Novel RNA molecules for cancer detection

Abstract

The present invention relates to methods of diagnosing cancer in a patient. Furthermore, the present invention relates to a method of monitoring the course of cancer in a patient. Furthermore, the present invention relates to a method of determining whether a patient is responsive to a therapeutic treatment of cancer. The invention also relates to a method of determining the risk of cancer recurrence in a patient. In addition, the present invention relates to a method of detecting minimal residual lesions in a patient with cancer. In addition, the invention relates to kits for carrying out these methods.

Description

[0001] The present invention relates to methods of diagnosing cancer in a patient. In addition, the present invention relates to methods of monitoring the course of cancer in a patient. In addition, the present invention relates to methods of determining whether a patient has responded to therapeutic treatment of cancer. The present invention also relates to methods of determining the risk of recurrence of cancer in a patient. In addition, the present invention relates to methods of detecting minimal residual disease in a patient suffering from cancer. In addition, the present invention relates to kits for implementing these methods. Background Art

[0002] Cancer is the uncontrolled growth of abnormal cells anywhere in the body. Abnormal cells are called cancer cells, malignant cells, or tumor cells. Cancer cells can multiply uncontrollably and form a large number of cancer cells.

[0003] The most common types of cancer in men are lung cancer, prostate cancer, colorectal cancer, and stomach cancer. In women, the most common types are breast cancer, colorectal cancer, lung cancer, and cervical cancer.

[0004] Lung or bronchial cancer refers to tumors that originate in the lung parenchyma or endobronchial tubes. It is one of the leading causes of cancer-related death in Europe and the United States. Since 1987, lung cancer has caused more deaths than breast cancer in women. It is estimated that there are 225,000 new cases of lung cancer and about 160,000 deaths from lung cancer in the United States each year. Interestingly, lung cancer was a relatively rare disease in the early 20th century. Its dramatic rise in the following decades was mainly due to an increase in smoking in both men and women.

[0005] Historically, markers such as age, performance status, and disease stage have been used to risk stratify cancer patients and guide treatment decisions. These parameters have provided some useful information, but more sensitive markers are clearly needed. Molecular and genetic studies have identified several such markers that appear to play a key role in carcinogenesis and influence patient outcomes. However, their prognostic and predictive value in cancer medicine has been low until now.

[0006] The inventors have identified 28S ribosomal RNA (rRNA) fragments, which are upregulated in cancer patients compared to healthy controls. In particular, the inventors have found that the 28S rRNA fragments are significantly upregulated in lung cancer patients compared to healthy controls. In addition, the inventors have demonstrated in clinical trials of lung cancer patients that the 28S rRNA fragments are expressed higher with the increase of tumor stages. After lung cancer surgery, the inventors have found that the 28S rRNA fragment levels return to normal levels. Therefore, the RNA molecules can be used as biomarkers for cancer diagnosis, monitoring, recurrence control, microlesion detection, and determining surgical resection status. Summary of the invention

[0007] In a first aspect, the present invention relates to a method of diagnosing cancer in a patient, the method comprising the steps of:

[0008] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0009] In a second aspect, the present invention relates to a method for monitoring the course of cancer in a patient, the method comprising the following steps:

[0010] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0011] In a third aspect, the invention relates to a method of determining whether a patient is responsive to therapeutic treatment of cancer, the method comprising the steps of:

[0012] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0013] In a fourth aspect, the present invention also relates to a method for determining the risk of cancer recurrence in a patient, the method comprising the steps of:

[0014] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0015] In a fifth aspect, the present invention relates to a method for detecting minimal residual disease in a patient suffering from cancer, the method comprising the steps of:

[0016] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0017] In a sixth aspect, the present invention relates to the use of an RNA molecule for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment of cancer, determining the risk of cancer recurrence in a patient and / or detecting minimal residual disease (MRD) in a patient with cancer, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0018] In a seventh aspect, the present invention relates to a kit for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment of cancer, determining the risk of cancer recurrence in a patient and / or detecting minimal residual disease in a patient suffering from cancer, wherein the kit comprises:

[0019] Means for determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0020] This summary does not necessarily describe all features of the present invention. Other embodiments will become apparent through a review of the following detailed description. DETAILED DESCRIPTION

[0021] definition

[0022] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methods, protocols and reagents described herein, as these may vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which will only be limited by the appended claims. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art.

[0023] Preferably, the terms used herein are as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and H. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0024] Multiple documents are quoted in the full text of this application document. Each document quoted herein (comprising all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank accession number sequence submissions, etc.), whether above or hereinafter, is hereby incorporated by reference in its entirety. Any content herein should not be regarded as admitting that the present invention is not qualified to advance such disclosure by means of prior invention. In the case of conflict between the definition or instruction of such incorporated reference and the definition or instruction described in the application document, the text of the application document shall prevail.

[0025] According to the present invention, the term "comprises / includes / contains" or variations such as "comprises / includes / comprising" is intended to include the stated integer or group of integers, but not to exclude any other integer or group of integers. According to the present invention, the term "essentially consisting of" is intended to include the stated integer or group of integers, while excluding modifications or other integers that would substantially affect or change the stated integer. According to the present invention, the term "consisting of" or variations such as "consists of" is intended to include the stated integer or group of integers, and to exclude any other integer or group of integers.

[0026] The terms “a,” “an,” and “the” and similar referents used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0027] As used herein, the term "about" indicates a certain variation from the quantitative value preceding it. In particular, unless otherwise indicated or inferred, the term "about" allows a variation of ±5% from the quantitative value preceding it. Unless otherwise expressly stated, the use of the term "about" also includes the specific quantitative value itself. For example, the expression "about 80°C" allows a variation of ±4°C, thus referring to a range from 76°C to 84°C.

[0028] The similarity of nucleotide and amino acid sequences, ie the percentage of sequence identity, can be determined by sequence alignment. Such an alignment can be achieved by several algorithms known in the art, preferably by the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), by hmmalign (HMMER package) or by the CLUSTAL algorithm (Thompson, JD, Higgins, DG & Gibson, TJ (1994) Nucleic Acids Res. 22, 4673-80) or the CLUSTALW2 algorithm (Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version2.0.Bioinformatics,23,2947-2948).

[0029] The rank of sequence identity (sequence match) can be calculated using, for example, BLAST, BLAT or BlastZ (or BlastX). Similar algorithms are incorporated into the BLASTN and BLASTP programs of Altschul et al., (1990) J. Mol. Biol. 215: 403-410. BLAST protein searches are performed by the BLASTP program, which is available, for example, on the website:

[0030] http: / / blast.ncbi.nlm.nih.gov / Blast.cgi? PROGRAM=blastp&BLAST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LI NK_LOC=blasthome.

[0031] The preferred algorithm parameters used are the default parameters as they are set on the indicated website:

[0032] Desired threshold = 10, word length = 3, maximum matches in query range = 0, matrix = BLOSUM62, gap costs = presence: 11 extension: 1, compositional adjustments = conditional compositional scoring matrix adjustments, and non-redundant protein sequence database (nr).

[0033] To obtain gap alignments for comparison purposes, Gapped BLAST was used as described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the corresponding programs were used. Sequence matching analysis can be supplemented by establishing homology mapping techniques such as Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:154-162) or Markov random fields.

[0034] If not specifically indicated otherwise, when percentages of sequence identity are mentioned in this application, these percentages are calculated relative to the full length of the reference sequence indicated. For example, the sentence "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated relative to the total length of SEQ ID NO: XYZ. Variants of the nucleotide sequences according to SEQ ID NO: 1 or SEQ ID NO: 2 are specifically described herein. The variant has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to SEQ ID NO: 1 or SEQ ID NO: 2.

[0035] If not specifically indicated otherwise, when calculating the percentage of sequence identity between two sequences, these percentages may also be calculated relative to the full length of the longer of the two sequences. For example, the phrase "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity to SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated relative to the longer of the two sequences, e.g. the nucleotide sequence according to SEQ ID NO: 1 relative to the nucleotide sequence according to SEQ ID NO: 2, the nucleotide sequence according to SEQ ID NO: 2 being 1 nucleotide longer than the nucleotide sequence according to SEQ ID NO: 1.

[0036] The term "RNA molecule" as used herein refers to a polymeric molecule that is essential in various biological functions of gene coding, decoding, regulation and expression. RNA and deoxyribonucleic acid (DNA) are nucleic acids. Nucleic acids, together with lipids, proteins and carbohydrates, constitute the four major macromolecules necessary for all known life forms. Like DNA, RNA is also assembled into chains of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded to itself, rather than a paired double strand. Cellular organisms use messengers (mRNA) to transmit genetic information (using nitrogenous bases of guanine, uracil, adenine and cytosine, represented by the letters G, U, A and C) to guide the synthesis of specific proteins. Some RNA molecules play an active role in cells by catalyzing biological reactions, controlling gene expression or sensing and conveying responses to cell signals. One of these active processes is protein synthesis, a universal function of RNA molecules to guide protein synthesis on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to ribosomes, where ribosomal RNA (rRNA) then connects amino acids together to form encoded proteins.

[0037] The term "ribosomal ribonucleic acid (rRNA)" as used herein refers to a non-coding RNA that is a major component of ribosomes required by all cells. rRNA is a ribozyme that performs protein synthesis in ribosomes. Ribosomal RNA is transcribed from ribosomal DNA (rDNA) and then combined with ribosomal proteins to form small and large ribosomal subunits. rRNA is the physical and mechanical factor of the ribosome, which forces transfer RNA (tRNA) and messenger RNA (mRNA) to be processed and the latter to be translated into protein. Ribosomal RNA is the main form of RNA found in most cells; although it itself has never been translated into protein, it constitutes about 80% of cellular RNA. By mass, ribosomes are composed of approximately 60% rRNA and 40% ribosomal proteins.

[0038] Mammalian cells have two mitochondrial (12S and 16S) rRNA molecules and four cytoplasmic rRNA molecules (28S, 5.8S, 18S, and 5S subunits). The 28S, 5.8S, and 18S rRNAs are encoded by a single transcription unit (45S) separated by two internal transcribed spacers. The first spacer corresponds to the spacer found in bacteria and archaea, while the other spacer is an insertion in the 23S rRNA in prokaryotes. The 45S rDNA is organized into five clusters (each with 30-40 repeats) on chromosomes 13, 14, 15, 21, and 22. These are transcribed by RNA polymerase I. The DNA of the 5S subunit is arranged in tandem (~200-300 true 5S genes and many scattered pseudogenes), with the largest one located on chromosome 1q41-42. The 5S rRNA is transcribed by RNA polymerase III. In most eukaryotes, 18S rRNA is located in the small ribosomal subunit, while the large subunit contains three rRNAs (5S, 5.8S and 28S).

[0039] The inventors have identified 28S ribosomal RNA (rRNA) fragments, which are upregulated in cancer patients compared to healthy controls. In particular, the inventors have found that the 28S rRNA fragments are significantly upregulated in lung cancer patients compared to healthy controls. In addition, the inventors have demonstrated in clinical trials of lung cancer patients that the 28S rRNA fragments are expressed higher with the increase of tumor stages. After lung cancer surgery, the inventors have found that the 28S rRNA fragment levels return to normal levels. Therefore, the RNA molecules can be used as biomarkers for cancer diagnosis, monitoring, recurrence control, microlesion detection, and determining surgical resection status.

[0040] The term "28S ribosomal RNA (rRNA)" as used herein refers to the structural ribosomal RNA (rRNA) of the large subunit (LSU) of the eukaryotic cytoplasmic ribosome, and therefore refers to one of the basic components of all eukaryotic cells. In mammals, its size is 28S, hence the name. The 28S rRNA described herein has the following nucleotide sequence: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1). The variant of the 28S rRNA described herein has the following nucleotide sequence: GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 2). Therefore, the nucleotide sequence according to SEQ ID NO: 2 is 1 nucleotide longer than the nucleotide sequence according to SEQ ID NO: 1. The levels of these two nucleotide sequences can be determined in the method of the present invention. According to the wording, Include The RNA molecule according to the nucleotide sequence of SEQ ID NO: 1 also encompasses the nucleotide sequence according to SEQ ID NO: 2.

[0041] The term "cancer" as used herein refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, renal cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer (gullet cancer), lymphoma and leukemia. The term "cancer" as used herein also includes cancer metastasis.

[0042] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer, such as lung cancer in stage I, stage II, stage III or stage IV. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) (such as NSCLC in stage I, stage II, stage III or stage IV), or small cell lung cancer (SCLS) (such as SCLS in stage I, stage II, stage III or stage IV). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC) (such as NSCLC in stage I, stage II, stage III or stage IV).

[0043] The term "lung cancer" as used herein refers to a disease consisting of uncontrolled cell growth in lung tissue. This growth may lead to metastasis, which is invasion of adjacent tissues and infiltration outside the lungs. The vast majority of primary lung cancers are carcinomas of the lungs, which originate from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, cough (including coughing up blood), and weight loss.

