SnRNA of target USH2A gene pre-mRNA and application of snRNA of target USH2A gene pre-mRNA

Abstract

The invention relates to snRNA of a target USH2A gene pre-mRNA and application of the snRNA, and belongs to the technical field of gene engineering. An identification structural domain of the snRNA is reversely complementary with a pre-mRNA sequence of the USH2A gene, and the snRNA is combined with the pre-mRNA of the USH2A gene so as to induce exon splicing jumping, so that eye and ear diseases of USH2A protein dysfunction caused by missense, frame shift, password termination, nonsense, synonymous mutation and the like of USH2A exons 17, 24, 45 and 50 are treated.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering, and in particular to a snRNA targeting USH2A gene pre-mRNA and an application thereof. Background Art

[0002] Usher syndrome is a hereditary disease, also known as deafness-retinitis pigmentosa syndrome, which is characterized by varying degrees of congenital sensorineural deafness and progressive visual loss caused by retinitis pigmentosa (RP).

[0003] Clinically, Usher syndrome can be divided into three types: 1. Type I Usher syndrome, in which patients will have congenital severe profound sensorineural hearing loss, vestibular response loss, and vision will develop pigmentary retinitis before puberty, which will gradually lead to blindness. The genes associated with this type include MYO7A, CDH23, USH1C, PCHD15, etc.; 2. Type II Usher syndrome, in which patients will have congenital moderate to severe sensorineural hearing loss, normal vestibular response, and vision will develop pigmentary retinitis during puberty, which will gradually lead to blindness. The genes associated with this type include USH2A, GPR98, WHRN, etc.; 3. Type III Usher syndrome, in which patients will have progressive sensorineural hearing loss, normal vestibular response, and vision will develop pigmentary retinitis at the end of puberty, which will gradually lead to blindness. The genes associated with this type include CLRN1, etc.

[0004] Among the three types of Usher syndrome mentioned above, type II Usher syndrome accounts for more than 50% of Usher syndrome, and USH2A gene mutation is the most common cause of type II Usher syndrome, covering more than 50% of Usher syndrome patients. At the same time, mutation of the USH2A gene is also one of the important causes of non-syndromic retinitis pigmentosa (NSRP).

[0005] USH2A is located on 1q41 (chromosome 1, long arm, region 4, band 1), spanning more than 800 kb in the genome. It encodes a large transmembrane protein, Usherin, which is anchored on the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is an essential component for the development and maintenance of cilia. In the retina, Usherin is an important part of the USH2 complex and is believed to play a role in stabilizing the outer segments of photoreceptors. USH2A has two subtypes. The main subtype in retinal cells contains 72 Exons and the coding region is about 15.6 kb long. The extracellular part of the Usherin protein contains many repeated domains, including 10 Laminin EGF-like (LE) domains and 35 Fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp long and encodes amino acids 723 to 936, which are 4 of the 10 LE domains in the Usherin protein.

[0006] To date, more than 1,000 pathogenic mutations distributed throughout the USH2A gene have been identified. Mutations in exons 17, 24, 45, and 50 of the USH2A gene can cause Usher syndrome, and these four exons are located in the repeated Laminin EGF-like (LE) domain or Fibronectin type 3 (FN3) domain, with lengths of 495 bp, 102 bp, 210 bp, and 219 bp, respectively, so splicing skipping of the exons will not cause a reading frame shift. To date, pathogenic mutations in exon 17 of the USH2A gene include c.3332T>G, c.3368A>G, c.3403_3404del, c.3407G>A, c.3420_3423del, c.3464_3468del, c.3507G>C, c.3518C>A, c.3544T>C, c.3558del, c.3629T>C, c.3635C>T, c.3680del, c.3680dup, c.3684T>A, c.3713C>G, c.3722_3729delinsTCA. , c.3737dup, c.3754C>T, c.3788G>A; pathogenic mutations in exon 24 of USH2A gene, including c.4894del, c.4933G>T, c.4948G>A, c.4957C>T; pathogenic mutations in exon 45 of USH2A gene, including c.8890dup, c.8906C>G, c.8917_8918del, c.8917_8918delCT, c.8954del, c.8972_8973del, c.8981G>A, c.9002A>G, c.9014G>C. So far, the pathogenic mutations in exon 50 of the USH2A gene include c.9751T>C, c.9753T>A, c.9770dup, c.9788_9808del, c.9791del, c.9799T>C, c.9801C>G, c.9804T>A, c.9811del, c.9815C>T, c.9844T>C, c.9860_9875del, c.9866G>T, c.9874C>T, c.9882C>G, c.9883T>C, c.9912dup, c.9915G>C, c.9924_9927dup, and c.9958G>T. However, there is no relevant gene therapy for retinal diseases caused by the above gene mutations. Summary of the invention

[0007] Based on this, it is necessary to provide a snRNA targeting the pre-mRNA of the USH2A gene to address the problem that there is no relevant gene therapy method for the retinal diseases caused by the USH2A gene mutation. The snRNA can promote the skipping of exons 17, 24, 45, and 50 and has a high skipping efficiency, so that gene therapy can be performed for retinal diseases caused by the USH2A gene by skipping exons 17, 24, 45, and 50 of the USH2A gene.

[0008] The invention discloses a snRNA targeting USH2A gene pre-mRNA, wherein a recognition domain of the snRNA is reversely complementary to a USH2A gene pre-mRNA sequence, and the snRNA binds to the USH2A gene pre-mRNA to induce splicing skipping of exon 17, exon 24, exon 45 or exon 50.

[0009] After investigating and studying USH2A, the inventors found that because the length of the USH2A coding region is about 15.6 kb, conventional gene therapy delivery methods (such as recombinant lentivirus, recombinant adeno-associated virus, etc.) are difficult to package such a large coding sequence, so it is difficult to treat by directly delivering USH2A. Therefore, it is considered that splicing jumps can be induced to achieve treatment by targeting exons with pathogenic mutations.

[0010] In some of the embodiments, the USH2A gene pre-mRNA sequence is selected from the following regions: USH2A exon 17, exon 24, exon 45, exon 50 and intron sequences on both sides of each exon.

[0011] The study found that the lengths of human USH2A exons 17, 24, 45, and 50 are 495bp, 102bp, 210bp, and 219bp, respectively, and the removal of the exons did not cause subsequent frameshift mutations. At the same time, the inventors found that after knocking out exons 17, 24, 45, and 50 of USH2A, respectively, the truncated Usherin can still be correctly positioned and perform some functions. Therefore, for human USH2A exons 17, 24, 45, and 50 containing pathogenic mutations, a series of means can be used to cause them to skip reading for treatment.

[0012] In some of the embodiments, the genomic localization region corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216199619-216200129, Chr1: 216086701-216086835, Chr1: 215845811-215846043, Chr1: 215798892-215799134.

[0013] In some of the embodiments, the USH2A gene pre-mRNA sequence is selected from the sequence shown in SEQ ID NO.1-SEQ ID NO.4.

[0014] In some embodiments, the genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216200104-216200133, Chr1: 216199615-216199644, Chr1: 216086701-216086745, Chr1: 216086765-216086794, Chr1: 216086809-216086838, Chr1: 215845834-215845884, Chr1: 215846018-215846047, Ch r1: 215845962-215845991, Chr1: 215798940-215798969, Chr1: 215798889-215798918. .

