Substance for detecting or assisting in detecting wheat plant height and application thereof

Abstract

The invention discloses a substance for detection or auxiliary detection of wheat plant height and application thereof. The invention aims to solve the problem of how to quickly and accurately identify or assist in identifying the wheat plant height. According to the application, a substance for detecting the polymorphism or genotype of an SNP site in a wheat genome is applied to identification or auxiliary identification of the wheat plant height, the SNP site is located in a wheat 7A chromosome TaFT-A1 gene, a single nucleotide polymorphism (SNP) site exists at the + 314bp position of a coding region of the TaFT-A1 gene, amino acid in the coding region is changed, and therefore the function of TaFT-A1 protein is affected. And the nucleotide is T or G and is the 366th nucleotide of the sequence 3 in the sequence table. The marker is good in repeatability, convenient to detect and low in cost, and has a good application prospect in improved wheat plant height assisted selection and molecular design breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to the field related to substances for detecting or assisting in detecting wheat plant height and applications thereof. Background Art

[0002] Plant height of wheat is one of the important traits that affect its growth, development and yield. In recent years, with the in-depth study of the regulation mechanism of wheat plant height, scientists have gradually revealed the key role of various genes and hormone signals in this process. These studies not only provide a theoretical basis for wheat breeding, but also open up new ways to improve crop resistance and yield.

[0003] In wheat, the number and length of internodes are directly related to the formation of the overall height of the plant. The important factors affecting plant height include Rht Genes and hormone signaling pathways. For example, by introducing GA-insensitive dwarfing genes Rht- B1b and Rht-D1b , wheat plant height is significantly reduced, thus enhancing wheat lodging resistance, which is one of the important factors for the success of the "Green Revolution" (Peng et al., 1999). These dwarfing genes reduce plant growth height by inhibiting the gibberellin signaling pathway, thereby optimizing resource utilization.

[0004] Recent studies have found that GSK3 It plays an important role in regulating wheat plant height. GSK3 can phosphorylate Rht-B1b protein, which regulates the function of Rht-B1b and thus affects the height of the plant (Dong et al., 2023). In addition, GSK3 also regulates the interaction between hormone signals such as auxin and gibberellin together with TaARF12 and other genes, forming a complex regulatory network (Li et al., 2022).

[0005] In addition to the Rht gene, other genes such as DENSE AND ERECT PANICLE 1 ( TaDEP1 ) also plays an important role in plant height regulation. Through functional studies of these genes, scientists have found that the interactions between different genes can jointly affect the growth and development of wheat. In addition, recent studies have also found that Rht8 Related allelic variants (such as Rht8-2 and Rht8-3 ) can effectively reduce wheat plant height (Xiong et al., 2022), providing a new option for breeding.

[0006] In addition to genetic factors, plant hormones such as auxin and brassinosteroids also play an important role in regulating plant height. DWARF AND LOW‐TILLERING (DLT )and ORYZA SATIVA HOMEOBOX 15 ( OSH15 ) interact with each other to regulate internode elongation by coordinating brassinosteroid signaling and metabolism. This mechanism also applies to wheat, revealing the importance of hormones in regulating plant height (Niu et al., 2022).

[0007] In recent years, more research has focused on other genes that control wheat plant height, such as TaCRY1a , studies have found that its overexpression can reduce coleoptile growth and inhibit plant height by competitively inhibiting the interaction between GA-INSENSITIVE DWARF 1 (GID1) and DELLA (Yan et al., 2021).

[0008] Although important progress has been made in the study of wheat plant height regulation, the dwarfing gene resources available in wheat breeding are still relatively limited. In the future, with the development of genomics and molecular biology technologies, we are expected to identify more genes that affect plant height and understand their role in complex genetic backgrounds. This will provide new ideas and approaches for wheat lodging tolerance, stress resistance and high-yield breeding. Summary of the invention

[0009] The technical problem to be solved by the present invention is how to quickly and accurately identify and screen wheat plant height traits.