[0044] Lung cancer can be lung cancer in stage I, stage II, stage III or stage IV. Preferably, lung cancer is non-small cell lung cancer (NSCLC) (e.g., NSCLC in stage I, stage II, stage III or stage IV), or small cell lung cancer (SCLS) (e.g., SCLS in stage I, stage II, stage III or stage IV). More preferably, lung cancer is non-small cell lung cancer (NSCLC) (e.g., NSCLC in stage I, stage II, stage III or stage IV).

[0045] Lung cancer can be staged as follows:

[0046] Stage I means the cancer is small. It has not spread to the lymph nodes or other distant organs. Stage I is an early stage of lung cancer. Stage I can be divided into stage IA and stage IB.

[0047] Stage IA means the cancer is 3 cm or smaller.

[0048] Stage IB means the cancer is between 3 cm and 4 cm. It may also grow into structures such as the main airways of the lungs (mainstream bronchi) or the membrane that covers the lungs (visceral pleura).

[0049] Stage II is still an early stage of lung cancer. Stage II is divided into stages IIA and IIB. Part of the affected lung may have collapsed.

[0050] Stage IIA means the cancer is between 4 cm and 5 cm in size, but there are no cancer cells in any lymph nodes.

[0051] Stage IIB means the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes near the affected lung. Or, it is between 5 cm and 7 cm, but there are no cancer cells in any lymph nodes. Or, the cancer is not in any lymph nodes but has spread to one or more of the following areas: the chest wall (ribs, muscles, or skin), the nerves close to the lungs (phrenic nerves), or the coverings of the heart (mediastinal pleura and parietal pericardium). Or, the cancer is smaller than 7 cm, but there is more than one tumor in the same lobe of the lung.

[0052] Stage III can be divided into stage IIIA, stage IIIB, and stage IIIC. It is sometimes called locally advanced lung cancer.

[0053] In stage IIIA, the cancer is up to 5 centimeters in size and has spread to lymph nodes in the center of the chest on the same side as the tumor. Or, the cancer is between 5 centimeters and 7 centimeters, and there is more than one tumor in the same lobe of the lung. Or, the cancer has spread to one or more of the following areas just outside the lung: the chest wall (ribs, muscle, or skin), nerves close to the lungs (phrenic nerves), the covering of the heart (mediastinal pleura and parietal pericardium), or lymph nodes in or near a lung. Or, the cancer is larger than 7 centimeters. It has not spread to the lymph nodes, but has spread to one or more of the following areas: the muscle under the lung (diaphragm), the center area of ​​the chest (mediastinum), the heart, major blood vessels, the airway (trachea), the nerves to the throat (larynx), the food pipe (esophagus), the spine, or the area where the airways separate (carina). Or, the cancer is in more than one lobe of the same lung, and there may also be cancer cells in the lymph nodes close to the affected lung.

[0054] Stage IIIB can also mean different things. The cancer is smaller than 5 centimeters and has spread to lymph nodes in one of these places: the chest on the side opposite the affected lung, in the neck, or above the collarbone. Or, the cancer is between 5 centimeters and 7 centimeters and has spread to lymph nodes in the center of the chest. Or, the cancer is any size, has spread to lymph nodes in the center of the chest, and has spread to one or more of the following areas: the chest wall, the muscle under the lungs (diaphragm), or the covering of the heart (mediastinal pleura and parietal pericardium). Or, the cancer has spread to lymph nodes in the center of the chest. A lung tumor is larger than 7 centimeters or has spread to major structures in the chest, such as the heart, airway (trachea), food pipe (esophagus), or major blood vessels.

[0055] Stage IIIC means the cancer is between 5 cm and 7 cm in size, or has spread to one or more of the following: the nerves near the lung (phrenic nerves) or the covering of the heart (parietal pericardium), and has spread to the following lymph nodes: in the center of the chest, on the side opposite the affected lung, or at the top of the lung on the same or opposite side, or above the collarbone. Or, there is more than one tumor in different lobes of the same lung. Alternatively, stage IIIC can mean the cancer is larger than 7 cm, or has spread to one of the following: the muscle under the lung (diaphragm), the center of the chest (mediastinum), the heart, the major blood vessels, the airway (trachea), the nerve to the throat (recurrent laryngeal nerve), the food pipe (esophagus), the spine, or the area where the airways separate (carina), and has spread to the following lymph nodes: in the center of the chest, on the side opposite the affected lung, or at the top of the lung on the same or opposite side, or above the collarbone. Or, there are tumors in more than one lobe of the lung.

[0056] Stage IV means that the lung cancer has spread. It can be designated as advanced stage lung cancer. It is divided into stages IVA and IVB.

[0057] Stage IVA can mean any of the following: cancer in both lungs, cancer in the covering of the lungs (pleura) or heart (pericardium), or fluid around the lungs or heart that contains cancer cells. Or, it can mean there is a single area of ​​cancer that has spread outside the chest to lymph nodes or organs, such as the liver or bones.

[0058] Stage IVB means the cancer has spread to several areas of one or more organs.

[0059] The term "(therapeutic) treatment / therapy" as used herein relates to any treatment / therapy that improves a patient's health status and / or prolongs (increases) a patient's life span. The treatment / therapy may eliminate a patient's disease, prevent, inhibit or slow the progression of a patient's disease, reduce the frequency or severity of a patient's symptoms, and / or reduce recurrence in a patient currently suffering from or previously suffering from a disease.

[0060] As used herein, the term "cancer therapy" refers to any regimen, method and / or agent that can be used for the prevention, management, treatment and / or alleviation of cancer. In particular, as used herein, the term "cancer therapy" means achieving one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction in tumor markers, (iii) reduction in tumor lesions and metastases, (iv) reduction in tumor burden as demonstrated by imaging studies (such as computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction in tumor burden as demonstrated by patient self-report or clinical assessment.

[0061] Specifically, cancer therapy includes but is not limited to drug therapy, supportive therapy and / or other therapies known to those skilled in the art (e.g., medical personnel) for prevention, management, treatment and / or alleviation of cancer. More specifically, cancer therapy includes but is not limited to surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof, such as a combination of chemotherapy and immunotherapy.

[0062] The drug administered to a patient in need is preferably selected from the group consisting of an immunomodulator, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine, and an antibody. Combinations of these drugs may also be administered, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0063] The term "chemotherapy" as used herein refers to a cancer treatment that uses one or more anti-cancer drugs (also called chemotherapeutic agents) as part of a standard chemotherapy regimen. Chemotherapy may be given with curative intent (which preferably involves a combination of drugs), or may be intended to prolong life or relieve symptoms (palliative chemotherapy). Preferably, the chemotherapy is platinum doublet chemotherapy.

[0064] The term "chemotherapeutic agent" as used herein refers to any agent that directly or indirectly inhibits the uncontrolled growth and proliferation of cancer cells. Chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, antibodies, signal transduction inhibitors, angiogenesis inhibitors and / or histone deacetylase inhibitors. Preferably, the chemotherapeutic agent is a platinum-containing doublet.

[0065] The term "radiation therapy" as used herein refers to cancer treatment that uses ionizing radiation to control or kill cancerous / malignant cells. Ionizing radiation is usually delivered by a linear accelerator. Radiation therapy is curative for several types of cancer if they are confined to one area of ​​the body. It may also be used as part of adjuvant therapy to prevent tumor recurrence after surgery to remove the primary malignancy. Radiation therapy works synergistically with chemotherapy and can be used for susceptible cancers before, during, and after chemotherapy.

[0066] The term "immunotherapy" refers to any therapy that intentionally modulates one or more components of the human or animal immune system to directly or indirectly obtain certain therapeutic benefits, including systemic and / or local effects, as well as preventive and / or curative effects. Immunotherapy may involve administering one or more immunotherapeutic drugs or agents, either systemically, locally or both, to a human or animal subject, alone or in any combination, by any route (e.g., oral, intravenous, through the skin, by injection, by inhalation, etc.). Immunotherapy may involve stimulating, increasing, decreasing, stopping, preventing, blocking or otherwise regulating the production of cytokines, and / or activating or deactivating cytokines or immune cells, and / or regulating the level of immune cells, and / or delivering one or more therapeutic or diagnostic substances to a specific location in the body or to a specific type of cell or tissue, and / or destroying specific cells or tissues. Immunotherapy can be used to achieve local effects, systemic effects, or a combination of the two. Immunotherapy can also be used to reduce or eliminate side effects that may be caused by other anticancer therapies.

[0067] Immunotherapies designed to elicit or amplify an immune response are classified as activating immunotherapies, while those designed to reduce or suppress an immune response are classified as suppressive immunotherapies.

[0068] Antitumor immunotherapy has broad potential and can be used to treat many different types of advanced cancers because it elicits durable and robust responses in a wide range of malignancies.

[0069] Immunotherapy involves the administration of immunotherapeutic agents.

[0070] The term "immunotherapeutic agent" as used herein refers to any drug, compound or biological product that indirectly or directly restores, enhances, stimulates or increases the body's immune response to cancer cells, and / or reduces the side effects of other anticancer therapies. Examples of common immunotherapeutic agents known in the art include, but are not limited to, checkpoint inhibitors, cytokines, cancer vaccines, antibodies (e.g., monoclonal antibodies) and / or non-cytokine adjuvants. Alternatively, or in addition, immunotherapy treatment includes administering immune cells (e.g., T cells, NK cells, dendritic cells, B cells, etc.) to the patient. In particular, the immune cells are antigen presenting cells and / or chimeric antigen receptor T cells.

[0071] The term "immunochemotherapy" as used herein refers to the treatment and management of diseases (such as cancer) by combining immunotherapy with chemotherapy. Chemotherapy uses different drugs to kill cancer cells or slow the growth of cancer cells, while immunotherapy uses treatments that stimulate or restore the immune system's ability to fight cancer. Specifically, immunochemotherapy is a combined anticancer therapy to improve treatment response and treatment outcome. Immunochemotherapy combines the administration of an immunotherapeutic agent with the administration of a chemotherapeutic agent.

[0072] As used herein, the term "oncolytic virotherapy" refers to a type of cancer treatment that uses oncolytic viruses. Oncolytic viruses are viruses that kill tumor cells directly or indirectly. Oncolytic viruses have different mechanisms of action, such as by infecting and lysing tumor cells, generating an immune response, or introducing toxins and tumor suppressor genes into tumor cells. Oncolytic virotherapy is sometimes considered a type of immunotherapy.

[0073] As used herein, the term "vaccine therapy" refers to a type of cancer treatment that uses a vaccine. The vaccine fights cancer by boosting the body's immune system. Doctors give therapeutic vaccines to people who already have cancer. Vaccine therapy is sometimes considered a type of immunotherapy.

[0074] As used herein, the term "laser therapy" refers to a type of cancer treatment that uses an intense, narrow beam of light to remove or destroy cancer or abnormal cells that can turn into cancer. Tumor cells absorb different wavelengths (or colors) of light than normal cells. So, by choosing the right wavelength of laser light, you can target tumor cells. Laser therapy is a localized treatment, which means it treats a specific part of the body.

[0075] As used herein, the term "thermotherapy" refers to a cancer treatment that uses heat to treat cancer. In particular, thermotherapy is a cancer treatment that heats body tissue to up to 45°C to help damage and kill cancer cells with little or no damage to normal tissue. Thermotherapy to treat cancer is also known as thermal therapy, thermal ablation, or hyperthermia.

[0076] The term "response" as used herein refers to a change in a patient's condition that occurs as a result of or is associated with a cancer treatment. In some embodiments, the response is or includes a beneficial response. In some embodiments, a beneficial response may include stabilization of the condition (e.g., prevention or delay of a worsening that would be expected or typically observed in the absence of treatment), alleviation of one or more symptoms of the condition (e.g., a reduction in frequency and / or intensity), and / or improvement in prospects for a cure of the condition, etc. In particular, the response is a response of a patient with cancer to a cancer therapy.

[0077] Specifically, a cancer patient or (control) subject with cancer treated with a cancer therapy is considered to "respond," have a "response," have a "positive response," or be "responsive" to a cancer therapy if the individual demonstrates evidence of an anti-cancer effect (including clinically significant benefit, such as preventing symptoms or reducing the severity of symptoms, or slowing the progression of the cancer) according to an art-accepted set of objective criteria or reasonable modifications thereof. It should be understood that the above terms can also be applied to cancer.

[0078] In contrast, cancer patients or (control) subjects with cancer who are treated with a cancer therapy are considered to "not respond," "lack a response," have a "negative response," or are "non-responders" to a cancer therapy if the therapy does not provide a clinically significant benefit (such as preventing symptoms or reducing the severity of symptoms, or the rate of progression of the cancer).

[0079] As used herein, the term "diagnosing cancer" means determining whether a patient exhibits signs of cancer or has cancer.

[0080] As used herein, the term "monitoring the course of cancer in a patient" means determining whether a patient develops cancer over time, or means determining the progression of cancer in a patient over time, e.g., whether cancer is getting worse in the patient over time, is not getting worse / stable in the patient, or is improving in the patient.