[0015] In some of the embodiments, the USH2A gene pre-mRNA sequence is selected from the sequence shown in SEQ ID NO.5-SEQ ID NO.14.

[0016] In some of the embodiments, the recognition domain of the snRNA is reverse complementary to a continuous sequence of at least 16 bp in the pre-mRNA sequence of the USH2A gene.

[0017] In some of the embodiments, the recognition domain of the snRNA is selected from the sequences shown in SEQ ID NO.15-SEQ ID NO.26, SEQ ID NO.30-SEQ ID NO.69.

[0018] In some embodiments, the genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216199619-216199641, Chr1: 216200107-216200129, Chr1: 216086701-216086723, Chr1: 216086723-216086745, Chr1: 216086769-216086791, Chr1: 216086813-216086835, Chr1: 215845834-215845856, Chr1: 215845862-215845884, Chr1: 215846021- 215846043, Chr1: 215845965-215845987, Chr1: 215798892-215798914, Chr1: 215798944-215798966.

[0019] In some of these embodiments, the recognition domain of the snRNA is selected from the sequence shown in SEQ ID NO.15-SEQ ID NO.26.

[0020] In some of the embodiments, the genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from the group consisting of: Chr1: 216199619-216199641, Chr1: 216086701-216086723, Chr1: 216086723-216086745, Chr1: 216086769-216086791, Chr1: 216086813-216086835, Chr1: 215845834-215845856, Chr1: 215845862-215845884, Chr1: 215798892-215798914, Chr1: 215798944-215798966.

[0021] In some of these embodiments, the recognition domain of the snRNA is selected from the sequence shown in: SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.25, and SEQ ID NO.26.

[0022] In some embodiments, the snRNA comprises at least two snRNAs.

[0023] In some of these embodiments, the recognition domains of at least two of the snRNAs target different pre-mRNA sequence regions of the USH2A gene.

[0024] In some embodiments, the recognition domains of at least two of the snRNAs have no overlapping sequences.

[0025] In some of the embodiments, the recognition domains of at least two of the snRNAs target different exons and their corresponding intron sequences in the pre-mRNA sequence of the USH2A gene.

[0026] In some embodiments, the snRNA is U1-snRNA or U7-snRNA.

[0027] Considering that there are small nuclear RNA (snRNA) in cells, it is the main component of RNA spliceosome in the post-transcriptional processing of eukaryotic organisms, and participates in the processing of mRNA precursors by binding to snRNP proteins. Its length is about 100-215 nucleotides in mammals, and it is divided into 7 categories. Because it contains a lot of U, it is numbered U1-U7. However, U7-snRNP does not participate in splicing, but is a key factor in the unique 3' end processing of replication-dependent histone (RDH) pre-mRNA.

[0028] Therefore, the inventors replaced the non-canonical Sm binding site of U7-snRNA with a consensus sequence derived from the major spliceosomal U-snRNPs and changed the histone binding sequence in the 5' region of U7-snRNA to the complementary sequence of the gene to be modified, which can induce splicing skipping of exons by targeting exons.

[0029] In some embodiments, the snRNA comprises an sm sequence.

[0030] In some embodiments, the sm sequence is a smOPT sequence, and the smOPT sequence is shown in SEQ ID NO:27.

[0031] In some of these embodiments, the snRNA further comprises a motif for recruiting splicing regulatory proteins.

[0032] In some embodiments, the splicing regulatory protein includes at least one of hnRNPA1, SRSF1, RBM4, DAZAP1 or SR.

[0033] The invention also discloses a nucleic acid, which comprises a nucleotide sequence encoding the snRNA.

[0034] The invention also discloses a gene expression box, which comprises the nucleic acid.

[0035] The present invention also discloses a vector, which comprises the snRNA, the nucleic acid, and / or the gene expression box.

[0036] The present invention also discloses a virus particle, which comprises the snRNA, the nucleic acid, and / or the vector.

[0037] The present invention also discloses a cell, which comprises the snRNA, the nucleic acid, the vector, and / or the virus particle.

[0038] The present invention also discloses a pharmaceutical composition, which comprises the snRNA, the nucleic acid, the vector, and / or the virus particle.

[0039] The present invention also discloses a method for obtaining Usherin protein with exon 17, exon 24, exon 45, or exon 50 deleted, which method comprises contacting the pre-mRNA of USH2A gene with the above-mentioned snRNA, the above-mentioned nucleic acid, the above-mentioned vector, the above-mentioned gene expression cassette, the above-mentioned virus particle, the above-mentioned cell, and / or the above-mentioned composition.

[0040] The present invention also discloses the use of the snRNA, the nucleic acid, the gene expression cassette, the vector, the virus particle, the cell, the pharmaceutical composition or the method in preparing drugs for preventing eye diseases and / or ear diseases, or preparing drugs for treating eye diseases and / or ear diseases.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] The snRNA targeting the pre-mRNA of the USH2A gene of the present invention selects USH2A exons 17, 24, 45, and 50 as the targeting regions, and induces splicing skipping of exons 17, 24, 45, and 50, thereby treating eye and ear diseases caused by abnormal USH2A protein function due to missense, frameshift, stop codon, nonsense, and synonymous mutations of USH2A exons 17, 24, 45, and 50.

[0043] In addition, the snRNA targeting the pre-mRNA of the USH2A gene of the present invention utilizes the characteristic that U7-snRNP does not participate in splicing but is a key factor in the unique 3' end processing of replication-dependent histone (RDH) pre-mRNA, and the modified U7-snRNA replaces the non-canonical Sm binding site of U7-snRNA with a common sequence derived from the main spliceosome U-snRNPs, and changes the histone binding sequence in the 5' region of U7-snRNA into a complementary sequence of the gene to be modified. The unique working mechanism, combined with the snRNA targeting the pre-mRNA of the USH2A gene, achieves the induction of efficient splicing skipping of exons 17, 24, 45, and 50 of the pre-mRNA of the USH2A gene.

[0044] At the same time, the present invention also compares gene editing induced by snRNA-induced splicing skipping and conventional AON technology, and finds that the target site sensitivity of the two is not the same, indicating that although both technologies may have the function of inducing exon splicing skipping, their mechanisms of action are different and the sensitivity of their target sites is also different. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the structure and function of U7-snRNA;

[0046] Figure 2 This is the map of the pUC57-U7 snRNA backbone vector;

[0047] Figure 3 Schematic diagram of the donor vector PUC57-EF1α constructed for Usherin high-expressing 293T cells;

[0048] Figure 4 This is the gel image of Clone#2, Clone#3, and Clone#8 being identified as heterozygous knock-in genes through genomic PCT;

[0049] Figure 5 This is the RT-PCR electrophoresis gel image of a representative experimental group of U7 snRNA-induced USH2A exon 17 splicing skipping;

[0050] Figure 6 This is the RT-PCR electrophoresis gel image of U7 snRNA24-1, 24-2 inducing USH2A exon 24 splicing skipping;

[0051] Figure 7 This is the RT-PCR electrophoresis gel image of a representative experimental group of U7 snRNA-induced USH2A exon 45 splicing skipping;

[0052] Figure 8This is the RT-PCR electrophoresis gel image of a representative experimental group of U7 snRNA-induced USH2A exon 50 splicing skipping;

[0053] Fig. 9 This is the plasmid map of the reporter vector pCMV-EGFPleft-Exon13c.2802T>G-EGFPright;

[0054] Fig.10 The results are as follows: the percentage of cells in which U7-snRNA targeting target region 1 induces USH2A pre-mRNA exon 13 splicing skipping in reporter vector cells;

[0055] Fig.11 The results are as follows: the percentage of cells in which U7-snRNA targeting target region 2 induces USH2A pre-mRNA exon 13 splicing skipping in reporter vector cells;

[0056] Fig.12 The results are as follows: the percentage of cells in which U7-snRNA targeting target region 3 induces USH2A pre-mRNA exon 13 splicing skipping in reporter vector cells;

[0057] Fig.13 Schematic diagram of the structure of tandem U7 snRNA.