[0010] In order to solve the above problems, the present invention first provides an application of a substance for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is a site in the wheat genome, the nucleotide type of which is T or G, and is the 366th nucleotide of sequence 3 in the sequence table; the application is any of the following: A1) Use of the substance in identifying or assisting in identifying wheat strains, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying wheat plant height, A4) Use of the substance in preparing wheat breeding products.

[0011] The substance may be the following B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0012] The SNP single nucleotide polymorphism site is a SNP in the wheat genome, which is the 366th nucleotide of SEQ ID No: 3 in the sequence list, which is T or G; located on chromosome 7A of wheat TaFT-A1 In genes, TaFT-A1 Genes linked to wheat plant height.

[0013] The wheat plant height refers to the distance from the root neck to the top of the plant, where the top refers to the top of the main stem.

[0014] In the above applications, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight measurement, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid sequence or a protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0015] The present invention also provides a method for identifying or assisting in identifying wheat plant height, the method comprising detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat plant height according to the genotype.

[0016] In the above-mentioned method for identifying or assisting in identifying wheat plant height, the genotype is TT or GG, the TT is the homozygous type when the SNP site is T, and the GG is the homozygous type when the SNP site is G. According to the genotype identification or assisting in identifying wheat plant height, the average plant height of the wheat to be tested with the genotype of TT is lower than that of the wheat to be tested with the genotype of GG.

[0017] The present invention also provides a method for wheat breeding, which comprises detecting the genotype of the above-mentioned SNP site in the wheat genome, and selecting wheat whose genotype of the SNP site is TT or GG as a parent for breeding, wherein the TT is a homozygous type when the SNP site is T, and the GG is a homozygous type when the SNP site is G.

[0018] In the above-mentioned wheat breeding method, the wheat breeding index includes wheat plant height.

[0019] Furthermore, the purpose of wheat breeding includes cultivating wheat with low plant height. The low plant height of wheat means that the average plant height of wheat is lower than that of the parent.

[0020] In the above method for identifying or assisting in identifying wheat plant height and the above method for wheat breeding, the wheat may be an inbred line or a pure line.

[0021] The invention also provides application of the method in wheat breeding.

[0022] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is the above-mentioned SNP site, and the product contains the substance described above, and the product may be any of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat plant height, C2) Products that identify or assist in identifying wheat plant height, C3) Products used in wheat breeding.

[0023] Specifically, the product may be as follows: D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

[0024] In the above, the primer composition may be as follows (E1), E2) or E3): E1) The primer combination is a first-round PCR primer, E2) The primer combination is a second-round PCR primer, E3) the primer combination is a first-round PCR primer and a second-round PCR primer; The first round of PCR primers consists of a forward primer FT-A1-F1 and a reverse primer FT-A1-R1, wherein the forward primer FT-A1-F1 is a single-stranded DNA molecule of sequence 1 in the sequence list, and the reverse primer FT-A1-R1 is a single-stranded DNA molecule of sequence 2 in the sequence list; the specific sequence is: FT-A1-F1: 5'-CGATGCTTCTGTTGACATGTTTT-3'; FT-A1-R1: 5'-ACGTGGGCCATGGGTAGG-3'.

[0025] The second round of PCR primers consist of a forward primer FT-A1-F2 and a reverse primer FT-A1-R2, wherein the forward primer FT-A1-F2 is a single-stranded DNA molecule of sequence 4 in the sequence list, and the reverse primer FT-A1-R2 is a single-stranded DNA molecule of sequence 5 in the sequence list; the specific sequence is: FT-A1-F2: 5'-GGTGCCTCGTTCGGGCAGGAAGGGA-3'; FT-A1-R2: 5'-CGAAGTCCCTGGGTGTTGA-3'.

[0026] In the above applications and methods, the substance for detecting SNP polymorphism or genotype can be a nucleotide type of the SNP site in the wheat genome determined by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0027] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is sequence 3 in the sequence list.