[0081] The term "determine whether a patient is responsive to a therapeutic treatment of cancer" as used herein means evaluating whether a therapeutic treatment method is effective for a patient. A patient may be identified as a patient who is responsive to a cancer therapy. In this case, the therapeutic treatment of cancer is continued. Specifically, the dosage of a drug administered during the therapeutic treatment of cancer is adjusted (e.g., reduced), and / or the number of times a drug is administered during the therapeutic treatment of cancer is adjusted (e.g., reduced). A patient may also be identified as a patient who is unresponsive to a cancer therapy. In this case, the dosing regimen is changed or the therapeutic treatment of cancer is changed. Specifically, the dosage of a drug administered during the therapeutic treatment of cancer is adjusted (e.g., increased), and / or the number of times a drug is administered during the therapeutic treatment of cancer is adjusted (e.g., increased).

[0082] Preferably, the therapeutic treatment of cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof, such as chemotherapy and immunotherapy (immunochemotherapy).

[0083] More preferably, the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressive agents, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

[0084] As used herein, the term "determining the risk of cancer recurrence in a patient" means detecting whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk of getting sick again. Recurrence occurs when cancer reappears after treatment. This can occur weeks, months, or even years after the primary cancer or original cancer has been treated. It is impossible to know for sure whether cancer will recur. The chance of recurrence depends on the type of primary cancer. Cancer recurs because small areas of cancer cells may remain in the body after treatment. Over time, these cells may multiply and grow large enough to cause symptoms or be found by tests. The time and location of cancer recurrence depends on the type of cancer. Some cancers have an expected recurrence pattern. Cancer may recur in the following ways: recurrence in the same part of the body as the primary cancer, called local recurrence; recurrence near the location of the primary cancer, called regional recurrence; or recurrence in another part of the body, called distant recurrence. Recurrent cancers are named after the location where the primary cancer started, even if it recurred in another part of the body. For example, if breast cancer recurs distantly in the liver, it is still called breast cancer, not liver cancer. Doctors call it metastatic breast cancer. Metastasis means that the cancer has spread to another part of the body.

[0085] The term "minimal residual disease (MRD)" as used herein is the name given to small amounts of cancer cells that remain in a patient's body during treatment or after treatment when the patient is in remission (no signs or symptoms of the disease). This is the leading cause of cancer recurrence. In cancer treatment, MRD testing plays several important roles: determining whether treatment has eradicated the cancer or if there are residual traces, comparing the effectiveness of different treatments, monitoring a patient's remission status and detecting the recurrence of cancer, and choosing the treatment that best meets these needs.

[0086] Preferably, the above-mentioned cancer is lung cancer, such as lung cancer in stage I, stage II, stage III or stage IV. More preferably, lung cancer is non-small cell lung cancer (NSCLC) (such as NSCLC in stage I, stage II, stage III or stage IV), or small cell lung cancer (SCLS) (such as SCLS in stage I, stage II, stage III or stage IV). Even more preferably, lung cancer is non-small cell lung cancer (NSCLC) (such as NSCLC in stage I, stage II, stage III or stage IV).

[0087] As used herein, the term "neoadjuvant therapy" refers to therapy performed prior to a planned primary treatment of a neoplastic disease, typically surgery. Neoadjuvant therapy is intended to reduce the size or extent of a tumor prior to intervention with radical treatment, thus making surgery easier and more likely to be successful, and reducing the consequences of more extensive therapeutic techniques that would be required if the size or extent of the tumor was not reduced. Neoadjuvant therapy may, for example, include chemotherapy, radiotherapy, thermotherapy, immunotherapy, or hormonal therapy.

[0088] The term "adjuvant therapy" used herein refers to a therapy that maximizes its effectiveness outside the primary therapy or primary therapy. The surgery and complex treatment regimens used in cancer therapy cause the term to be mainly used to describe adjuvant cancer therapy. The example of such adjuvant therapy is an additional treatment usually given after surgery, in which all detectable diseases have been removed, but due to the presence of undetected diseases, there is still a statistical risk of recurrence. If a known disease is left behind after surgery, further treatment is not technically adjuvant. For example, patients with minimal residual disease (MRD) preferably receive such adjuvant therapy. Adjuvant therapy can, for example, include chemotherapy, radiotherapy, thermotherapy, immunotherapy or hormone therapy.

[0089] The term "remission" as used herein means that the treatment reduces or eliminates the symptoms and / or signs of a disease (such as cancer). Remission may last for months, years, or the rest of the patient's life. In the case of cancer, remission includes complete remission and partial remission. When there is no sign of cancer in a physical examination, blood test, or imaging test, the cancer is considered to be in complete remission. For example, if a patient's lung cancer is in complete remission, the patient's symptoms will improve, and a computed tomography (CT) scan will show that the cancer has disappeared. Complete remission does not mean that the cancer is gone forever. Cancer can appear again (relapse). In addition, if imaging and blood tests show that the cancerous tumor is at least 50% smaller than before treatment and / or the tumor cells do not seem to be growing, the cancer is considered to be in partial remission.

[0090] A patient is considered cured of cancer if he or she has no signs or symptoms of cancer for at least 5 years after finishing treatment.

[0091] As used herein, the term "recurrence" means that the symptoms and / or signs of a disease (such as cancer) appear again. In other words, if a disease (such as cancer) is discovered after treatment and after a period of time when the disease (such as cancer) cannot be detected, it is called a recurrence of the disease, such as a recurrence of cancer. In the case of cancer, a local recurrence means that the cancer is in the same place or very close to the original cancer. In the case of cancer, a regional recurrence means that the tumor has grown into lymph nodes or tissues near the original cancer. In the case of cancer, a distant recurrence means that the cancer has spread to organs or tissues far away from the original cancer.

[0092] The term "progression" as used herein means that the symptoms and / or signs of a disease (such as cancer) worsen or increase over time. In the case of cancer, the cancer spreads (further) in the body. To indicate the progression of cancer, cancer is usually divided into different stages, with the lowest stage describing early and small cancer / tumor forms, and higher stages classifying the cancer as having progressed and / or spread. Most cancers are divided into four stages, from 1 to 4.

[0093] "Stable disease" as used herein refers to a disease (such as cancer) that neither decreases nor increases in degree or severity. In addition, the term "stable disease" as used herein refers to a disease (such as cancer) that neither worsens nor improves over time. In a stable patient, the patient's condition is constant. "Stable" preferably means a change of no more than 10% or 20% over time, such as 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%. Slight changes over time can be changes within the range of measurement accuracy. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0094] The term "patient" as used herein refers to any subject who wishes to know whether she or he has cancer. In particular, the term "patient" as used herein refers to a subject suspected of being affected by cancer. A patient may be diagnosed as being affected by cancer (i.e., sick) or may be diagnosed as not being affected by cancer (i.e., healthy).

[0095] As used herein, the term "patient" also refers to a subject affected by cancer (i.e., sick). A patient can be monitored to determine whether the cancer develops further in the patient over time. In particular, the patient can be monitored in the form of longitudinal monitoring. Thus, the course of the cancer can be observed in the patient (particularly after or during treatment). The patient can be retested for cancer, and the patient may or may not be diagnosed as developing cancer over time.

[0096] The term "patient" as used herein further refers to a subject with cancer who wishes to know whether she or he responds to cancer therapy. A patient can be identified as a patient who responds to cancer therapy. In this case, the therapeutic treatment of cancer is continued. Specifically, the dosage of the drug used during the therapeutic treatment of cancer is adjusted (e.g., reduced), and / or the number of times the drug is applied during the therapeutic treatment of cancer is adjusted (e.g., reduced). A patient can also be identified as a patient who is unresponsive to cancer therapy. In this case, the dosage regimen is changed or the therapeutic treatment of cancer is changed. Specifically, the dosage of the drug used during the therapeutic treatment of cancer is adjusted (e.g., increased), and / or the number of times the drug is applied during the therapeutic treatment of cancer is adjusted (e.g., increased).

[0097] In addition, the term "patient" as used herein refers to any subject who wishes to know whether she or he (in remission) is at risk of becoming ill again or whether she or he is at risk of experiencing a relapse. A patient can be identified as a patient at risk of relapse or a patient without risk of relapse.

[0098] In addition, the term "patient" as used herein refers to any subject who wishes to know whether the cancer treatment has eradicated the cancer or whether there are any residual traces. Patients (in remission) can be identified as patients who still carry a small amount of cancer cells after treatment or patients who do not carry a small amount of cancer cells. Such patients suffer from minimal residual disease (MRD). Patients with minimal residual disease (MRD) are preferably assigned to / eligible for adjuvant therapy.

[0099] It should be noted that a patient diagnosed as healthy, i.e., without cancer, may have another disease or condition that is not tested / unknown.

[0100] A patient may also be a cancer patient who is in remission, where the cancer is stable, or where the cancer has progressed.

[0101] The patient may be any mammal, including humans and further mammals, for example, animals such as rabbits, mice, rats or monkeys. Human healthy individuals are particularly preferred.

[0102] As used herein, the term "(control) subject" refers to a subject known to be unaffected by cancer (ie healthy) (negative control).

[0103] The term "(control) subject" as used herein also refers to a subject known to be affected by (ie, sick with) cancer (positive control). The (control) subject may have developed an advanced form of cancer, such as a higher grade or stage of cancer.

[0104] The term "(control) subject" as used herein also refers to a subject who is known to be a responder to a therapeutic treatment for cancer or who is known to be a non-responder to a therapeutic treatment for cancer.

[0105] Furthermore, the term "(control) subject" as used herein also refers to successfully treated cancer patients.

[0106] It should be noted that a known healthy (control) subject (ie, not suffering from cancer) may have another disease or condition that is not tested / unknown.

[0107] The (control) subject may be any mammal, including humans and further mammals, for example, animals such as rabbits, mice, rats or monkeys. Human healthy individuals are particularly preferred.

[0108] The term "blood sample" as used herein includes whole blood or blood fractions. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction includes red blood cells, white blood cells and / or platelets. More preferably, the blood cell fraction is a white blood cell fraction or a mixture of red blood cells, white blood cells and platelets.

[0109] The volume of the blood sample is preferably between 0.01 mL and 20 mL, more preferably between 0.1 mL and 10 mL, even more preferably between 0.5 mL and 8 mL, and most preferably between 1 mL and 5 mL.

[0110] The blood sample can be provided by taking blood from a patient or (control) subject, but can also be provided by using a previously separated sample. For example, a blood sample can be collected from a patient or (control) subject by conventional blood collection techniques.

[0111] Blood samples can also be obtained from patients or (control) subjects before the start of therapeutic treatment, during therapeutic treatment and / or after therapeutic treatment. If the blood sample is from at least one (control) subject, for example, from at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500 or 1000 (control) subjects, it is designated as a "reference blood sample". Preferably, the reference blood sample and the blood sample of the patient to be tested are from the same source, for example, both are whole blood samples or blood cell fractions. Further preferably, both are from the same species, for example, from humans. Also (alternatively or additionally) preferably, the measured values ​​of the reference blood sample of the (control) subject and the blood sample of the patient to be tested are the same, for example, both have the same volume. It is particularly preferred that the reference blood sample and the blood sample are from (control) subjects / patients of the same sex and similar age.

[0112] Whole blood samples can be collected by blood collection tubes. For example, they are collected in PAXgene Blood RNA tubes, Tempus Blood RNA tubes, EDTA tubes, sodium citrate tubes, heparin tubes or ACD tubes (citrate dextrose). Alternatively, whole blood samples can be collected in blood collection tubes containing cell-free nucleic acid stabilizing chemicals or cell crowding agents, such as glutaraldehyde, formaldehyde or the like (e.g., Streck cfRNA BCT tubes, Streck cfDNA BCT tubes), etc., and the cell crowding agents are such as polyethylene glycol (PEG) (e.g., Norgen cfDNA / cfRNA storage tubes), etc.

[0113] The blood samples used herein, in particular whole blood samples, can also be collected by means of blood spot technology, for example using the Mitra Microsampling Device. This technology requires a smaller sample volume, which is usually 45 μL-60 μL or less for humans. For example, whole blood can be drawn from a patient by finger puncture with a needle or a lancet. Therefore, the whole blood sample can have the form of a blood drop. The blood drop is then placed on an absorbent probe (e.g., a hydrophilic polymer material such as cellulose), which is capable of absorbing whole blood. Once the sampling is completed, the blood spot is dried in the air before being transferred or mailed to a laboratory for processing. Because the blood is dry, it is not considered dangerous. Therefore, no special precautions are required during handling or transportation. Once the analysis site is reached, the desired component (e.g., the RNA molecule described herein) is extracted from the dried blood spot into the supernatant, and the supernatant is then further analyzed. In this way, the level of RNA molecules is determined. This technology is suitable for monitoring cancer patients at home (based on home care / home sampling) or for screening purposes.

[0114] In the method described herein, the level of RNA molecules is determined in the patient's blood sample. The term "level" used herein refers to the amount (e.g., measured in grams, moles or ion counts) or concentration (e.g., absolute or relative concentration, such as reads per million (RPM) or NGS counts) of RNA molecules. The term "level" used herein also includes a scaled, normalized or scaled and normalized amount or value (e.g., RPM). In particular, the level of RNA molecules is determined by sequencing, preferably next generation sequencing (e.g., ABI SOLID, Illumina Genome Analyzer, Roche454GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or microbeads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX) or any combination thereof. Specifically, the level of RNA molecules is the expression level of the RNA molecules.