[0058] Fig.14 This is the RT-PCR electrophoresis gel image of chemically synthesized U7 snRNA inducing corresponding exon skipping in Weri-Rb-1.

[0059] Fig.15 RT-PCR electrophoresis gel image showing snRNA combination-induced USH2A exon splicing skipping.

[0060] Fig.16 RT-PCR electrophoresis gel image of snRNAs with different targets in series inducing USH2A exon splicing skipping.

[0061] Fig.17 RT-PCR electrophoresis gel image of AON and snRNA tandem with different target sites inducing USH2A exon splicing skipping. DETAILED DESCRIPTION

[0062] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0064] It should be noted that when a sequence is referred to as being "selected from" another sequence, it may be directly another sequence or a sequence fragment of another sequence; when a genomic localization region is "selected from" another genomic localization region, its corresponding sequence may be directly the corresponding sequence of another genomic localization region or a sequence fragment of the corresponding sequence of another genomic localization region; the sequence includes DNA or RNA.

[0065] definition:

[0066] The snRNA described in the present invention is the main component of RNA spliceosome in the post-transcriptional processing of eukaryotic organisms, and participates in the processing of mRNA precursors by binding to snRNP proteins.

[0067] Sources:

[0068] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; the experimental methods are all conventional experimental methods in the art unless otherwise specified.

[0069] Example 1

[0070] Design of U7-snRNA system and vector construction.

[0071] 1. Synthesize the U7-snRNA expression vector backbone.

[0072] The wild-type U7-snRNA includes a stem-loop structure (scafford), a U7-specific Sm sequence (AAUUUGUCUAG), and a recognition domain (complementary to histone pre-mRNA).

[0073] The U7-snRNA of this embodiment is based on the gene sequence of mouse wild-type U7-snRNA on NCBI (NCBI Reference Sequence: NR_024201.3), and the U7-specific sm sequence AATTTGTCTAG (SEQ ID NO: 28) is replaced with an optimized common sm sequence, i.e., smOPT: AATTTTTTGGAG (SEQ ID NO: 27), and the original recognition domain at the 5' end of the smOPT sequence is replaced with a recognition domain that is reverse complementary to the specific target site of the USH2A gene pre-mRNA, and the 3' end of the smOPT sequence retains the original U7 stem-loop structure sequence, such as Figure 1 shown.

[0074] The U7-snRNA recognition domain sequence that targets and induces USH2A pre-mRNA exons is reversely complementary paired with a target sequence selected from USH2A pre-mRNA exon 17, exon 24, exon 45, exon 50 and intron sequences on both sides thereof.

[0075] The specific operation process is as follows:

[0076] First, a pUC57 vector (e.g., Figure 2 As shown). Two Type IIs restriction endonuclease recognition sites are added between the U7 promoter and smOPT to facilitate subsequent excision, replacement and insertion of other recognition domain sequences. The snRNA gene-specific 3' box is a sequence containing gtctacaatgaaa (SEQ ID NO: 29) after the 3' end of the U7-snRNA gene in the mouse genome (GenBank: X54748.1), which participates in the processing of pre-snRNA, preferably a sequence connected to the 3' end of the U7 snRNA gene, preferably a gene fragment with a sequence length of 28-131 bp, and further preferably a sequence length of 106 bp.

[0077] 2. Construct a U7-snRNA vector targeting USH2A.

[0078] In this example, 24 target sites are set for USH2A pre-mRNA exon 17, exon 24, exon 45, exon 50 and intron sequences on both sides thereof as shown in the following table.

[0079] Table 1 snRNA recognition domain sequences

[0080]

[0081]

[0082]

[0083]

[0084] Note: The snRNA numbering rule is exon number + snRNA number, such as 17-1 means snRNA No. 1 targeting exon No. 17.

[0085] Example 2

[0086] Chemical synthesis and modification of U7-snRNA.

[0087] Similar to oligonucleotides, U7-snRNA can also be produced by direct chemical synthesis to produce RNA containing a guide sequence, smOPT, and U7-snRNA scafford. U7-snRNA synthesized in vitro can be specifically modified to make it resistant to nuclease degradation or to increase its affinity for the target sequence.

[0088] In this example, U7-snRNA was chemically synthesized, and the three bases at the 5' and 3' ends were each modified with 2'-methoxy (2'-OME) and thiophosphorylation to increase nuclease resistance. Taking snRNA#16 and snRNA#15 as examples, the chemically synthesized snRNA sequences and modifications are as follows (* indicates thiophosphorylation backbone, m indicates 2'-methoxy modification, underline indicates recognition domain that is reverse complementary to the target sequence, and italics indicates smOPT sequence):

[0089] Chemically synthesized and modified U7-snRNA:

[0090] 5'- mX*mX*mX*XXXXXXXXXXXXXXXXXX AAUUUUUGGAGCAGGUUUUCUGACUUCGGUCGGAAAACCmC*mC*mU*-3'.

[0091] Example 3

[0092] Construction of an usherin-overexpressing 293T cell line for evaluating the efficiency of USH2A exon splicing skipping.

[0093] The strong promoter EF1α was knocked into the USH2A gene promoter region of 293T cells near the transcription start site (TSS) by CRISPR / Cas9 technology, thereby promoting the high expression of USH2A gene in 293T cells, so as to evaluate the effect of the technical scheme of the present invention on inducing splicing skipping of exon 17, exon 24, exon 45 and exon 50 of USH2A pre-mRNA.

[0094] In order to knock in a strong promoter in the promoter region of the USH2A gene in 293T cells, a gRNA was designed for this target site: UCAGAGCGUGGUCUGCUUGG GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAA GGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUUU (SEQ ID NO: 70) (wherein the underlined sequence is the guide sequence), the donor vector PUC57-EF1α includes the left homology arm, the BSD blasticidin resistance expression cassette Loxp-SV40Promoter-Bsd-Loxp, the EF1α promoter, and the right homology arm in order from the 5' end to the 3' end, and the vector structure is as follows Figure 3 shown.

[0095] The gRNA and spCas9 vector pX459-V2 expressing USH2A were co-transfected with the donor vector PUC57-EF1α into 293T cells. After 24 hours, 40μg / ml of Blasticidin and 1.5μg / ml of Puromycin were added. After 48 hours of drug screening, the cells were digested into single clones, diluted to 10 cells / ml, and inoculated into 96-well plates at 100μl per well. When the single clones in the 96-well plate proliferated to dozens of cells, 40μg / ml of Blasticidin was added. Continue to culture, and gradually subculture and expand the cells that survived after BSD drug screening, while continuing to maintain BSD screening. After the BSD screening is stable, pick the single cell clone and culture it in a 96-well plate. After further amplification, transfer it to a 24-well plate for amplification.