[0028] The application of the above DNA molecules is also within the scope of protection of the present invention, and the application may be any of the following: F1) Use of the DNA molecule in identifying or assisting in identifying wheat plant height, F2) application of the DNA molecule in wheat breeding, F3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying wheat plant height, F4) Use of the DNA molecule in preparing wheat breeding products.

[0029] The present invention is based on population genetics and association analysis, and is obtained by cloning Chinese Spring cDNA. TaFT-A1 By comparing the different wheat materials TaFT-A1 Sequence polymorphism analysis of the coding region revealed that TaFT-A1 There is a SNP site (T / G) at the +314 bp position downstream of the "ATG" in the coding region, which causes amino acid changes in the coding region, thus affecting the function of the TaFT-A1 protein. The dCAPS marker was developed using this SNP site to form two alleles, and 348 wheat materials were scanned at the same time. The genotype was associated with the plant height data of multiple years and multiple points, and it was found thatTaFT-A1 The _SNP+314-dCAPS marker was significantly correlated with wheat plant height, indicating that this marker can assist in the molecular design breeding of wheat plant height. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 for TaFT-A1 The mutation site and two alleles in the coding region. The numbers indicate the position of the mutation in the gene coding region (bp), and the red bases represent the T / G change at that position.

[0031] Figure 2 for TaFT-A1 _SNP+314 marker dCAPS detection.

[0032] Figure 3 for TaFT-A1 _SNP+314 marker association analysis. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0034] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0035] The following examples were processed using SPSS 25 statistical software, and the experimental results were expressed as mean ± standard deviation, and a one-way ANOVA test was used. P <0.001(***)indicates a very significant difference.

[0036] The wheat varieties in the following examples are commercial varieties, which can be found on the China Crop Germplasm Information Network (http: / / www.cgris.net / ).

[0037] Embodiment 1, TaFT-A1 The role of cDNA SNP sites in identifying wheat plant height 1. TaFT-A1_SNP+314 Discovery and genotyping 1.1 TaFT-A1 SNP site discovery and primer design in cDNA Using the wheat Chinese spring reference genome to obtain wheat TaFT-A1Sequence information, the gene is located in chromosome 7A of wheat. TaFT-A1 Coding region variation analysis revealed TaFT-A1 There is a single nucleotide polymorphism (SNP) site at the +314bp position in the coding region, which leads to changes in the amino acids in the coding region, thereby affecting the function of the TaFT-A1 protein. This site has a G / T polymorphism. TaFT-A1 _SNP+314 is at position 366 of sequence 3, and its nucleotide type is G or T. TaFT-A1 _SNP+314 dCAPS marker. The marker was used to scan the natural wheat population. Agarose gel electrophoresis showed that the population can be divided into two types. TaFT-A1(G) The PCR product of the material cannot be cut and is 151 bp; TaFT-A1(T) The material was cut to form a lower band of 115bp. The association analysis combined with the genotype data and plant height phenotype data showed that TaFT-A1 _SNP+314 allele variation is significantly associated with wheat plant height, carrying TaFT-A1 ( G ) The average plant height of the material was significantly higher than that of the TaFT-A1(T) The average plant height of the material. TaFT-A1(G) Materials TaFT-A1 _SNP+314 is homozygous for G, and can also be named as genotype GG; TaFT-A1(T) Materials TaFT-A1 _SNP+314 is the homozygous type of T, which can also be named as genotype TT.

[0038] 1.2 TaFT-A1 _Genotyping of SNP+314 Specific dCAPS primers were designed using the dCAPS Finder 2.0 website according to the variation of the site.

[0039] 1) One round of PCR amplification: Extract wheat leaf genomic DNA, add 200ul TE to dissolve, and use 1% agarose gel electrophoresis to test DNA quality. The extracted DNA is required to be free of obvious impurities, clear bands, and non-degraded, and is used as the template DNA for amplification.

[0040] The first round of PCR primers included forward primer FT-A1-F1 and reverse primer FT-A1-R1.