[0115] Those skilled in the art will appreciate that in many embodiments described herein, the determined RNA molecule level is compared to an appropriate "reference level" of RNA molecules. Specifically, the level of RNA molecules is compared to the reference level of the RNA molecules. More specifically, the reference level of RNA molecules is determined in a blood sample of a (control) subject. Even more specifically, the reference level is determined empirically by measuring multiple reference blood samples of subjects with cancer who are known to be responders or non-responders to cancer therapy, or by measuring multiple reference blood samples of subjects with cancer who have a known good or poor survival prognosis. Typically, as understood by those skilled in the art, the reference level is determined under conditions comparable to those used to determine or analyze the RNA molecule levels in a patient's blood sample.

[0116] The reference level may also be a cut-off or threshold level. Typically, the cut-off or threshold level may be determined experimentally, empirically or theoretically. As recognized by those of ordinary skill in the art, the cut-off or threshold level may also be arbitrarily selected based on existing experimental and / or clinical conditions. According to the function of the test and the benefit / risk balance (clinical results of false positives and false negatives), the cut-off or threshold level must be determined to obtain the best sensitivity and specificity. Typically, the best sensitivity and specificity (and thus the threshold level) may be determined using a receiver operating characteristic (ROC) curve based on experimental data. For example, after determining the RNA molecule level in the reference group, the RNA molecule level measured in the sample to be tested may be statistically processed using an algorithmic analysis to obtain a classification criterion that is significant for sample classification. The full name of the ROC curve is the receiver operating characteristic curve, also known as the receiver operating characteristic curve. It is mainly used in clinical biomarker testing. The ROC curve is a comprehensive indicator of a continuous variable that reflects the true positive rate (sensitivity) and the false positive rate (1-specificity). It reveals the relationship between sensitivity and specificity through an image fusion method. A series of different cutoff or threshold levels are set as continuous variables to calculate a series of sensitivity and specificity values. The curve is then plotted with sensitivity as the ordinate and specificity as the abscissa. The higher the area under the curve (AUC), the higher the accuracy of the prediction / prognosis / diagnosis. On the ROC curve, the point closest to the upper left corner of the coordinate graph is the critical point with high sensitivity and high specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. When AUC>0.5, as the AUC approaches 1, the prediction / prognosis / diagnosis results get better and better.

[0117] The term "classifier" as used herein refers to a prediction / prognosis model that allows for distinguishing between samples or characterizing samples by classifying a given sample into a predetermined category based on certain features of the sample. For example, the classification can predict with relatively high sensitivity and specificity whether a blood sample of a patient with an unknown response prediction belongs to one of two given categories; each category represents a predicted estimated response. The output can be given as a probability of belonging to any one category between 0-1. If a blood sample of a patient with an unknown survival prognosis belongs to one of two given categories, the classification can also be predicted with relatively high sensitivity and specificity; each category represents a predicted estimated survival. The output can be given as a probability of belonging to any one category between 0-1. Specifically, the classifier allows for distinguishing responders to cancer therapy from non-responders to cancer therapy.

[0118] In the context of the present invention, the term "kit of parts (short: kit)" is understood as any combination of at least some of the components identified herein, which are combined into a functional unit, coexist spatially, and may contain further components.

[0119] Embodiments of the present invention

[0120] The present invention will now be further described. In the following paragraphs, different aspects of the present invention are defined in more detail. Unless clearly indicated otherwise, each aspect so defined may be combined with any other aspect. Especially, unless clearly indicated otherwise, any feature indicated as preferred or advantageous may be combined with any other feature indicated as preferred or advantageous.

[0121] The inventors have identified 28S ribosomal RNA (rRNA) fragments, which are upregulated between cancer patients and healthy controls. In particular, the inventors found that the 28S rRNA fragments were significantly upregulated in lung cancer patients compared with healthy controls. In addition, the inventors showed in clinical trials of lung cancer patients that the 28S rRNA fragments were expressed higher with the increase of tumor stages. After lung cancer surgery, the inventors found that the 28S rRNA fragment levels returned to normal levels. Therefore, the RNA molecule can be used as a biomarker for cancer diagnosis, monitoring, recurrence control, microlesion detection and determining surgical resection status.

[0122] Thus, in a first aspect, the present invention relates to an (in vitro) method for diagnosing cancer in a patient (suspected of having cancer), said method comprising the following steps:

[0123] Determining the level of an RNA molecule in a blood sample from a patient suspected of having cancer, wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0124] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0125] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0126] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0127] (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0128] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Therefore, in a specific embodiment, the present invention relates to an (in vitro) method for diagnosing cancer in a patient, the method comprising the following steps:

[0129] (i) determining the level of the RNA molecule in a blood sample from the patient, and

[0130] (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule,

[0131] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0132] Such comparison allows for diagnosis of cancer in a patient, particularly a patient suspected of having cancer. A patient may be diagnosed as having cancer (ie, being sick), or as not having cancer (ie, being healthy).

[0133] The reference level may be any level that allows determining whether a patient is suffering from cancer. It may be obtained from a (control) subject (i.e. a subject different from the patient to be tested, e.g. a healthy subject and / or a subject known to have cancer) or from the same patient. In the latter case, the patient may be retested for cancer, e.g. in the form of longitudinal monitoring. It may be determined whether the patient is currently affected by cancer or is still not affected by cancer.

[0134] In particular, the reference level is the level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0135] Healthy subjects, and / or

[0136] Subjects with / known to have cancer.

[0137] For example,

[0138] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or

[0139] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects having cancer / known to have cancer.

[0140] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with cancer / known to have cancer) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample of the patient to be tested, which is separated. Further preferably, the reference level is obtained from a control subject (e.g., a healthy subject or a subject with cancer / known to have cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with cancer / known to have cancer. More particularly, the subject population with cancer / known to have cancer includes subjects of all cancer stages, e.g., Phase I, Phase II, Phase III, and Phase IV (mixed population, particularly equal presentation).

[0141] In a preferred embodiment,

[0142] The reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from healthy subjects, and wherein a level of the RNA molecule above the reference level indicates that the patient has cancer, and / or

[0143] The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having / known to have cancer, and wherein a level of the RNA molecule comparable to the reference level indicates that the patient has cancer.

[0144] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher than the reference level.

[0145] In the above context, "comparable" preferably means that the level changes over time by 0 to <20%, specifically 0 to <10%, such as 0, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 19.9%, 19.99% or 19.999%. In this regard, "comparable" may also mean that the detected level changes within the accuracy of the measurement. The accuracy of the measurement depends on the measurement method used. The level can be constant over time.

[0146] Alternatively, the level of the RNA molecule is compared to a threshold value indicative of cancer, and wherein a level of the RNA molecule above the threshold value indicates that the patient has cancer.

[0147] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0148] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0149] Figure 2 It was clearly shown that the above mentioned RNA molecules were increased in patients with lung cancer compared to healthy controls.

[0150] In a second aspect, the invention relates to an (in vitro) method for monitoring the course of cancer in a patient (suffering from cancer or healthy), the method comprising the following steps:

[0151] Determining the level of an RNA molecule in a blood sample from a patient (having cancer or healthy), wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0152] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0153] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0154] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0155] (iv) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0156] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Therefore, in a specific embodiment, the present invention relates to an (in vitro) method for monitoring the course of cancer in a patient, the method comprising the following steps:

[0157] (i) determining the level of the RNA molecule in a blood sample from the patient, and

[0158] (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule,

[0159] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0160] The above comparison allows monitoring / determining the course of cancer in a cancer patient. It can determine whether the patient's cancer is worsening, the patient's cancer is not worsening / is stable, or the patient's cancer is improving. The above comparison also allows monitoring / determining whether cancer is progressing in a patient.

[0161] A reference level may be any level that allows monitoring or detecting cancer in a patient. It may be obtained from a (control) subject, i.e. a subject different from the patient to be tested, e.g. a subject with cancer / known to have cancer or a healthy subject.

[0162] In particular, the reference level is the level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0163] Healthy subjects, and / or

[0164] A subject having / known to have cancer, e.g., a subject having / known to have stage I, stage II, stage III, or stage IV cancer. Stage I and stage II are early cancer stages. Stage III is a locally advanced cancer stage. Stage IV is an advanced cancer stage.

[0165] For example,

[0166] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or

[0167] The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects having / known to have cancer (e.g., subjects having / known to have stage I, stage II, stage III, or stage IV cancer).

[0168] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with cancer / known to have cancer) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample of the patient to be tested, which is separated. Further preferably, the reference level is obtained from a control subject (e.g., a healthy subject or a subject with cancer / known to have cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. In particular, the reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a subject population with cancer / known to have cancer. More particularly, the subject population with cancer / known to have cancer includes a subject of a specific cancer stage (e.g., Phase I, Phase II, Phase III, or Phase IV), or a subject (mixed population, particularly equally presented) of all cancer stages (e.g., Phase I, Phase II, Phase III, or Phase IV).

[0169] In a preferred embodiment,

[0170] (i) the reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from healthy subjects, and wherein a level of the RNA molecule above the reference level indicates that the patient has developed cancer,

[0171] (ii) the reference level is a level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having / known to have a particular stage of cancer (e.g., stage I, stage II, stage III, or stage IV cancer), wherein the stage is comparable to or higher than the stage of cancer in the patient to be tested, and wherein a level of the RNA molecule above the reference level indicates worsening of the patient's cancer,

[0172] (iii) the reference level is a level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having / known to have a particular stage of cancer (e.g., stage I, stage II, stage III, or stage IV cancer), wherein the stage is comparable to or lower than the stage of cancer in the patient to be tested, wherein a level of the RNA molecule below the reference level indicates improvement in the patient's cancer, or

[0173] (iv) the reference level is an RNA molecule level empirically determined by measuring multiple reference blood samples from subjects having / known to have a specific stage of cancer (e.g., stage I, stage II, stage III, or stage IV cancer), wherein the stage is the same as the cancer stage of the patient to be tested, and wherein a level of the RNA molecule comparable to the reference level indicates that the patient is stable or that the patient's cancer is not progressing.

[0174] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher / lower than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4, at least 2.5, at least 2.6, at least 2.7, at least 2.8, at least 2.9, or at least 3.0 times higher / lower than the reference level.

[0175] In the above context, "comparable" preferably means that the level changes over time by 0 to <20%, particularly between 0 and <10%, for example 0, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 19.9%, 19.99% or 19.999%. In this regard, "comparable" may also mean that the detected level changes within the accuracy range of the measurement. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0176] As already mentioned above, the reference level can be any level that allows monitoring or detecting cancer in a patient. It can be obtained from a (control) subject (i.e. a subject different from the patient to be tested, such as a subject known to have cancer or a healthy subject). It can also be obtained from the same individual.

[0177] Thus, in an alternative or additional embodiment, the monitoring comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point and the level of the RNA molecule in at least one further blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points. Thus, in a specific embodiment, the invention relates to an (in vitro) method for monitoring the course of cancer in a patient, the method comprising the following steps:

[0178] (i) determining the level of an RNA molecule in a blood sample obtained from a patient at a first time point and the level of an RNA molecule in at least one further blood sample obtained from (the same) patient at a later time point, and

[0179] (ii) comparing said levels determined at different time points,

[0180] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0181] This process allows monitoring of cancer in patients (healthy or suffering from cancer) over extended periods of time, such as months or years, for example 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months or 11 months, 1 year, 2 years, 3 years, 4 years or 5 years.

[0182] In a preferred embodiment,

[0183] (i) the level of the RNA molecule increases over time indicating that the patient has developed cancer or that the patient's cancer is worsening,

[0184] (ii) the level of the RNA molecule does not change over time, indicating that the patient is stable or that the patient's cancer is not progressing, or

[0185] (iii) Decreasing levels of the RNA molecule over time indicates that the patient's cancer is improving.

[0186] In a more preferred embodiment,

[0187] (i) the patient is healthy at a first point in time and increasing levels over time indicate that the patient has developed cancer,

[0188] (ii) the patient has cancer at a first time point, and the increasing level over time indicates that the patient's cancer is getting worse,

[0189] (iii) the patient has cancer at a first time point, and the level that does not (significantly) change over time indicates that the patient's cancer is not progressing, or

[0190] (iv) the patient has cancer at a first time point, and decreasing levels over time indicate that the patient's cancer is improving.

[0191] Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and still even more preferably at least 2.0-fold or 3.0-fold over time.

[0192] For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0193] Preferably, the reduction is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and still even more preferably at least 2.0-fold or 3.0-fold over time.

[0194] For example, the reduction can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0195] In the above context, "significant change" preferably means a change of more than 10% or 20% over time, such as 10%, 20%, 30%, 40% or 50%. Small changes over time may be changes within the accuracy of the measurement. The accuracy of the measurement depends on the measurement method used. The level may be constant over time.

[0196] In the above context, "stable" preferably means not changing by more than 10% or 20% over time, for example 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%. Small changes over time may be changes within the accuracy of the measurement. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0197] The time period between the first time point and the later time point preferably totals at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (one week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, individuals may be examined routinely, e.g., once or twice a year. Patients may be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9 or 10 time points (the first time point and the additional time points).