[0096] Table 1. Primers used in PCR experiments

[0097] USH2A-TSS-JD-F CCTAGGAGGCACAAGCATGAG(SEQ ID NO.71) SV40-Promoter-R CTCACTACTTCTGGAATAGCTCAG(SEQ ID NO.72) EF1A-F2 TCATTCTCAAGCCTCAGACAGTG(SEQ ID NO.73) USH2A-TSS-JD-R CAATGGCGAAGACATGAGTAGC(SEQ ID NO.74)

[0098] The genomic DNA of the monoclonal amplified cells was extracted, and the genotype of the clones (KI / KI homozygotes, KI / WT heterozygotes, WT / WT random integration) was identified by PCR. The identification results showed that Clone#2, Clone#3, and clone#8 could amplify the wild-type band (USH2A-TSS-JD-F / USH2A-TSS-JD-R), which was a heterozygote. Figure 4As shown. For clones successfully identified by PCR, several different heterozygous and wild-type clones were further selected to compare their USH2A expression (as shown in Table 2). The highly expressed clone cell clone#8 was selected for amplification and frozen for backup.

[0099] Table 2. USH2A mRNA expression in different cloned cells detected by qRT-PCR (ΔCT = USH2ACTmean-GAPDHCTmean, the smaller the value, the higher the expression of USH2A)

[0100]

[0101] Example 4

[0102] The effect of U7-snRNA-mediated splicing skipping of exon 17.

[0103] Usherin high-expressing 293T cells were inoculated into 24-well plates, so that the cell confluence reached about 80% after 24 hours. Lipofectamine 2000 was used to transfect 293T cells with pUC57-U7-snRNA plasmid targeting exon 17 of USH2A pre-mRNA (the vector mass ratio was 100ng:400ng), and 293T cells with pUC57-U7-Scramble were used as negative controls, and 293T cells without any plasmid transfection were used as blank controls. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR was performed to amplify exon 17 using primers (Exon17-RTPCR-F: ccattgctgggcaacgttgtg (SEQ ID NO.75); Exon17-RTPCR-R: gatcatgaatacaggtgctgattc (SEQ ID NO.76)).

[0104] The results of RT-PCR electrophoresis showed that U7-snRNA#17-1 to #17-6 could induce splicing skipping of exon 17, and U7-snRNA#17-1 and #17-4 had more significant splicing induction efficiency, such as Figure 5 As shown, U7-snRNA#17-1 induced almost all exon 17 splicing skipping.

[0105] Example 5

[0106] The effect of U7-snRNA-mediated splicing skipping of exon 24.

[0107] Usherin high-expressing 293T cells were inoculated into 24-well plates so that the cell confluence reached about 80% after 24 hours. Lipofectamine 2000 was used to transfect 293T cells with pUC57-U7-snRNA plasmid targeting exon 24 of USH2A pre-mRNA (the vector mass ratio was 100ng:400ng), and 293T cells with pUC57-U7-Scramble were used as negative controls, and 293T cells without any plasmid transfection were used as blank controls. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR was performed to amplify exon 24 using primers (Exon24-RTPCR-F: caatacagacttcactggcattaag (SEQ ID NO.77); Exon24-RTPCR-R: gaagttccaggaaccctgctc (SEQ ID NO.78)).

[0108] RT-PCR electrophoresis results showed that U7-snRNA#24-1 to #24-6 could induce splicing skipping of exon 24, and U7-snRNA#24-1, #24-2, #24-4 and #24-6 had more significant splicing induction efficiency, among which U7-snRNA#24-1 and #24-2 had better splicing skipping effects, and U7-snRNA#24-1 was better than U7-snRNA#24-2 (e.g. Figure 6 shown).

[0109] Example 6

[0110] The effect of U7-snRNA-mediated splicing skipping of exon 45.

[0111] Usherin high-expressing 293T cells were inoculated into 24-well plates, so that the cell confluence reached about 80% after 24 hours. Lipofectamine 2000 was used to transfect 293T cells with pUC57-U7-snRNA plasmid targeting exon 45 of USH2A pre-mRNA (the vector mass ratio was 100ng:400ng), and 293T cells with pUC57-U7-Scramble were used as negative controls, and 293T cells without any plasmid transfection were used as blank controls. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR was performed to amplify exon 45 using primers (Exon45-RTPCR-F: ccagaagatttaaatcggtggcac (SEQ ID NO.79); Exon45-RTPCR-R: gcatatattgtgcagacttcaacc (SEQ ID NO.80)).

[0112] The results of RT-PCR electrophoresis showed that U7-snRNA#45-1 to #45-6 could induce splicing skipping of exon 45, while U7-snRNA#45-2, #45-3, #45-4 and #45-6 had more significant splicing induction efficiency, among which U7-snRNA#45-2 and #45-3 induced most of the splicing skipping of exon 45, as shown in Figure 7 shown.

[0113] Example 7

[0114] The effect of U7-snRNA-mediated splicing skipping of exon 50.

[0115] Usherin high-expressing 293T cells were inoculated into 24-well plates in a certain amount so that the cell confluence reached about 80% after 24 hours. Lipofectamine 2000 was used to transfect 293T cells with pUC57-U7-snRNA plasmid targeting exon 50 of USH2A pre-mRNA (the vector mass ratio was 100ng:400ng), 293T cells with pUC57-U7-Scramble were used as negative controls, and 293T cells without any plasmid transfection were used as blank controls. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR was performed to amplify exon 50 using primers (Exon50-RTPCR-F: gaatctatctgtggacacatttgc (SEQ ID NO.81); Exon50-RTPCR-R: ctgcactctttggtttccttcatc (SEQ ID NO.82)).

[0116] RT-PCR electrophoresis results showed that U7-snRNA #50-1 to #50-6 could induce splicing skipping of exon 50, while U7-snRNA #50-1, #50-2, #50-3, #50-4 and #50-5 had more significant splicing induction efficiency, and U7-snRNA #50-1 and #50-3 could induce splicing skipping of most exon 50, e.g. Figure 8 shown.

[0117] Example 8

[0118] A reporter vector was constructed for quantitative evaluation of USH2A exon 13 splicing skipping efficiency.

[0119] RG left -USH2AEXON13 mut -RG rightThe sequence (with AgeI and EcoRI restriction sites added to the 5' and 3' ends, respectively) was obtained by total gene synthesis. The synthetic sequence and pX601 plasmid (Addgene, 61591) were digested with restriction endonucleases AgeI and EcoRI, electrophoresed, gel-cut and ligated. The synthesized sequence was inserted between the AgeI and EcoRI restriction sites of the pX601 vector to replace the SaCas9 gene sequence of the original vector and obtain the reporter vector. The purified reporter vector plasmid was obtained by further transformation of E. coli competent cells, single clone selection, PCR and sequencing verification, and stored at -20°C for future use.