[0041] FT-A1-F1: 5'-CGATGCTTCTGTTGACATGTTTT-3' (SEQ ID NO: 1); FT-A1-R1: 5'-ACGTGGGCCATGGGTAGG-3' (SEQ ID NO: 2).

[0042] The experiment used 2×Mix enzyme. After measuring the DNA concentration, the template DNA concentration was uniformly adjusted to 50 ng / μL. The PCR amplification system was as follows:

[0043] The PCR amplification program was as follows: denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C (1 kb·min-1), 30 cycles; extension at 72°C for 10 min, and termination of the reaction at 12°C.

[0044] A 601 bp PCR product was obtained, which is sequence 3 (SEQ ID NO: 3) in the sequence list, and the 366th base of sequence 3 is the mutation site TaFT-A1 _SNP+314, as follows: Sequence 3 (SEQ ID NO: 3): 5'--3'.

[0045] 2) Second round of PCR amplification In the second round of PCR, a single base G mutation was introduced 3 bp upstream of the SNP site by using dCAPS marker primers. The dCAPS marker primers (second round PCR primers) contain specific forward and reverse primers FT-A1-F2 and FT-A1-R2. The guanine base G at position 23 of FT-A1-F2 is the introduced mismatch site and forms an endonuclease Fok The recognition site of Ⅰ is "5'-GGATG-3'".

[0046] FT-A1-F2: 5'-GGTGCCTCGTTCGGGCAGGAAGGGA-3' (SEQ ID NO: 4); FT-A1-R2: 5'-CGAAGTCCTGGTGTTGA-3' (SEQ ID NO: 5).

[0047] The PCR product of the first round was diluted 200 times, the primers were FT-A1-F2 and FT-A1-R2, and then the second round of PCR amplification was performed using 2× Mix. The system was as follows:

[0048] The PCR amplification program was as follows: denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 10 sec, 35 cycles; extension at 72°C for 10 min, and termination of the reaction at 12°C.

[0049] The second-round PCR amplification products were recovered by 4% agarose gel electrophoresis and sequenced to obtain TaFT-A1(G) The material is as sequence 6 (SEQ ID NO: 6, 151 bp) in the sequence list and TaFT-A1(T) The material is sequence 7 (SEQ ID NO: 7, 151 bp), and is as follows: TaFT-A1(G) (SEQ ID NO: 6): 5'-GGTGCCTCGTTCGGGCAGGAAGGGAGGTGCTATGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCG-3'; TaFT-A1(T) (SEQ ID NO: 7): 5'-GGTGCCTCGTTCGGGCAGGAAGGGATGTGCTATGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCG-3'.

[0050] Note: The 23rd position of sequence 6 and sequence 7 is the introduced mismatch base, the 26th position is the mutation site, and the 23rd to 27th positions are the endonucleases. Fok ⅠRecognition site.

[0051] 3) Enzyme digestion reaction use Fok Ⅰ Single enzyme digestion of the second round PCR amplification product, the reaction system is as follows:

[0052] Reaction procedure: 37℃ constant temperature water bath, enzyme digestion for 4 h.

[0053] 4) Agarose gel electrophoresis TaFT-A1 _Genotyping of SNP+314 The digested products were subjected to electrophoresis on 4% agarose gel, and then photographed and the genotype of the material was determined based on the band type. The electrophoresis results showed that the second-round PCR amplification products were digested by endonucleases. Fok The genotype of the material cut by Ⅰ is TT (also known as TaFT-A1(T) ), the second round of PCR amplification products cannot be cleaved by endonuclease Fok The genotype of the material cut by Ⅰ is GG (also known as TaFT-A1 (G) ). Figure 2 The genotypes of 4 of the 348 wheat varieties in step 2 are TaFT-A1(G) and The genotypes of the four TaFT-A1 (T) The electrophoresis results of the material carry TaFT-A1(G) The PCR product of the material cannot be cut and is 151 bp; TaFT-A1 (T) The material was cut to form a lower band of 115 bp, with 100 bp and 200 bp on the left as markers.