[0198] Figure 1 It was clearly shown in clinical trials on lung cancer patients that the above RNA molecules were expressed more highly with increasing tumor stage.

[0199] In addition to monitoring a patient's cancer, therapeutic treatment of the cancer may also be monitored. In particular, the patient receives, has received or has received therapeutic treatment for the cancer.

[0200] Preferably, the therapeutic treatment of cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof, such as chemotherapy and immunotherapy (immunochemotherapy).

[0201] More preferably, the drug is selected from the group consisting of an immunomodulator, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine, and an antibody. The drug may also be a drug combination, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0202] The patient may receive therapeutic treatment (e.g., administration of a drug) throughout the monitoring process, or may receive therapeutic treatment (e.g., administration of a drug) before, at, or after a first time point, and may be retested at a later time point. In particular, the first time point may be before the start of the therapeutic treatment, and the later time point may be during and / or after the therapeutic treatment. If the therapeutic treatment includes administration of a drug and the patient responds to the treatment, the administration of the drug may continue, the dosage of the drug may be reduced, or the administration of the drug may be stopped. If the therapeutic treatment includes administration of a drug and the patient does not respond to the treatment, the dosage of the drug may be increased, the drug may be changed, or the mode of therapy may be changed, for example, from administration of a drug to surgery, laser therapy, or thermotherapy.

[0203] Due to therapeutic treatment, the increased levels of RNA molecules can be reduced. In this way, the (overall) condition of the cancer patient can be improved.

[0204] In a more preferred embodiment,

[0205] (i) the patient is receiving, has received or has received therapeutic treatment for the cancer and a decrease in levels over time indicates that the patient is responding to the treatment, or

[0206] (ii) the patient is receiving, has received or has received therapeutic treatment for cancer and a stable or increasing level over time indicates that the patient is not responding to said treatment.

[0207] Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and still even more preferably at least 2.0-fold or 3.0-fold over time.

[0208] For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0209] Preferably, the reduction is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and still even more preferably at least 2.0-fold or 3.0-fold over time.

[0210] For example, the reduction can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0211] In the above context, "stable" preferably means not changing by more than 10% or 20% over time, for example 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%. Small changes over time may be changes within the accuracy of the measurement. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0212] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0213] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0214] Figure 7 The data in clearly show that the above-mentioned RNA molecules allow monitoring the course of cancer in patients, in particular under therapeutic treatment / anti-cancer therapy (such as chemotherapy or immunochemotherapy) of cancer. Figure 7, the distribution of the above RNA molecules in lung cancer samples before and after anticancer therapy in patients is shown. The clinical assessment performed by the oncologist at the time of follow-up (after therapy) summarizes the development of the disease (since the last visit) as remission (disease improvement), stable disease (no change) and progression (disease worsening). The levels of the above RNA molecules reflect this assessment by: (i) significantly decreasing during remission, indicating that the patient's cancer is improving; (ii) significantly increasing during progression, indicating that the patient's cancer is worsening; and (iii) remaining constant (no significant difference) during stable disease, indicating that the patient's cancer is not progressing.

[0215] In a third aspect, the invention relates to an (in vitro) method for determining whether a patient is responsive to therapeutic treatment of cancer, the method comprising the steps of:

[0216] Determine the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0217] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0218] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0219] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0220] (v) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0221] Preferably, the patient is a patient to whom the following is administered, has been administered or has been administered at least once (1 time, 2 times or 3 times):

[0222] Medications for said therapeutic treatment, and / or

[0223] Another form of therapeutic treatment.

[0224] The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0225] Administration may be oral, nasal, rectal, parenteral or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous or intraperitoneal administration.

[0226] Further preferably, a blood sample is isolated from a patient after at least the first (e.g., first, second or third) administration of the drug and / or after at least the first (e.g., first, second or third) administration of another form of therapeutic treatment (different from the administration of the drug). Particularly preferably, a blood sample is isolated from a patient within a time period of between 2 weeks to 1 day after at least the first (e.g., first, second or third) administration of the drug and / or after at least the first (e.g., first, second or third) administration of another form of therapeutic treatment (different from the administration of the drug). Particularly more preferably, a blood sample is isolated from a patient within a time period of between 1 week to 1 day after at least the first (e.g., first, second or third) administration of the drug and / or after at least the first (e.g., first, second or third) administration of another form of therapeutic treatment (different from the administration of the drug). For example, a blood sample is isolated from the patient 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks after at least the first (e.g., first, second, or third) administration of the drug and / or after at least the first (e.g., first, second, or third) administration of another form of therapeutic treatment (other than the administration of the drug).

[0227] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in a specific embodiment, the present invention relates to an (in vitro) method for determining whether a patient has responded to a therapeutic treatment of cancer, the method comprising the following steps:

[0228] (i) determining the level of the RNA molecule in a blood sample from the patient, and

[0229] (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule,

[0230] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0231] Such comparisons allow evaluation of whether a treatment approach is effective for the patient.

[0232] A reference level may be any level that allows determining whether a therapeutic treatment is effective for a patient. It may be obtained from a (control) subject (i.e. a subject different from the patient to be tested, such as a subject with cancer / known to have cancer) or from the same individual.

[0233] In a preferred embodiment, the reference level is the level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having / known to have cancer.

[0234] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects having cancer / known to have cancer.

[0235] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a subject with cancer / known to have cancer and calculating its "average" value (such as mean, median or mode). Preferably, the reference blood sample is from the same source (such as blood cells, serum or plasma) as the blood sample separated from the patient to be tested. Further preferably, the reference level is obtained from a subject with cancer / known to have cancer of the same gender (such as women or men) and / or similar age / life stage (such as adults or the elderly) as the patient to be tested. In particular, the reference level represents the mean value of RNA molecules in a subject population with cancer / known to have cancer. More particularly, the colony includes a subject of a specific cancer stage (such as Phase I, Phase II, Phase III or Phase IV), or a subject (mixed population, particularly equally presented) of all cancer stages (such as Phase I, Phase II, Phase III or Phase IV).

[0236] In a more preferred embodiment,

[0237] A level of the RNA molecule below the reference level indicates that the patient is responding to the cancer treatment,

[0238] A level of the RNA molecule comparable to the reference level indicates that the patient has not responded to the cancer treatment, or

[0239] Levels of the RNA molecule above the reference level indicate that the patient is not responding to the cancer treatment.

[0240] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher / lower than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4, at least 2.5, at least 2.6, at least 2.7, at least 2.8, at least 2.9, or at least 3.0 times higher / lower than the reference level.

[0241] In the above context, "comparable" preferably means that the level changes between 0 and <20%, particularly between 0 and <10%, such as 0, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 19.9%, 19.99% or 19.999%. In this regard, "comparable" may also mean that the detected level changes within the accuracy range of the measurement. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0242] In an alternative or additional preferred embodiment, the reference level is a level determined in a reference blood sample isolated from the (same) patient prior to administration of:

[0243] The drug, and / or

[0244] Another form of therapeutic treatment.

[0245] The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0246] Particularly preferably, the reference blood sample is isolated from the (same) patient in a time period between immediately before the administration of the medicament and / or before the administration of another form of therapeutic treatment (other than the administration of the medicament) and 1 day before the administration of the medicament and / or before the administration of another form of therapeutic treatment (other than the administration of the medicament). Particularly more preferably, the reference blood sample is isolated from the (same) patient in a time period between immediately before the administration of the medicament and / or before the administration of another form of therapeutic treatment (other than the administration of the medicament) and 0.5 day before the administration of the medicament and / or before the administration of another form of therapeutic treatment (other than the administration of the medicament). For example, a reference blood sample is isolated from the (same) patient immediately prior to administration of the drug and / or prior to administration of another form of therapeutic treatment (other than administration of the drug), 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours or 1 day prior to administration of the drug and / or prior to administration of another form of therapeutic treatment (other than administration of the drug).

[0247] In a more preferred embodiment,

[0248] A level of the RNA molecule below the reference level indicates that the patient is responding to the cancer treatment,

[0249] A level of the RNA molecule comparable to the reference level indicates that the patient has not responded to the cancer treatment, or

[0250] Levels of the RNA molecule above the reference level indicate that the patient is not responding to the cancer treatment.

[0251] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher / lower than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4, at least 2.5, at least 2.6, at least 2.7, at least 2.8, at least 2.9, or at least 3.0 times higher / lower than the reference level.

[0252] In the above context, "comparable" preferably means that the level changes between 0 and <20%, particularly between 0 and <10%, such as 0, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 19.9%, 19.99% or 19.999%. In this regard, "comparable" may also mean that the detected level changes within the accuracy range of the measurement. The accuracy of the measurement depends on the measurement method used. Preferably, the level is constant over time.

[0253] If the therapeutic treatment includes the administration of a drug and the patient responds to the treatment, the administration of the drug can be continued. In particular, the dosage of the drug can be reduced and / or the interval between drug administrations can be extended. Alternatively, administration can be stopped. If the therapeutic treatment includes the administration of a drug and the patient does not respond to the treatment, the dosage of the drug can be increased, the interval between drug administrations can be shortened, and / or the drug can be changed. Alternatively, the mode of therapy can be changed, for example, from the administration of a drug to surgery, radiotherapy, laser therapy, and thermotherapy.

[0254] If the therapeutic treatment includes another therapeutic treatment in addition to the administration of a drug and the patient responds to the treatment, the therapeutic treatment can be continued, the number of treatments can be reduced, or the intensity of the therapeutic treatment can be reduced. If the therapeutic treatment includes another therapeutic treatment in addition to the administration of a drug and the patient does not respond to the treatment, the number of treatments can be increased and / or the intensity of the therapeutic treatment can be increased. Alternatively, the therapy mode can be changed.

[0255] Preferably, the drug is selected from the group consisting of an immunomodulator, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine and an antibody. As described above, the drug may also be a drug combination of at least two different medications. Thus, the patient may be a patient to whom a chemotherapeutic agent and an immunotherapeutic agent have been administered, have been administered or have been administered at least once.

[0256] More preferably,

[0257] (i) an immunomodulator selected from the group consisting of a checkpoint inhibitor, preferably a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, CTLA-4, or an intrinsic checkpoint blocker,

[0258] (ii) a chemotherapeutic agent selected from the group consisting of an alkylating agent, an antimetabolite, folinic acid, a folic acid antagonist, a mitotic inhibitor, an anthracycline, a topoisomerase inhibitor, a signal transduction inhibitor, an angiogenesis inhibitor and a histone deacetylase inhibitor, or

[0259] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0260] Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0261] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0262] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0263] Figure 7 The data in clearly show that the above RNA molecules allow determining whether a patient is responding to a therapeutic treatment / anti-cancer therapy for cancer. In particular, the therapeutic treatment / anti-cancer therapy is chemotherapy or immunochemotherapy. Figure 7 , the distribution of the above RNA molecules in lung cancer samples before and after anticancer therapy of the patient is shown. The clinical assessment performed by the oncologist at the time of follow-up (after therapy) summarizes the development of the disease (since the last visit) as remission (disease improvement), stable disease (no change) and progression (disease worsening). The level of the above RNA molecules reflects this assessment by: (i) significantly decreased during remission, indicating that the patient responded to the treatment of cancer; (ii) significantly increased during progression, indicating that the patient did not respond to cancer treatment; and (iii) remained constant (no significant difference) during stable disease, indicating that the patient did not respond to cancer treatment.

[0264] In a fourth aspect, the invention relates to an (in vitro) method for determining the risk of cancer recurrence in a patient, the method comprising the following steps:

[0265] Determine the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0266] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0267] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0268] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0269] (vi) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0270] Preferably, the patient has previously received therapeutic treatment for cancer. In particular, the patient is in remission (ie, has no symptoms or signs of the disease).

[0271] Further preferably, the treatment involves the administration of:

[0272] Medicines for cancer, and / or

[0273] Another form of therapeutic treatment of cancer.

[0274] The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0275] Administration may be oral, nasal, rectal, parenteral or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous or intraperitoneal administration.

[0276] It is also preferred to isolate a blood sample after therapeutic treatment of cancer.

[0277] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Therefore, in a specific embodiment, the present invention relates to an (in vitro) method for determining the risk of cancer recurrence in a patient, the method comprising the following steps:

[0278] (i) determining the level of RNA molecules in a blood sample from a patient (isolated following therapeutic treatment of cancer), and

[0279] (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule,

[0280] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0281] The above comparison allows an assessment of whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk for getting the disease again. Relapse occurs when cancer comes back after treatment. This can happen weeks, months, or even years after the primary cancer or original cancer was treated. It is impossible to know for sure whether cancer will come back. The chance of relapse depends on the type of primary cancer. Cancer comes back because small areas of cancer cells can remain in the body after treatment. Over time, these cells may multiply and grow large enough to cause symptoms or be found by tests.

[0282] The reference level may be any level that allows determining whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk of recurring the disease. It may be obtained from a (control) subject (i.e., a healthy subject or a subject different from the patient to be tested, such as a successfully treated cancer patient).

[0283] In a preferred embodiment, the reference level refers to the level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0284] Healthy subjects, and / or

[0285] Successfully treated cancer patients.

[0286] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or

[0287] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from successfully treated cancer patients.