[0120] The reporter vector structure is: pCMV-RG left -USH2A EXON13 mut -RG right RG represents a reporter gene, RGleft represents the first half of the 5' end of the reporter gene without a reporter function, and RGright represents the second half of the 3' end of the reporter gene without a reporter function. The tandem expression of RGleft and RGright can normally perform the complete reporter gene function. In the embodiment, the reporter gene is the green fluorescent gene EGFP, and the vector structure is pCMV-EGFP left -Exon13 mut -EGFP right (Reporter vector map such as Fig. 9 EXON13 mut It represents USH2A exon 13 containing the pathogenic mutation, and its upstream and downstream intron sequences (the upstream intron sequence is a gene sequence of 204bp at the 5' end and 490bp at the 3' end of intron 12 of the human USH2A gene; the downstream intron sequence is a gene sequence of 703bp at the 5' end and 216bp at the 3' end of intron 13 of the human USH2A gene).

[0121] Example 9

[0122] The effect of U7-snRNA mediated USH2A exon 13 splicing skipping was detected by targeting the target region of USH2A Pre-mRNA exon 13.

[0123] In the previous study, the inventors conducted a splicing skipping experiment on exon 13 (see CN202210003448.3). This example compares the differences in editing efficiency between AON technology and U7-snRNA technology.

[0124] 1. Detection method: 293T cells were inoculated into 24-well plates, and the cell confluence reached about 80% after 24 hours. Lipofectamine 2000 was used to infect pCMV-EGFP left-Exon13 c.2802T>G -EGFP right 293T cells were co-transfected with pUC57-U7-snRNA plasmid targeting USH2A pre-mRNA (the vector mass ratio was 100ng:400ng), and 293T cells transfected with reporter plasmid alone, co-transfected with reporter plasmid and pUC57-U7-Scramble were used as two negative controls, respectively, and 293T cells without any plasmid were used as blank controls. The transfected cells were cultured for 48-72 hours, digested into single cells with trypsin, and then flow cytometry was used to detect the GFP positive rate of different U7-snRNA groups (i.e., the proportion of cells in which USH2A pre-mRNA exon 13 was induced to splice jump) and the average FITC intensity of GFP-positive cells (i.e., the average level of USH2A pre-mRNA exon 13 splicing jump in GFP cells).

[0125] 2. Results of targeting target area 1:

[0126] The recognition domain sequence of the snRNA targeting target region 1 is shown in the following table.

[0127] Table 2 snRNA recognition domain sequences

[0128]

[0129] The experimental results are as follows Fig.10 As shown, all U7-snRNAs targeting USH2A Pre-mRNA exon 13 can induce splicing skipping of USH2A exon 13 in reporter gene cells. In the previous experiments, AONs targeting region 1 could not induce splicing skipping of exon 13, but snRNAs targeting region 1 could efficiently induce splicing skipping of exon 13.

[0130] 3. Results of targeting target area 2:

[0131] The recognition domain sequence of the snRNA targeting target region 2 is shown in the following table.

[0132] Table 3 snRNA recognition domain sequences

[0133]

[0134] Experimental results: Fig.11 As shown, all U7-snRNAs targeting target region 2 can induce splicing skipping of USH2A exon 13 in reporter gene cells. The AONs targeting region 2 in the prior art are less effective in inducing splicing skipping of exon 13, but snRNAs targeting region 2 can efficiently induce splicing skipping of exon 13.

[0135] 4. Results of targeting target area 3:

[0136] The recognition domain sequence of the snRNA targeting target region 3 is shown in the following table.

[0137] Table 4 snRNA recognition domain sequence

[0138]

[0139] Experimental results: Fig.12 As shown, all U7-snRNAs targeting target region 3 can induce splicing skipping of USH2A exon 13 in reporter gene cells. The AONs targeting region 3 in the prior art are less effective in inducing splicing skipping of exon 13, but snRNAs targeting region 3 can efficiently induce splicing skipping of exon 13.

[0140] Analysis of the above results shows that although the prior art shows that target regions 1, 2, and 3 are AON-targeted non-sensitive regions, that is, targeting this region is unable / low-efficiency to induce splicing skipping of exon 13, snRNA targeting this region can significantly induce splicing skipping of exon 13. Therefore, although both snRNA and AON can induce splicing skipping, their mechanisms of action are different, and the sensitivity of the target sites (the applicable target regions and target sites) is also different.

[0141] Example 10

[0142] Chemically synthesized U7-snRNA (the backbone sequence and modifications used were the same as those in “Chemically synthesized and modified U7-snRNA” in Example 2) induced USH2A exon splicing skipping in WERI cells.

[0143] Human host cells were cultured at 6×10 5 / well inoculated into a 24-well plate, and the human retinal neural cells selected in this example are WERI-Rb-1 cells (retinal neural cell line). WERI cells were transfected with 100 pmol U7-snRNA synthesized in vitro using Lipofectamine 2000, and 1 μg EGFP plasmid was transfected as a negative control. WERI cells without any plasmid were used as blank controls. The transfected cells were cultured for 72 hours, and then RNA from each experimental group of cells was extracted, reverse transcribed to obtain cDNA, and RT-PCR experiments were performed to detect whether mature USH2A mRNA had exon splicing skipping.

[0144] The results showed that chemically synthesized and modified U7-snRNA could efficiently induce splicing skipping of USH2A exons 17, 24, 45, and 50 in WERI cells. Fig.14 shown.

[0145] Embodiment 11

[0146] The splicing skipping effects of USH2A exons 17, 23, 45, and 50 mediated by U7-snRNA combinations with different target sites.

[0147] Construct U7-snRNA multi-target combination vector. According to the Golden Gate Assembly technology, different U7snRNA plasmids were used as templates to PCR amplify U7 snRNA cassettes (expression cassettes). At the same time, additional 5' flanking bases and BsaI restriction sites in the correct direction were introduced at both ends of the amplicon through primers, so that the adjacent different U7 snRNA cassettes were digested by BsaI to produce specific complementary sticky ends, and the first and last U7 snRNA cassettes were digested by BsaI to produce the same sticky ends as the linearized backbone vector digested by HindIII+NotI. Finally, use Golden GateAssembly Kit( v2) (NEB#E1601) The above PCR product and the pUC57-U7snRNA Backbone recovered by HindIII+NotI digestion were assembled.

[0148] The assembly method is as follows: pUC57-U7 snRNABackbone-HindIII+NotI, 80ng; U7 snRNA#Acassette PCR product, 20ng; U7 snRNA#B cassette PCR product, 20ng; U7 snRNA#Ccassette PCR product, 20ng; T4 DNA Ligase Buffer (10X), 2μl; NEB Golden GateAssembly Mix, 1μl; reaction process: (37℃, 5min→16℃, 5min)×20→60℃, 5min.

[0149] The Golden Gate Assembly product was further transformed into E. coli competent cells, single clones were selected, PCR and sequencing were verified to obtain the U7 snRNA multi-target combination vector for inducing USH2A exon splicing skipping. The plasmid was purified and stored at -20°C for future use. The constructed vector was exemplarily named pUC57-U7 snRNA#A+U7 snRNA#B+U7snRNA#C.