[0054] 2. TaFT-A1 Functional validation of SNP+314 348 wheat materials were used for TaFT-A1_SNP+314 These materials were planted in Luoyang, Henan in 2002 and 2005, and in Shunyi, Beijing in 2005 and 2010.

[0055] A completely randomized block design was used with three replicates, 4 rows, 2 m long and 0.25 m wide. 40 seeds were evenly sown in each row. The height of the wheat plants was counted after maturity. The 348 wheat samples were analyzed according to the method in 1.2. TaFT- A1_SNP+314 Genotyping of .

[0056] The genotyping data were analyzed with plant height (PH) data from multiple years and multiple locations (Luoyang, Henan in 2002, Luoyang, Henan in 2005, and Shunyi, Beijing in 2010). The results showed that under multiple environments, TaFT-A1(G) The average plant height of the material was significantly higher than that of the TaFT-A1(T) The average plant height of the materials ( Figure 3 ). The above results show the effectiveness of this marker and it can be used as a functional marker for wheat plant height screening.

[0057] 2002LY means it was planted in Luoyang, Henan in 2002; 2005LY means it was planted in Luoyang, Henan in 2005; 2010SY means it was planted in Shunyi, Beijing in 2010. Table 1 shows some wheat genotypes and average plant heights planted in Luoyang, Henan in 2005.

[0058] Table 1 Partial genotype and plant height information of 348 wheat accessions

[0059]

[0060] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

[0061] This application is funded by the National Key Research and Development Program of Agricultural Biobreeding (2022ZD04017).

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a wheat genome, characterized in that: The SNP site is a site in the wheat genome, the nucleotide type of which is T or G, and is the 366th nucleotide of sequence 3 in the sequence list; the application is any of the following: A1) Use of the substance in identifying or assisting in identifying wheat strains, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying wheat plant height, A4) Use of the substance in preparing wheat breeding products.

2. The use according to claim 1, characterized in that: The substance is as follows (B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in identifying wheat plant height, characterized in that: The method comprises detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat plant height according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in wheat breeding.

5. A method for wheat breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the wheat genome, and selecting wheat whose genotype of the SNP site is TT or GG as a parent for breeding, wherein the TT is a homozygous type when the SNP site is T, and the GG is a homozygous type when the SNP site is G.

6. A product for detecting polymorphism or genotype of SNP sites in wheat genome, characterized in that: The SNP site is the SNP site described in claim 1, the product contains the substance described in claim 1, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat plant height, C2) Products that identify or assist in identifying wheat plant height, C3) Products used in wheat breeding.

7. The product according to claim 6, characterized in that: The product is as follows (D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

8. The use according to claim 2 or the product according to claim 7, characterized in that: The primer composition is as follows: E1), E2) or E3): E1) The primer combination is a first-round PCR primer, E2) The primer combination is a second-round PCR primer, E3) the primer combination is a first-round PCR primer and a second-round PCR primer; The one-round PCR primers consist of a forward primer FT-A1-F1 and a reverse primer FT-A1-R1, wherein the forward primer FT-A1-F1 is a single-stranded DNA molecule of sequence 1 in the sequence list, and the reverse primer FT-A1-R1 is a single-stranded DNA molecule of sequence 2 in the sequence list; The second round PCR primers consist of a forward primer FT-A1-F2 and a reverse primer FT-A1-R2, wherein the forward primer FT-A1-F2 is a single-stranded DNA molecule of sequence 4 in the sequence list, and the reverse primer FT-A1-R2 is a single-stranded DNA molecule of sequence 5 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is sequence 3 in the sequence listing.

10. The use of the DNA molecule according to claim 9, wherein the use is any of the following: F1) Use of the DNA molecule in identifying or assisting in identifying wheat plant height, F2) application of the DNA molecule in wheat breeding, F3) Use of the DNA molecule in preparing a product for identifying or assisting in identifying wheat plant height, F4) Use of the DNA molecule in preparing wheat breeding products.

Images