[0288] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a successfully treated cancer patient) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample of the patient to be tested, which is separated. Further preferably, the reference level is obtained from a control subject (e.g., a healthy subject or a successfully treated cancer patient) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. The reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a population of successfully treated cancer patients. More particularly, the population of successfully treated cancer patients includes subjects of specific cancer stages (e.g., Phase I, Phase II, Phase III, or Phase IV), or subjects of all cancer stages (e.g., Phase I, Phase II, Phase III, or Phase IV) (mixed population, particularly equally presented).

[0289] In a more preferred embodiment, a level of the RNA molecule above a reference level indicates a risk of cancer recurrence in the patient.

[0290] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher than the reference level.

[0291] In an alternative or additional preferred embodiment, the reference level represents the lowest level of the RNA molecule achievable / reached in a patient by therapeutic treatment of cancer.

[0292] In a more preferred embodiment, a level of the RNA molecule above a reference level indicates a risk of cancer recurrence in the patient.

[0293] Preferably, the level of the RNA molecule is at least 0.6 or 0.7 times higher than the reference level, more preferably at least 0.8 or 0.9 times, even more preferably at least 1.2 or 1.5 times, and still more preferably at least 2.0 or 3.0 times. For example, the level of the RNA molecule is at least 0.6 times, at least 0.7 times, at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times higher than the reference level.

[0294] The above-mentioned “minimum level” may be a single value achievable / reached in a patient through therapeutic treatment of cancer, or may be an average of a plurality of values ​​achievable / reached in a patient during therapeutic treatment of cancer.

[0295] As already mentioned above, the reference level may be any level that allows determining whether a patient who is in remission (i.e., without symptoms or signs of the disease) is at risk of recurring the disease. It may be obtained from a (control) subject (i.e., a healthy subject or a subject different from the patient to be tested, such as a successfully treated cancer patient). It may also be obtained from the same individual.

[0296] Thus, in an alternative or additional embodiment, the determining comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point after therapeutic treatment of the cancer and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points. Thus, in a specific embodiment, the invention relates to an (in vitro) method for determining the risk of cancer recurrence in a patient, the method comprising the following steps:

[0297] (i) determining the level of an RNA molecule in a blood sample obtained from a patient at a first time point after therapeutic treatment for cancer and the level of the RNA molecule in at least one further blood sample obtained from (the same) patient at a later time point, and

[0298] (ii) comparing said levels determined at different time points,

[0299] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0300] The above comparison allows an assessment of whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk for getting the disease again. Relapse occurs when cancer shows up again after treatment. This can happen weeks, months, or even years after the primary cancer or original cancer was treated. It is impossible to know for sure whether cancer will come back. The chance of relapse depends on the type of primary cancer. Cancer comes back because small areas of cancer cells can remain in the body after treatment. Over time, these cells may multiply and grow large enough to cause symptoms or be detected by tests.

[0301] In a preferred embodiment, increasing levels of an RNA molecule over time indicate a patient's risk of cancer recurrence.

[0302] Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and still even more preferably at least 2.0-fold or 3.0-fold over time.

[0303] For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0304] The time period between the first time point and the later time point preferably totals at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (one week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, individuals may be examined routinely, e.g., once or twice a year. Patients may be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9 or 10 time points (the first time point and the additional time points).

[0305] Preferably, the drug is selected from the group consisting of an immunomodulator, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine and an antibody. As described above, the drug may also be a drug combination of at least two different medications. Thus, the patient may be a patient to whom a chemotherapeutic agent and an immunotherapeutic agent have been administered, have been administered or have been administered at least once.

[0306] More preferably,

[0307] (i) an immunomodulator selected from the group consisting of a checkpoint inhibitor, preferably a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, CTLA-4, or an intrinsic checkpoint blocker,

[0308] (ii) a chemotherapeutic agent selected from the group consisting of an alkylating agent, an antimetabolite, folinic acid, a folic acid antagonist, a mitotic inhibitor, an anthracycline, a topoisomerase inhibitor, a signal transduction inhibitor, an angiogenesis inhibitor and a histone deacetylase inhibitor, or

[0309] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0310] Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0311] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0312] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0313] In a fifth aspect, the invention relates to an (in vitro) method for detecting minimal residual disease (MRD) in a patient having cancer, the method comprising the following steps:

[0314] Determine the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0315] Specifically, the levels of RNA molecules are determined in a blood sample, said RNA molecules comprising:

[0316] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0317] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0318] (vii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0319] Preferably, the patient is receiving, has received, or has received therapeutic treatment for cancer.

[0320] Further preferably, the treatment involves or involved the administration of:

[0321] Drugs for cancer, and / or

[0322] Another form of therapeutic treatment of cancer.

[0323] The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The combined administration of a chemotherapeutic agent and an immunotherapeutic agent may be designated as immunochemotherapy.

[0324] Administration may be oral, nasal, rectal, parenteral or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous or intraperitoneal administration.

[0325] It is also preferred to isolate a blood sample during or after therapeutic treatment of cancer.

[0326] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Therefore, in a specific embodiment, the present invention relates to an (in vitro) method for detecting minimal residual disease (MRD) in a patient with cancer, the method comprising the following steps:

[0327] (i) determining the level of an RNA molecule in a blood sample from a patient (isolated during or after therapeutic treatment of cancer), and

[0328] (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule,

[0329] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0330] Such comparisons allow for the evaluation of whether there are microscopic cancers left in a patient. In particular, the detection of minimal residual disease in a patient indicates that small amounts of cancer cells remain in the patient's body during or after treatment while the patient is in remission (no symptoms or signs of the disease). This is the leading cause of cancer recurrence. MRD testing has several important roles in cancer treatment: determining whether treatment has eradicated the cancer or whether there are residual traces, comparing the effectiveness of different treatments, monitoring a patient's remission status and detecting the recurrence of cancer, and selecting the treatment that best meets these needs.

[0331] The reference level may be any level that allows determining whether a patient suffers from minimal residual disease. It may be obtained from a (control) subject (i.e. a healthy subject or a subject different from the patient to be tested, such as a successfully treated cancer patient).

[0332] In a preferred embodiment, the reference level refers to the level of an RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0333] Healthy subjects, and / or

[0334] Successfully treated cancer patients.

[0335] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or

[0336] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from successfully treated cancer patients.

[0337] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a successfully treated cancer patient) and calculating its "average" value (e.g., mean, median, or mode). Preferably, the reference blood sample is from the same source (e.g., blood cells, serum, or plasma) as the blood sample of the patient to be tested, which is separated. Further preferably, the reference level is obtained from a control subject (e.g., a healthy subject or a successfully treated cancer patient) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. The reference level represents the mean value of RNA molecules in a healthy population and / or the reference level represents the mean value of RNA molecules in a population of successfully treated cancer patients. More particularly, the population of successfully treated cancer patients includes subjects of specific cancer stages (e.g., Phase I, Phase II, Phase III, or Phase IV), or subjects of all cancer stages (e.g., Phase I, Phase II, Phase III, or Phase IV) (mixed population, particularly equally presented).

[0338] In a more preferred embodiment, a level of the RNA molecule above the reference level indicates that the patient has minimal residual disease.

[0339] Preferably, patients with minimal residual disease are assigned / eligible for adjuvant therapy. More preferably, patients assigned / eligible for adjuvant therapy are subsequently treated with said cancer therapy.

[0340] In an alternative or additional embodiment, the determining comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point before therapeutic treatment of the cancer and the level of the RNA molecule in at least one further blood sample obtained from the (same) patient at a later time point after the therapeutic treatment, and comparing the levels determined at the different time points. Thus, in a specific embodiment, the present invention relates to an (in vitro) method for detecting minimal residual disease (MRD) in a patient with cancer, the method comprising the following steps:

[0341] (i) determining the level of an RNA molecule in a blood sample obtained from a patient at a first time point before therapeutic treatment for cancer and the level of the RNA molecule in at least one further blood sample obtained from (the same) patient at a later time point after therapeutic treatment, and

[0342] (ii) comparing said levels determined at different time points,

[0343] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0344] In a preferred embodiment, an RNA molecule level that is stable over time or does not decrease over time until / below a threshold level (representing the lowest level of RNA molecules that can be achieved by therapeutic treatment of cancer) indicates that the patient has minimal residual disease. The threshold level preferably represents the lowest level of RNA molecules that can be achieved by therapeutic treatment of cancer.

[0345] Preferably, patients with minimal residual disease are assigned / eligible for adjuvant therapy. More preferably, patients assigned / eligible for adjuvant therapy are subsequently treated with said cancer therapy.

[0346] The time period between the first time point and the later time point preferably totals at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (one week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, individuals may be examined routinely, e.g., once or twice a year. Patients may be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9 or 10 time points (the first time point and the additional time points).

[0347] Preferably, the drug is selected from the group consisting of an immunomodulator, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine and an antibody. As described above, the drug may also be a drug combination of at least two different medications. Thus, the patient may be a patient to whom a chemotherapeutic agent and an immunotherapeutic agent have been administered, have been administered or have been administered at least once.

[0348] More preferably,

[0349] (i) an immunomodulator selected from the group consisting of a checkpoint inhibitor, preferably a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, CTLA-4, or an intrinsic checkpoint blocker,

[0350] (ii) a chemotherapeutic agent selected from the group consisting of an alkylating agent, an antimetabolite, folinic acid, a folic acid antagonist, a mitotic inhibitor, an anthracycline, a topoisomerase inhibitor, a signal transduction inhibitor, an angiogenesis inhibitor and a histone deacetylase inhibitor, or

[0351] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0352] Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0353] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0354] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0355] Figure 6 Shown is a reduction of the above RNA molecules after lung cancer surgery (depending on the stage). Therefore, the above RNA molecule levels are tumor-related. Therefore, the determination of the above RNA molecule levels allows the assessment of micro-residual lesions in patients with cancer, for example, after surgery, possibly as a treatment control.

[0356] In the methods of the first to fifth aspects, the patient is preferably a mammal, more preferably a human or a rodent, even more preferably a human.

[0357] In the methods of the first to fifth aspects, the blood sample is preferably whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. The blood cell fraction may include red blood cells, white blood cells and / or platelets. Even more preferably, the blood cell fraction is a white blood cell fraction, or the blood cell fraction is a mixture of red blood cells, white blood cells and platelets.

[0358] In the methods of the first to fifth aspects, the level of the RNA molecule is preferably determined by sequencing, preferably next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyze, Roche 454GS FL, BGISEQ), nucleic acid hybridization (e.g. microarray or microbeads), nucleic acid amplification (e.g. PCR, RT-PCR, qRT-PCR or high throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g. LUMINEX) or any combination thereof. Specifically, the level of the RNA molecule is the expression level of the RNA molecule.

[0359] In a sixth aspect, the present invention relates to the (in vitro) use of an RNA molecule for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment of cancer, determining the risk of cancer recurrence in a patient and / or detecting minimal residual disease (MRD) in a patient with cancer,

[0360] wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0361] For the above uses, the levels of RNA molecules are determined / analyzed in a blood sample from a patient.

[0362] Preferably, the blood sample is whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. The blood cell component may include red blood cells, white blood cells and / or platelets. Even more preferably, the blood cell fraction is a fraction of white blood cells, or the blood cell fraction is a mixture of red blood cells, white blood cells and platelets.

[0363] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0364] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0365] As for other preferred embodiments, see the first to fourth aspects of the present invention.

[0366] In a seventh aspect, the invention provides a kit (the (in vitro) use of) for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment of cancer, determining the risk of cancer recurrence in a patient and / or detecting minimal residual disease (MRD) in a patient with cancer, wherein the kit comprises:

[0367] Means for determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g. at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity thereto.

[0368] Specifically, the kit comprises means for determining the level of an RNA molecule comprising:

[0369] (i) the nucleotide sequence according to SEQ ID NO: 1,

[0370] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) nucleotides shorter than the nucleotide sequence according to (i), or

[0371] (viii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii).

[0372] More specifically, the kit comprises

[0373] Tools for performing next generation sequencing (NGS),

[0374] at least one polynucleotide (probe) for detecting said RNA molecule,

[0375] at least one primer (e.g., a primer pair) for binding to the RNA molecule, and / or

[0376] At least one antibody capable of binding to the hybrid of said at least one polynucleotide (probe) and said RNA molecule.

[0377] The at least one polynucleotide (probe) can be a part of a microarray / biochip, or can be attached to a bead of a bead-based multiplex system. The at least one polynucleotide (primer, primer pair) can be a part of a RT-PCR system, a PCR system, or a next generation sequencing system.

[0378] The tools may further include a microarray, a RT-PCR system, a PCR system, a flow cytometer, a Luminex system, and / or a next generation sequencing system.

[0379] In a preferred embodiment, the kit comprises instructions on how to carry out the methods according to the first to fifth aspects of the present invention.

[0380] In another preferred embodiment, the kit is useful for performing the methods according to the first to fifth aspects of the present invention.

[0381] The kit may further comprise

[0382] container, and / or

[0383] Data carrier.