[0150] Usherin high-expressing 293T cells were inoculated into 24-well plates in a certain amount so that the cell confluence reached about 80% after 24 hours. Lipofectamine2000 was used to transfect 293T cells with pUC57-U7-snRNA combination plasmids targeting USH2A pre-mRNA exons (the vector mass ratio was 100ng:400ng), and 293T cells transfected with single-target snRNA plasmids were used as the control group, 293T cells transfected with pUC57-U7-Scramble plasmids were used as negative controls, and 293T cells not transfected with any plasmids were used as blank controls. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR and qRT-PCR were used to detect the splicing skipping of USH2A exons induced by snRNA combination.

[0151] In this embodiment, by combining the U7-snRNA targeting different target sites, it is found that the efficiency of inducing splicing jumps of USH2A exons 17, 23, 45, and 50 in Usherin high-expressing 293T cells can be improved. The splicing jump efficiency induced by the combination of different targets in this embodiment can be higher than the effect of a single target. In the combined application of U7-snRNA at different target sites, U7-snRNA can not only be expressed by vector delivery, but also can be a combination of chemically synthesized and modified U7-snRNA molecules for administration.

[0152] RT-PCR electrophoresis results are as follows Fig.15 As shown, the splicing jump efficiency induced by the combination of snRNA#17-1 and snRNA#17-4 is better than that of single snRNA#17-1 and snRNA#17-4. The splicing jump efficiency induced by the combination of snRNA#21-1 and snRNA#21-4 is better than that of single snRNA#21-1 and snRNA#21-4. The splicing jump efficiency induced by the combination of snRNA#45-2 and snRNA#45-4 is better than that of single snRNA#45-2 and snRNA#45-4. The splicing jump efficiency induced by the combination of snRNA#50-3 and snRNA#50-4 is better than that of single snRNA#50-3 and snRNA#50-4.

[0153] The ratio of exon skipping transcripts to total USH2A transcripts was preliminarily evaluated by QPCR relative quantification, ΔCT = CT value of exon skipping - CT value of total USH2A, and then 2 -ΔCT That is, the estimated exon skipping efficiency. The results are shown in Table 5.

[0154] Table 5 Exon skipping efficiency calculated based on QPCR data

[0155]

[0156]

[0157] Example 12

[0158] Recognition domain-containing tandem U7 snRNA induces USH2A exon splicing skipping

[0159] 1. Preparation of U7 snRNA with tandem recognition domain

[0160] The U7 snRNA with tandem recognition domains means a U7 snRNA stem-loop structure and a smOPT sequence connected to two or more recognition domains, and its structure is 5′-recognition domain B-recognition domain A-smOPT sequence-stem-loop structure-3′, such as Fig.12 As shown. The recognition domains A and B of the tandem U7 snRNA recognize RNA sequences at different target sites.

[0161] According to the pre-transcription DNA sequence corresponding to the snRNA recognition domain sequence, the corresponding oligo DNA was synthesized. The sense strand of the oligo DNA was the DNA corresponding to the recognition domain sequence, and CCGCA was added to the 5′ end, while the antisense strand was the antisense complementary sequence of the recognition domain sequence, and AATT was added to the 5′ end and T was added to the 3′ end. The synthesized sense strand and antisense strand of the oligo DNA were mixed according to the annealing reaction system (total reaction volume 20 μl: Oligo-F (100 μM) 2 μl + Oligo-R (100 μM) 2 μl + 10×NEB Cutter smartbuffer 2 μl + deionized water 16 μl), incubated at 95°C for 5 minutes, and then placed on ice to cool and anneal to form double-stranded DNA with sticky ends. After diluting 100 times, 1 μl was taken and ligated with 10 ng of BsaI-digested and recovered linearized pUC57-U7 snRNA backbone plasmid by T4 ligase. The ligation product was further transformed into competent E. coli cells, single cloned, PCR and sequenced to obtain the U7 snRNA vector for inducing USH2A exon splicing skipping. The plasmid was purified and stored at -20°C for later use. The constructed vector was named pUC57-U7 snRNA#B-#A, where A and B represent the recognition domain numbers, corresponding to different recognition domain sequences. For example, pUC57-snRNA#17-1-#17-6 means that the two recognition domain sequences 17-1 and 17-6 are connected in series.

[0162] The recognition domain tandem U7 snRNA can also be chemically synthesized and modified. In some embodiments, the total length of the chemically synthesized snRNA sequence is preferably greater than or equal to 96 bp.

[0163] 2. Recognition domain tandem U7 snRNA induces USH2A exon splicing skipping in Usherin-overexpressing 293T cells

[0164] Usherin high-expressing 293T cells were inoculated into 24-well plates so that the cell confluence reached about 80% after 24 hours. Lipofectamine2000 was used to transfect 293T cells with pUC57-U7-recognition domain tandem snRNA plasmid targeting USH2A pre-mRNA exon (the vector mass ratio was 100ng:400ng), and 293T cells transfected with single recognition domain U7 snRNA plasmid were used as control group, 293T cells transfected with pUC57-U7-Scramble were used as negative control, and 293T cells not transfected with any plasmid were used as blank control. The transfected cells were cultured for 48-72 hours, and the cells were collected to extract RNA. RT-PCR and qRT-PCR were used to detect the splicing skipping of USH2A exons induced by snRNA combination.

[0165] In this example, by applying U7-snRNA targeting different target sites in series, it is found that the efficiency of inducing splicing skipping of USH2A exon can be significantly improved. The splicing skipping efficiency induced by the series of different target sites in this example is higher than the effect of a single target site.

[0166] RT-PCR electrophoresis results are as follows Fig.16 As shown, the splicing skipping efficiency induced by different targets in tandem is higher than that of the corresponding single targets.

[0167] The ratio of exon skipping transcripts to total USH2A transcripts was preliminarily evaluated by QPCR relative quantification, ΔCT = CT value of exon skipping - CT value of total USH2A, and then 2 -ΔCT That is, the estimated exon skipping efficiency. The results are shown in Table 6.

[0168] Table 6 Exon skipping efficiency calculated based on QPCR data (primers used are the same as in Example 11)

[0169]

[0170]

[0171] In addition, the present invention constructed AONs with different target sites in series and tried to induce splicing skipping of USH2A pre-mRNA exons, but found that there was almost no splicing skipping efficiency, which further verified that the mechanism of action of AON and snRNA inducing splicing skipping is different. Fig.17 shown.

[0172] Embodiment 13

[0173] The splicing skipping effect of U7-snRNA linked to the hnRNP A1 binding motif was examined.

[0174] 1. Construction of U7-snRNA linked to the hnRNP A1 binding motif.

[0175] According to the pre-transcription DNA sequence corresponding to the gRNA sequence in the table, the corresponding oligo DNA is synthesized. The positive strand of the oligo DNA is the reverse complementary sequence of the target sequence (the DNA sequence corresponding to the recognition domain sequence), and the 5' The antisense strand is the target sequence 5' plus AATT and 3' plus For example, the recognition domain sequence of snRNA#14 is ACACUGGCAGGGCUCACAUCCA (SEQ ID NO: 85), and the synthesized oligo DNA positive strand is The antisense strand is The underline indicates the DNA double-stranded sequence corresponding to the recognition domain sequence, and the bold italic indicates the DNA double-stranded sequence corresponding to the binding motif "UAGGGU" of the hnRNP A1 protein.

