TG and GG. DETAILED DESCRIPTION
[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0027] Example 1 Genotyping and genome-wide association analysis of feed conversion efficiency traits
[0028] (1) Ear samples from 5256 Large White pigs were collected, DNA was extracted from the samples and genotyped using the Porcine 80K SNP high-density functional locus array, resulting in a total of 187,255 SNP loci.
[0029] (2) Plink v1.90 software was used to perform quality control on the genotype data. The quality control criteria were as follows: SNP call rate>90%, minimum allele frequency (MAF)>0.01, mind<0.1, geno<0.1, and then the missing genotypes were filled according to the Beagle default parameters. The genotype files after filling were quality controlled again, with the standard of MAF>0.01.
[0030] (3) After quality control, 5256 individuals and 97476 SNP loci were retained for subsequent GWAS studies of feed conversion efficiency traits.
[0031] (4) The feed conversion rate data of 5256 large white pigs were recorded using the Aoshiben production performance measurement system during the trial period. The distribution of the data is as follows: Figure 1 shown.
[0032] (5) The association analysis between genotype and phenotype was performed using the GWAS method based on the MLM model. The specific model was: y = Xβ + Vα + Zμ + e, adding field and sex as fixed effects, and the first three PCs as covariates, where y is the phenotypic value, β is the fixed effect, α is the SNP vector, μ is the random effect, X, V, Z are the association matrices, and e is the residual vector.
[0033] (6) The present invention uses the Bonferroni method for correction to improve the reliability of the experimental results. The genome significance level threshold is set to 0.05 / N (N is the number of markers). According to the results of GWAS, the P value of each SNP site is converted to -log 10 (P), the significant threshold line is set to -log 10 (0.05 / N), and the -log 10 When the (P) value is greater than or equal to 6.29, it indicates that there is a significant association between the SNP and the trait. Then, the Manhattan plot and QQ plot of the feed conversion rate trait are drawn using R packages such as qqman and CMplot in the R language ( Figure 2 , Figure 3 ).
[0034] (7) The present invention further screened out a SNP with accession number rs325088362 located at the 129423208 nucleotide position on chromosome 8 from among the SNP positions on the significance threshold line. The differences in population phenotypic values between different genotypes at this position and the distribution of the number of individuals with corresponding phenotypic values are shown in FIG. Figure 4 For the SNP sites finally screened, the lines with genotype T / T should be selected for breeding.
[0035] Example 2 Amplification of target DNA sequence and application of SNP sites
[0036] (1) Primer design
[0037] For SEQ ID NO.1, the following primers were designed:
[0038] Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO.2;
[0039] Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.3.
[0040] (2) PCR amplification:
[0041] PCR reaction system: Add 5μl Taq Mix, 0.3μl forward primer and 0.3μl reverse primer, 1μl DNA template, 3.4μl ddH2O to 10μl reaction system. PCR reaction conditions are: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; finally 72℃ extension for 5min.
[0042] (3) DNA sequence determination:
[0043] Finally, the products amplified by PCR are sequenced, and the gene fragment sequencing is required to be bidirectional.
[0044] The sequencing result is shown in SEQ ID NO.4:
[0045] ATCGAAGGAGCCAGGAAATAGACTTATACAAGGATTGTACCTCTAGTACCTAGATCTCATCAGAGGAAGGAAGGGGAGCAGATTTAGAGGAAAAGAKCATACTTCCTTTTGTGTCCCCAGCTTCTATTATGTAGCCATCTATCCTCCAGCACTCAACACACGCATGTTCTATTCTGACAGAGCCAACAA AATGATCCCTTTATAAATAAGAACAAATCATTCCAGGATTCTGCTCCAAATCTGGTCTTCCCATAGCTCAAAGTCAAACTCATTGCAGCAGC; SEQ ID NO.4.
[0046] Note: K in the sequence table is the mutation site T / G, and the primer sequences are shown in bold at the beginning and end of the sequence.
[0047] (4) The present invention provides a method for improving the feed conversion rate trait of pigs, comprising the following steps: detecting the SNP site at the 129423208 nucleotide on chromosome 8 of pigs, and selecting a strain with a genotype of T / T at the site for breeding, thereby reducing the feed consumption of large white pigs during the production process to improve feed utilization.
[0048] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A SNP molecular marker associated with pig feed conversion efficiency, characterized in that: The SNP molecular marker is located at chr8:129423208 of the genome version Ensembl Sscrofa 11.1, and its polymorphic site is T or G.
2. A SNP molecular marker related to pig feed conversion efficiency according to claim 1, characterized in that: The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at the 97th position of the nucleotide sequence shown in SEQ ID NO.
1.
3. A primer for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The primer sequences are as follows: Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO.2; Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.
3.
4. Use of the SNP molecular marker according to any one of claims 1 to 2 or the primer according to claim 3 in detecting the feed conversion rate trait of pigs.
5. The use according to claim 4, characterized in that: The strain with the genotype of T / T at the chr8:129423208 locus was selected for breeding. The strain with the genotype of T / T had high feed utilization rate.
6. The use according to claim 4, characterized in that: The breed of the pig is Large White pig.
7. Use of the SNP molecular marker according to any one of claims 1 to 2 or the primer according to claim 3 in pig genetic breeding.
8. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the primer described in claim 3.
9. A method for improving pig breeds, characterized in that: The following steps are involved: Detect the SNP molecular marker as described in any one of claims 1-2 on pig chromosome 8, and select the strain with genotype T / T for breeding.