[0384] The data carrier may be a non-electronic data carrier, such as a graphic data carrier (e.g., an information brochure, an information sheet, a bar code, or an access code), or an electronic data carrier, such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip, or another semiconductor-based electronic data carrier. The access code may allow access to a database (e.g., an Internet database, a centralized database, or a decentralized database). The access code may also provide access to application software that enables a computer to perform tasks for a computer user, or to a mobile application, which is software designed to run on smartphones and other mobile devices.

[0385] The data carrier may further comprise at least one reference, e.g., a reference level or threshold level of the level of the RNA molecule determined herein. Where the data carrier comprises an access code allowing access to a database, the at least one reference (e.g., the reference level or threshold level) may be stored in the database.

[0386] The data carrier may also comprise information or instructions on how to carry out the method according to the first to fifth aspects of the invention.

[0387] The kit may further include materials desirable from a commercial and user perspective, including buffers, reagents and / or diluents for determining the above-mentioned levels.

[0388] Preferably, the blood sample is whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum. The blood cell component may include red blood cells, white blood cells and / or platelets. Even more preferably, the blood cell fraction is a fraction of white blood cells, or the blood cell fraction is a mixture of red blood cells, white blood cells and platelets.

[0389] Examples of cancer include, but are not limited to, lung cancer (preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), breast cancer, cervical cancer, stomach cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain cancer, lymphoma, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0390] Preferably, the cancer is selected from the group consisting of lung cancer (such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS)), bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), or small cell lung cancer (SCLS). Still more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0391] Finally it should be noted that in addition to or instead of the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 1, the level of RNA molecules comprising the nucleotide sequence according to SEQ ID NO: 2 may also be determined in all aspects of the invention. As mentioned above, the nucleotide sequence according to SEQ ID NO: 2 is a variant of the nucleotide sequence according to SEQ ID NO: 1. In particular, the nucleotide sequence according to SEQ ID NO: 2 is 1 nucleotide longer than the nucleotide sequence according to SEQ ID NO: 1.

[0392] Most preferably, the cancer in the first to seventh aspects of the present invention is lung cancer. In this aspect, the present invention relates to:

[0393] 1. A method for diagnosing lung cancer in a patient, the method comprising the following steps:

[0394] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0395] 2. The method according to claim 1, wherein the level of the RNA molecule is compared with a reference level of the RNA molecule.

[0396] 3. The method according to item 2, wherein the reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0397] Healthy subjects, and / or

[0398] A subject having lung cancer.

[0399] 4. The method according to item 3, wherein:

[0400] The reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from healthy subjects, and wherein a level of the RNA molecule above the reference level indicates that the patient has lung cancer, and / or

[0401] The reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having lung cancer, and wherein a level of the RNA molecule comparable to the reference level indicates that the patient has lung cancer.

[0402] 5. A method for monitoring the course of lung cancer in a patient, the method comprising the following steps:

[0403] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0404] 6. The method according to item 5, wherein the level of the RNA molecule is compared with a reference level of the RNA molecule.

[0405] 7. The method according to item 6, wherein the reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from:

[0406] Healthy subjects, and / or

[0407] A subject having lung cancer.

[0408] 8. A method according to any one of items 5-7, wherein the monitoring comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

[0409] 9. The method according to item 8, wherein:

[0410] (i) the level of the RNA molecule increasing over time indicates that the patient has developed lung cancer or that lung cancer is worsening in the patient,

[0411] (ii) the level of the RNA molecule not changing over time indicates that the patient is stable or that the lung cancer is not progressing in the patient, or

[0412] (iii) a level of the RNA molecule that decreases over time indicates that the lung cancer in the patient is improving.

[0413] 10. The method according to item 9, wherein:

[0414] (i) the patient is healthy at the first time point, and the level increasing over time indicates that the patient has developed lung cancer,

[0415] (ii) the patient had lung cancer at the first time point, and the level increasing over time indicates that the lung cancer is worsening in the patient,

[0416] (iii) the patient had lung cancer at the first time point, and the level not changing over time indicates that the lung cancer is not progressing in the patient, or

[0417] (iv) the patient had lung cancer at the first time point, and the levels decreasing over time indicate that lung cancer is improving in the patient.

[0418] 11. A method according to any one of items 5-10, wherein the patient receives, has received or has received therapeutic treatment for lung cancer.

[0419] 12. The method according to item 11, wherein the therapeutic treatment of lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof.

[0420] 13. The method according to item 11 or 12, wherein

[0421] (i) the patient receives, has received or has received therapeutic treatment for lung cancer and a decrease in said level over time indicates that the patient is responding to said treatment, or

[0422] (ii) the patient receives, has received or has received therapeutic treatment for lung cancer and said level increasing over time indicates that the patient has not responded to said treatment.

[0423] 14. A method of determining whether a patient has responded to therapeutic treatment for lung cancer, the method comprising the steps of:

[0424] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0425] 15. The method according to item 14, wherein the patient is a patient to whom the following is administered, has been administered or has been administered at least once:

[0426] Medications for said therapeutic treatment, and / or

[0427] Another form of therapeutic treatment.

[0428] 16. A method according to item 15, wherein the blood sample is isolated from the patient after at least the first administration of the drug and / or another form of therapeutic treatment.

[0429] 17. A method according to any one of items 14-16, wherein the level of the RNA molecule is compared with a reference level of the RNA molecule.

[0430] 18. The method according to item 17, wherein the reference level is the level of the RNA molecule determined empirically by measuring multiple reference blood samples from subjects with lung cancer.

[0431] 19. The method according to item 17 or 18, wherein the reference level is a level determined in a reference blood sample isolated from the (same) patient prior to administration of

[0432] The drug, and / or

[0433] Another form of therapeutic treatment.

[0434] 20. The method according to any one of items 17 to 19, wherein:

[0435] a level of the RNA molecule below the reference level indicates that the patient is responsive to the treatment for lung cancer,

[0436] a level of the RNA molecule comparable to the reference level indicates that the patient has not responded to the treatment for lung cancer, or

[0437] A level of the RNA molecule above the reference level indicates that the patient has not responded to the treatment for lung cancer.

[0438] 21. The method according to any one of items 15-20, wherein the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

[0439] 22. The method according to item 21, wherein:

[0440] (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers,

[0441] (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or

[0442] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0443] 23. The method according to any one of items 15-22, wherein the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0444] 24. A method of determining the risk of recurrence of lung cancer in a patient, the method comprising the steps of:

[0445] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0446] 25. The method according to item 24, wherein the patient has received therapeutic treatment for lung cancer.

[0447] 26. The method according to item 25, wherein the treatment comprises applying:

[0448] Medicines for lung cancer, and / or

[0449] Another form of therapeutic treatment for lung cancer.

[0450] 27. The method according to any one of items 24-26, wherein the blood sample is isolated after the therapeutic treatment of lung cancer.

[0451] 28. A method according to any one of items 24-27, wherein the level of the RNA molecule is compared with a reference level of the RNA molecule.

[0452] 29. The method according to item 28, wherein the reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from

[0453] Healthy subjects, and / or

[0454] Successfully treated lung cancer patient.

[0455] 30. The method according to item 29, wherein the level of the RNA molecule above the reference level indicates the risk of lung cancer recurrence in the patient.

[0456] 31. A method according to any one of items 28-30, wherein the reference level represents the lowest level of the RNA molecule that can be achieved in the patient by therapeutic treatment of lung cancer.

[0457] 32. The method of claim 31, wherein the level of the RNA molecule above the reference level indicates a risk of lung cancer recurrence in the patient.

[0458] 33. A method according to any one of items 24-32, wherein the determination comprises determining the level of the RNA molecule in a blood sample obtained from a patient at a first time point after therapeutic treatment of lung cancer and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

[0459] 34. The method according to item 33, wherein the level of the RNA molecule that increases over time indicates the risk of lung cancer recurrence in the patient.

[0460] 35. The method according to any one of items 26-34, wherein the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

[0461] 36. The method according to item 35, wherein:

[0462] (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers,

[0463] (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or

[0464] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0465] 37. The method according to any one of items 26-36, wherein the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0466] 38. A method for detecting minimal residual disease in a patient with lung cancer, the method comprising the steps of:

[0467] Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0468] 39. The method according to item 38, wherein the patient receives, has received or has received therapeutic treatment for lung cancer.

[0469] 40. The method according to item 39, wherein the treatment includes or included the administration of a drug directed against lung cancer, and / or

[0470] Another form of therapeutic treatment for lung cancer.

[0471] 41. A method according to any one of items 38-40, wherein the level of the RNA molecule is compared with a reference level of the RNA molecule.

[0472] 42. The method according to item 41, wherein the reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from

[0473] Healthy subjects, and / or

[0474] Successfully treated lung cancer patient.

[0475] 43. A method according to item 42, wherein the level of the RNA molecule above the reference level indicates that the patient has minimal residual disease.

[0476] 44. The method of claim 43, wherein patients with minimal residual disease are assigned to / eligible for adjuvant therapy.

[0477] 45. A method according to any one of items 38-44, wherein the determination comprises determining the level of the RNA molecule in a blood sample obtained from a patient at a first time point before therapeutic treatment of lung cancer and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point after the therapeutic treatment, and comparing the levels determined at different time points.

[0478] 46. ​​A method according to item 45, wherein the level of the RNA molecule that is stable over time or does not decrease over time to / below a threshold level (representing the lowest level of the RNA molecule that can be achieved by therapeutic treatment of lung cancer) indicates that the patient has minimal residual disease.

[0479] 47. The method of claim 46, wherein patients with minimal residual disease are assigned to / eligible for adjuvant therapy.

[0480] 48. The method according to any one of items 40-47, wherein the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

[0481] 49. The method according to item 48, wherein:

[0482] (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers,

[0483] (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or

[0484] (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

[0485] 50. The method according to any one of items 40-49, wherein the other form of therapeutic treatment is selected from the group consisting of surgery, radiotherapy, laser therapy and thermotherapy.

[0486] 51. A method according to any one of items 1-50, wherein the lung cancer is non-small cell lung cancer (NSCLC).

[0487] 52. A method according to any one of items 1-51, wherein the patient is a mammal, preferably a human or a rodent.

[0488] 53. A method according to any one of items 1-52, wherein the level of the RNA molecule is determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, flow cytometry or any combination thereof.

[0489] 54. The method according to any one of items 1-53, wherein the level of the RNA molecule is the expression level of the RNA molecule.

[0490] 55. The method according to any one of items 1-54, wherein the blood sample is whole blood or a blood fraction.

[0491] 56. The method according to item 55, wherein the blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum.

[0492] 57. The method according to item 56, wherein the blood cell fraction is a fraction of white blood cells or a mixture of red blood cells, white blood cells and platelets.

[0493] 58. Use of an RNA molecule for diagnosing lung cancer in a patient, monitoring the course of lung cancer in a patient, determining whether a patient has responded to therapeutic treatment for lung cancer, determining the risk of lung cancer recurrence in a patient, and / or detecting minimal residual disease in a patient with lung cancer,

[0494] Wherein, the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity therewith.

[0495] 59. A kit for diagnosing lung cancer in a patient, monitoring the course of lung cancer in a patient, determining whether a patient has responded to therapeutic treatment for lung cancer, determining the risk of lung cancer recurrence in a patient, and / or detecting minimal residual disease in a patient with lung cancer, wherein the kit comprises:

[0496] Means for determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0497] 60. The kit according to item 59, wherein the kit further comprises instructions on how to carry out the method according to any one of items 1-57.

[0498] 61. The kit according to any one of items 59 or 60, wherein the kit is useful for performing the method according to any one of items 1-57.

[0499] Various modifications and variations of the present invention will be apparent to those skilled in the art without departing from the scope of the present invention. Although the present invention has been described in conjunction with specific preferred embodiments, it should be understood that the present invention as claimed should not be overly limited to such specific embodiments. In fact, the present invention is intended to cover various modifications of the described modes for implementing the present invention, which modifications are apparent to those skilled in the relevant art. BRIEF DESCRIPTION OF THE DRAWINGS

[0500] The following drawings are merely illustrative of the present invention and are not to be construed in any way to limit the scope of the present invention as indicated by the appended claims.

[0501] Figure 1: Box plots showing log2(1+RPM) expression for each tumor stage. In a clinical trial on lung cancer patients, the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) was expressed more highly with increasing tumor stage.

[0502] Figure 2 : The log2(1+RPM) expression histograms of the control and CaseLC groups were plotted as smooth curves using Gaussian kernel density estimation. When all lung cancer patients (CaseLC) were grouped, the log2-RPM expression histogram showed a significant increase compared to the control group.

[0503] Figure 3 : For features with non-zero model coefficients, Cohen's d effect size (diagnostic) relative to the logistic regression model coefficient.

[0504] Figure 4 : DESeq2 adjusted p-values ​​relative to the log2 fold difference (diagnostic) for features with non-zero model coefficients.

[0505] Figure 5 : Performance of a binary classification (diagnosis) model on a held-out test set. Performance is given as the area under the ROC curve (AUC).

[0506] Figure 6 : shows the reduction of 28S ribosomal RNA (rRNA) fragments after surgery (depending on the stage).