[0176] The synthesized Oligo DNA positive and antisense strands were mixed according to the annealing reaction system (total reaction volume 20μl: Oligo-F (100μM) 2μl + Oligo-R (100μM) 2μl + 10×NEB Cutter smart buffer 2μl + deionized water 16μl), incubated at 95℃ for 5 minutes and placed on ice to cool and anneal to form double-stranded DNA with sticky ends. After diluting 100 times, 1μl was taken and connected with 10ng BsaI-digested and recovered linearized pUC57-U7-snRNA backbone plasmid. Further, by transforming competent E. coli cells, picking single clones, PCR and sequencing verification, a U7-snRNA vector containing the hnRNP A1 binding motif for inducing splicing skipping of exon 17, exon 24, exon 45 and exon 50 of USH2A pre-mRNA was obtained, and the vector was named pUC57-U7-hnRNP A1-snRNA#. The plasmid was purified and stored at -20°C for future use.

[0177] U7-hnRNP A1-snRNA can also be chemically synthesized and modified according to the methods described in the above examples. Taking snRNA17-1 as an example, the chemically synthesized U7-hnRNP A1-snRNA sequence and modification are as follows (* indicates phosphorothioate backbone, m indicates 2'-methoxy modification, underline indicates recognition domain that is reverse complementary to the target sequence, italics indicate smOPT sequence, and bold indicates hnRNP A1 protein binding motif):

[0178]

[0179] The schematic diagram of the structure of U7-hnRNP A1-snRNA is shown in Fig.13 shown.

[0180] The modified sequence is based on the sequence shown in SEQ ID NO: 96, with phosphorothioate backbone modification and methoxy modification added to the first three bases at the 5' end and the 3' end.

[0181] 2. Detect the efficiency of U7-snRNA linked to the hnRNP A1 binding motif in inducing splicing skipping of USH2A exon 17, exon 24, exon 45 and exon 50 in reporter gene cells.

[0182] Exemplary detection method: 293T cells were seeded into 24-well plates, and the cell confluence reached about 80% after 24 hours. pCMV-EGFP was transfected into the cells using Lipofectamine 2000. left -Exon17-EGFP right 293T cells were co-transfected with pUC57-U7-hnRNP A1-snRNA plasmid and pUC57-U7-snRNA plasmid (the vector mass ratio was 100ng:400ng), and 293T cells transfected with reporter plasmid alone, co-transfected with reporter plasmid and pUC57-U7 Scramble were used as two negative controls, and 293T cells not transfected with any plasmid were used as blank controls. The transfected cells were cultured for 48-72 hours, digested into single cells with trypsin, and then flow cytometry was used to detect the splicing jump efficiency induced by different snRNA groups.

[0183] Experimental results: Introducing the hnRNP A1 binding motif at the 5' end of U7-snRNA can significantly enhance the effect of inducing splicing skipping of exon 17, exon 24, exon 45 and exon 50 of USH2Apre-mRNA, which not only increases the proportion of cells with exon splicing skipping (GFP+), but also increases the mRNA level of splicing skipped exons in each cell (average FITC intensity).

[0184] In this embodiment, a free tail is introduced at the 5' end of U7-snRNA. The free tail sequence includes the binding motif "UAGGGU" of hnRNP A1 protein. The free tail sequence is preferably It can recruit hnRNP A1 protein and promote splicing skipping of USH2A exon 17, exon 24, exon 45 and exon 50 without affecting its targeting specificity and causing or increasing off-target effects.

[0185] Embodiment 14

[0186] Construction and viral packaging of AAV-U7-snRNA related plasmid vectors targeting and inducing splicing skipping of USH2A pre-mRNA exons 17, 24, 45, and 50.

[0187] In this example, the U7-snRNA gene that targets and induces the splicing skipping of the above exons of USH2A pre-mRNA is inserted and replaced with the middle gene sequence of the two ITR domains in the pAAV-CMV vector to construct the pAAV-U7-snRNA vector, and the host cells are co-transfected with the AAV packaging plasmid: the serotype pRC plasmid (containing the Rep gene of AAV2 and the Cap gene of each serotype), the pHelper plasmid (a vector plasmid containing the E2A, E4 and VA genes of adenovirus), and the AAV-U7-snRNA virus that targets the splicing skipping of USH2A pre-mRNA exons 17, 24, 45, and 50 is packaged. The specific operation process is as follows:

[0188] First, the gene sequence - U7-snRNA gene expression box skeleton (excluding the recognition domain) was synthesized by whole gene synthesis: 5'-mouse U7 promoter-smOPT sequence-U7-snRNA scafford-snRNA gene specific 3' box-3'. Two Type IIs restriction endonuclease recognition sites were added between the U7 promoter and smOPT to facilitate subsequent excision, replacement and insertion of other recognition domain sequences. The whole gene synthesized sequence was inserted and replaced the gene sequence between the two AAV2-ITR domains of the pAAV-CMV plasmid to obtain the pAAV-U7-snRNA backbone vector.

[0189] U7-snRNA gene expression cassette skeleton (excluding the recognition domain) (SEQ ID NO: 98):

[0190] AAGCTTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTG GAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAGACCAATGTGGGTCTCGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGCGGCCGC.

[0191] According to the method of the above embodiment, according to the pre-transcription DNA sequence corresponding to the snRNA recognition domain sequence in Table 1, the corresponding Oligo DNA positive chain and antisense chain are synthesized respectively, and sticky ends similar to those cut by the Type IIs restriction endonuclease recognition site are added to both ends. Annealing forms a double-stranded DNA of the recognition domain with sticky ends, and T4 ligase is ligated into the linearized pAAV-U7-snRNA backbone plasmid recovered by the corresponding Type IIs restriction endonuclease digestion to form a pAAV-U7-snRNA plasmid targeting a specific site of the USH2A pre-mRNA exon to induce splicing jumps, and it is named according to the snRNA number corresponding to the recognition domain sequence.

[0192] After inserting the target gene (U7-snRNA gene expression box that targets and induces USH2A pre-mRNA exon splicing skipping) and replacing the gene sequence between the AAV-ITR domains of the pAAV-CMV plasmid, the pAAV-U7-snRNA plasmid vector was obtained. The AAV-U7-snRNA virus that targets and induces USH2A pre-mRNA exon splicing skipping was packaged according to the instructions and standard cell operation procedures.

[0193] 24 hours before transfection, HEK293 / 293T cells were inoculated into 100mm cell culture dishes with 10% FBS DMEM culture medium. Transfection was performed when the confluence reached 80%-90%. 3 hours before transfection, the old culture medium was discarded and replaced with fresh culture medium. During transfection, pAAV-U7-snRNA plasmid, pRC plasmid, pHelper plasmid and PEI (polyethyleneimine) transfection reagent were prepared according to the system in the table below and added dropwise to the culture dish. After the PEI transfection mixture was added, the culture dish was gently shaken to evenly distribute the transfection reagent, and the culture medium was placed in a 37°C, 5% CO2 incubator for culture.

[0194] Table 7 PEI transfection system

[0195]

[0196]

[0197] 24 hours after transfection, replace the DMEM medium with fresh 2% FBS. 48-72 hours after transfection, collect the cells containing AAV virus, wash and centrifuge, collect the cell pellet, and vortex to loosen the cell pellet. Then, according to the instructions of the kit, add 0.5mL of AAV Extraction Solution A to the cell pellet and vortex for 15 seconds to fully suspend the cell pellet. After standing at room temperature for 5 minutes, vortex again for 15 seconds. Centrifuge at 4°C, 2000-14000g for 10 minutes to remove cell debris. Collect the supernatant into a new sterile centrifuge tube, add 50μL AAV Extraction Solution B, use a pipette to mix, and obtain AAV-U7-snRNA virus solutions with different recognition domains. Take a portion to detect the virus titer by qPCR and store at 80°C for later use.

[0198] Since the AAV-ITR domain inserted into the pAAV-U7-snRNA plasmid and the target gene fragment inserted therein should be less than 4.7kb, multiple U7-snRNA gene expression cassettes (5'-mouse U7 promoter-recognition domain-smOPT sequence, snRNA gene-specific 3' cassette-3') can be inserted to ensure that the expression amount of U7-snRNA is increased under the same number of AAV virus particles. The gene sequence length is about 450bp, so preferably the pAAV-U7-snRNA plasmid carries 1-10 U7-snRNA gene expression cassettes, and the multiple U7-snRNA gene expression cassettes in the pAAV-U7-snRNA plasmid may have the same recognition domain.

[0199] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0200] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An snRNA targeting USH2A gene pre-mRNA, characterized in that: The recognition domain of the snRNA is reversely complementary to the pre-mRNA sequence of the USH2A gene, and the snRNA induces splicing skipping of exon 17, exon 24, exon 45 or exon 50 by binding to the pre-mRNA of the USH2A gene.

2. The snRNA according to claim 1, characterized in that The USH2A gene pre-mRNA sequence is selected from the following regions: USH2A exon 17, exon 24, exon 45, exon 50 and intron sequences on both sides of each exon.

3. The snRNA according to claim 2, characterized in that The genomic localization region corresponding to the USH2A gene pre-mRNA sequence is selected from: Chr1: 216199619-216200129, Chr1: 216086701-216086835, Chr1: 215845811-215846043, Chr1: 215798892-215799134.

4. The snRNA according to claim 3, characterized in that The USH2A gene pre-mRNA sequence is selected from the sequence shown in SEQ ID NO.1 to SEQ ID NO.

4.

5. The snRNA according to claim 3, characterized in that The genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216200104-216200133, Chr1: 216199615-216199644, Chr1: 216086701-216086745, Chr1: 216086765-216086794, Chr1: 21608 6809-216086838, Chr1: 215845834-215845884, Chr1: 215846018-215846047, Chr1: 215845962-215845991, Chr1: 215798940-215798969, Chr1: 215798889-215798918.

6. The snRNA according to claim 5, characterized in that The USH2A gene pre-mRNA sequence is selected from the sequence shown in: SEQ ID NO.5-SEQ ID NO.

14.

7. The snRNA according to claim 1, characterized in that The recognition domain of the snRNA is reversely complementary to a continuous sequence of at least 16 bp in the pre-mRNA sequence of the USH2A gene.

8. The snRNA according to claim 6, characterized in that The recognition domain of the snRNA is selected from the sequences shown in SEQ ID NO.15-SEQ ID NO.26 and SEQ ID NO.30-SEQ ID NO.

69.

9. The snRNA according to claim 1, characterized in that The genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216199619-216199641, Chr1: 216200107-216200129, Chr1: 216086701-216086723, Chr1: 216086723-216086745, Chr1: 216086769-216086791, Chr1: 21608 6813-216086835, Chr1: 215845834-215845856, Chr1: 215845862-215845884, Chr1: 215846021-21 5846043, Chr1: 215845965-215845987, Chr1: 215798892-215798914, Chr1: 215798944-215798966.

10. The snRNA according to claim 9, characterized in that The recognition domain of the snRNA is selected from the sequence shown in SEQ ID NO.15 to SEQ ID NO.

26.

11. The snRNA according to claim 9, characterized in that The genomic location corresponding to the pre-mRNA sequence of the USH2A gene is selected from: Chr1: 216199619-216199641, Chr1: 216086701-216086723, Chr1: 216086723-216086745, Chr1: 216086769-216086791, Chr1: 216086813-216086835, Chr1: 215845834-215845856, Chr1: 215845862-215845884, Chr1: 215798892-215798914, Chr1: 215798944-215798966.

12. The snRNA according to claim 11, characterized in that The recognition domain of the snRNA is selected from the sequences shown in: SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.25, and SEQ ID NO.

26.

13. The snRNA according to any one of claims 1 to 12, characterized in that Contains at least two snRNAs.

14. The snRNA according to claim 13, characterized in that The recognition domains of at least two snRNAs target different pre-mRNA sequence regions of the USH2A gene.

15. The snRNA according to claim 14, characterized in that The recognition domains of at least two of the snRNAs have no overlapping sequences.

16. The snRNA according to claim 15, characterized in that The recognition domains of at least two snRNAs target different exons and corresponding intron sequences of the pre-mRNA sequence of the USH2A gene.

17. The snRNA according to any one of claims 1 to 12, characterized in that The snRNA is U1-snRNA or U7-snRNA.

18. The snRNA according to claim 17, characterized in that The snRNA includes an sm sequence.

19. The snRNA according to claim 18, characterized in that The sm sequence is a smOPT sequence, and the smOPT sequence is shown in SEQ ID NO:

27.

20. The snRNA according to claim 18, characterized in that The snRNA also includes a motif that recruits splicing regulatory proteins.

21. The snRNA according to claim 20, characterized in that The splicing regulatory protein includes at least one of hnRNPA1, SRSF1, RBM4, DAZAP1 or SR.

22. A nucleic acid, characterized in that The nucleic acid comprises a nucleotide sequence encoding the snRNA according to any one of claims 1 to 21.

23. A gene expression cassette, characterized in that The gene expression cassette comprises the snRNA according to any one of claims 1 to 21, and / or comprises the nucleic acid according to claim 22.

24. A carrier, characterized in that The vector comprises the snRNA according to any one of claims 1 to 21, the nucleic acid according to claim 22, and / or the gene expression cassette according to claim 23.

25. A virus particle, characterized in that The viral particle comprises the snRNA according to any one of claims 1 to 21, the nucleic acid according to claim 22, and / or the vector according to claim 24.

26. A cell, characterized in that The cell comprises the snRNA of any one of claims 1-21, the nucleic acid of claim 22, the vector of claim 24, and / or the viral particle of claim 25.

27. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the snRNA according to any one of claims 1 to 21, the nucleic acid according to claim 22, the vector according to claim 24, and / or the virus particle according to claim 23.

28. A method for obtaining an Usherin protein in which exon 17, exon 24, exon 45, or exon 50 is deleted, characterized in that: The method comprises contacting the pre-mRNA of the USH2A gene with the snRNA of any one of claims 1 to 21, the nucleic acid of claim 22, the vector of claim 24, the gene expression cassette of claim 23, the viral particle of claim 25, the cell of claim 26, and / or the composition of claim 27.

29. Use of the snRNA of any one of claims 1 to 19, the nucleic acid of claim 22, the gene expression cassette of claim 23, the vector of claim 24, the viral particle of claim 25, the cell of claim 26, the pharmaceutical composition of claim 27 or the method of claim 28 in the preparation of a medicament for preventing eye diseases and / or ear diseases, or in the preparation of a medicament for treating eye diseases and / or ear diseases.

Images