[0507] Figure 7:The expression distribution of 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in lung cancer clinical samples before and after anticancer therapy is shown in box plots. The clinical evaluation performed by oncologists during follow-up (after therapy) summarizes the development of the disease (since the last visit) as remission (disease improvement), stable disease (no change) and progression (disease worsening). The expression of 28S ribosomal RNA (rRNA) fragments reflects this evaluation by: significantly decreasing during remission, significantly increasing during progression, and remaining constant during stable disease (no significant difference). The statistical quantification of this difference is obtained by paired T test of bilateral opposing hypotheses (expression after treatment and before treatment has changed). The P value and Cohen's d symbol effect size (symbol indicates change direction) and sample size N for each test are given. P values ​​were categorized by significance (lower P values ​​indicate higher significance), using the following convention: ns (not significant): P>0.05; *: p≤0.05; **: p≤0.01; ***: p≤0.001; ****: p≤0.0001. Results are given for (a) all combinations of treatment types, (b) only cases where chemotherapy was given, possibly in combination with other therapies, and (c) only cases where immunochemotherapy was given, possibly in combination with other therapies.

[0508] Example

[0509] The following examples are given for illustrative purposes only and are not intended to limit the invention described above in any way.

[0510] The inventors can demonstrate that determining the level of the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in a patient's blood sample allows for diagnosis and monitoring of lung cancer. The inventors can also demonstrate that determining the level of the 28S ribosomal RNA (rRNA) fragment in a patient's blood sample allows for the assessment of the success of anti-lung cancer therapy. Specifically, the inventors can demonstrate that determining the level of the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in a blood sample allows for the assessment of whether a patient is in remission after anti-lung cancer therapy, whether the patient is stable (lung cancer has not improved or worsened), or whether lung cancer has further progressed in the patient (lung cancer has worsened).

[0511] 1. Experiment

[0512] Materials and methods

[0513] A small RNA next-generation sequencing (NGS) dataset of 1427 patients was used, excluding only those patients with unclear diagnosis or low QC indicators (based on in-house spike-ins and total read counts). Of the more than 1.8M unique RNA sequences detected in this dataset, 18,312 sequences remained after removing sequences with a maximum log2(1+RPM) expression below 10, where RPM stands for reads per million.

[0514] These patients were first balanced for diagnosis in each of the two clinics (by under-sampling the majority arrays) to avoid any batch effects due to potential differences between clinics. The resulting balanced dataset thus had equal counts in the Control (non-neoplastic lung disease) and CaseLC (lung cancer) groups.

[0515] A uniformly sampled test set of 25% of the patients was removed, and the remaining 75% of the patients were used to train a logistic regression classifier model. The training samples were further reduced to the 10,000 most variable sequences (features) in each NGS-pooling group, thereby reducing the impact of major batch variables. In addition, any sequence detected in less than 20% of the training samples was removed. The remaining 9,132 features were standard scaled and used as input to an L1 penalized logistic regression model with a penalty of 20.

[0516] After fitting the model coefficients to distinguish between control and CaseLC samples, only 78 features remained with non-zero coefficients. These coefficients correlated well with Cohen's d effect size (r = 0.59; see Figure 3 ). DESeq2 is a standard software tool for calculating significantly differentially expressed proteins from RNA-seq data. Figure 4 Adjusted p values ​​and log2 fold differences between the control and CaseLC groups are given.

[0517] result

[0518] Among all Cohen's d, model coefficients, and adjusted p-values ​​of DESeq2, the strongest outlier was the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1).

[0519] In a clinical trial of lung cancer patients with non-tumor lung disease patients as controls, it was found that the expression of this RNA molecule was higher with increasing tumor stage (see Figure 1). When all lung cancer patients (CaseLC) were grouped, the log2-RPM expression histogram showed a significant increase compared with the control group (see Figure 2 ).

[0520] On the entire test set, the AUC is 0.67 and is therefore much higher than the AUC of 0.46 when the diagnostic labels are shuffled (indicating no better performance than random guessing) (see Figure 5 ).

[0521] The exact number of patients used for training and testing (listed per stage) is given in Table 1 below:

[0522] #patient Training set Test Set Comparison 494 189 Stage I cancer 100 36 Stage II cancer 66 13 Stage III cancer 161 49 Stage IV cancer 204 54

[0523] Table 1: Number of patients used as controls or cases in each training and test set (by tumor stage).

[0524] Figure 6 Further shown is the reduction of 28S ribosomal RNA (rRNA) fragments after lung cancer surgery (depending on the stage). Therefore, the level of 28S ribosomal RNA (rRNA) fragments is tumor-related. The determination of 28S ribosomal RNA (rRNA) fragment levels can also be used to determine the micro-residual lesions in patients with lung cancer, such as after surgery, possibly as a treatment control.

[0525] 2. Experiment

[0526] Materials and methods

[0527] For the subset of lung cancer patients described in Experiment 1 above, follow-up visits were accompanied by blood draws to monitor their response to various anticancer treatments deemed appropriate by their oncologists. These follow-up samples were processed in the same manner as the baseline samples (see above). Multiple follow-up visits were possible for each patient.

[0528] Consecutive visits of patients were paired, independent of the number of previous visits. These paired visits were then classified as "progression", "stable disease" or "progression" based on the oncologist's assessment. For each patient visit, the expression of RNA (SEQ ID NO: 1) was obtained in the form of log2(1+RPM). A paired T-test was performed on the expression values ​​within each category, and the two-sided alternative hypothesis was stated as follows: "In each pair of visits, there is a significant difference in expression between the first visit and the second visit". Cohen's d effect size and T-test for paired samples were calculated using the pingouin statistical package (https: / / pingouin-stats.org).

[0529]

[0530] Table 2: Count of patients at consecutive visits, including the first visit (baseline, BL) and numbered follow-up visits (F-…). For example, "BL_F-01" is the interval between the pre-treatment visit (BL) and the first follow-up visit (F-01), during which anticancer therapy was received. The numbers indicate the order of the visits, but the duration between visits is variable.

[0531] result

[0532] The expression distribution of the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in lung cancer clinical samples before and after anticancer therapy was further evaluated. Figure 7 The clinical assessment performed by the oncologist at follow-up (after treatment) summarized the development of the disease (since the last visit) as remission (disease improvement), stable disease (no change), and progression (disease worsening). The expression of 28S ribosomal RNA (rRNA) fragments reflected this assessment by a significant decrease during remission, a significant increase during progression, and a constant (no significant difference) during stable disease. Statistical quantification of this difference was obtained by paired T-tests for the two-sided alternative hypothesis (change in expression after treatment compared with before treatment). The P value and Cohen's d signed effect size (sign indicates the direction of change) are given for each test, as well as the sample size N. P values ​​are categorized by significance (lower P values ​​indicate higher significance), using the following convention: ns (not significant): P>0.05; *: p≤0.05; **: p≤0.01; ***: p≤0.001; ****: p≤0.0001. The results are presented for (a) all treatment types combined, (b) only cases where chemotherapy was given, possibly in combination with other therapies, and (c) only cases where immunochemotherapy was given, possibly in combination with other therapies. In this regard, it should be noted that the box plots for all treatment types combined include data for patients after chemotherapy, radiotherapy, immunotherapy, immunochemotherapy, surgery, targeted therapy, or no therapy (“wait and see” category).

Claims

1. A method for diagnosing cancer in a patient, the method comprising the steps of: Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

2. The method according to claim 1, wherein: The level of the RNA molecule is compared to a reference level of the RNA molecule.

3. The method according to claim 2, wherein: The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from: Healthy subjects, and / or A subject having cancer.

4. The method according to claim 3, wherein: The reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from healthy subjects, and wherein a level of the RNA molecule above the reference level indicates that the patient has cancer, and / or The reference level is a level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having cancer, and wherein a level of the RNA molecule comparable to the reference level indicates that the patient has cancer.

5. A method for monitoring the course of cancer in a patient, the method comprising the following steps: Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

6. The method according to claim 5, wherein: The level of the RNA molecule is compared to a reference level of the RNA molecule.

7. The method according to claim 6, wherein: The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from: Healthy subjects, and / or A subject having cancer.

8. The method according to any one of claims 5 to 7, wherein: The monitoring comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

9. The method according to claim 8, wherein: (i) an increase in the level of the RNA molecule over time indicates that the patient has developed cancer or that cancer is worsening in the patient, (ii) the level of the RNA molecule not changing over time indicates that the patient is stable or that the cancer is not progressing in the patient, or (iii) a decrease in the level of the RNA molecule over time indicates that the cancer is improving in the patient.

10. The method according to claim 9, wherein: (i) the patient is healthy at the first time point, and the level increasing over time indicates that the patient has developed cancer, (ii) the patient had cancer at the first time point, and the level increasing over time indicates that the cancer is worsening in the patient, (iii) the patient had cancer at the first time point, and the level not changing over time indicates that the cancer is not progressing in the patient, or (iv) the patient had cancer at the first time point, and the levels decreasing over time indicate that cancer is improving in the patient.

11. The method according to any one of claims 5 to 10, wherein: The patient receives, has received or has received therapeutic treatment for cancer.

12. The method according to claim 11, wherein: The therapeutic treatment of cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiotherapy, laser therapy, thermotherapy and administration of drugs, or a combination thereof.

13. The method according to claim 11 or 12, wherein (i) the patient is receiving, has received or has received therapeutic treatment for cancer and a decrease in said level over time indicates that the patient is responding to said treatment, or (ii) the patient receives, has received or has received therapeutic treatment for cancer and said levels increasing over time indicate that the patient is not responding to said treatment.

14. A method of determining whether a patient has responded to therapeutic treatment of cancer, the method comprising the steps of: Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

15. The method according to claim 14, wherein: The patient is a patient to whom the following is administered, has been administered, or has been administered at least once: Medications for said therapeutic treatment, and / or Another form of therapeutic treatment.

16. The method according to claim 15, wherein: The blood sample is isolated from the patient after at least the first administration of the medicament and / or another form of therapeutic treatment.

17. The method according to any one of claims 14 to 16, wherein: The level of the RNA molecule is compared to a reference level of the RNA molecule.

18. The method according to claim 17, wherein: The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from subjects having cancer.

19. The method according to claim 17 or 18, wherein: The reference level is the level determined in a reference blood sample isolated from the (same) patient prior to administration of the drug, and / or Another form of therapeutic treatment.

20. The method according to any one of claims 17 to 19, wherein: a level of said RNA molecule below said reference level indicates that said patient is responding to said treatment for cancer, a level of the RNA molecule comparable to the reference level indicates that the patient has not responded to the treatment for cancer, or A level of the RNA molecule above the reference level indicates that the patient has not responded to the treatment for cancer.

21. The method according to any one of claims 15 to 20, wherein: The drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

22. The method according to claim 21, wherein: (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers, (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

23. The method according to any one of claims 15 to 22, wherein: Said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy and thermotherapy.

24. A method of determining the risk of cancer recurrence in a patient, the method comprising the steps of: Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

25. The method according to claim 24, wherein: The patient has received therapeutic treatment for cancer.

26. The method according to claim 25, wherein: The treatment comprises the administration of: Medicines for cancer, and / or Another form of therapeutic treatment of cancer.

27. The method according to any one of claims 24 to 26, wherein: Said blood sample is isolated after said therapeutic treatment of cancer.

28. The method according to any one of claims 24 to 27, wherein: The level of the RNA molecule is compared to a reference level of the RNA molecule.

29. The method according to claim 28, wherein: The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from: Healthy subjects, and / or Successfully treated cancer patients.

30. The method of claim 29, wherein: A level of the RNA molecule above the reference level is indicative of a risk of cancer recurrence in the patient.

31. The method according to any one of claims 28 to 30, wherein: The reference level represents the lowest level of the RNA molecule that can be achieved in the patient by therapeutic treatment of cancer.

32. The method according to claim 31, wherein: A level of the RNA molecule above the reference level is indicative of a risk of cancer recurrence in the patient.

33. The method according to any one of claims 24 to 32, wherein: The determination comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point after therapeutic treatment of cancer and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at different time points.

34. The method of claim 33, wherein: Increasing levels of the RNA molecule over time are indicative of the patient's risk of cancer recurrence.

35. The method according to any one of claims 26 to 34, wherein: The drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

36. The method of claim 35, wherein: (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers, (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

37. The method according to any one of claims 26 to 36, wherein: Said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy and thermotherapy.

38. A method for detecting minimal residual disease in a patient having cancer, the method comprising the steps of: Determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

39. The method of claim 38, wherein: The patient receives, has received or has received therapeutic treatment for cancer.

40. The method of claim 39, wherein: The treatment includes or included the administration of: Medicines for cancer, and / or Another form of therapeutic treatment of cancer.

41. The method according to any one of claims 38 to 40, wherein: The level of the RNA molecule is compared to a reference level of the RNA molecule.

42. The method according to claim 41, wherein The reference level is the level of the RNA molecule determined empirically by measuring a plurality of reference blood samples from: Healthy subjects, and / or Successfully treated cancer patients.

43. The method of claim 42, wherein: A level of the RNA molecule above the reference level indicates that the patient has minimal residual disease.

44. The method of claim 43, wherein: Patients with minimal residual disease were assigned / eligible for adjuvant therapy.

45. A method according to any one of claims 38 to 44, wherein The determination comprises determining the level of the RNA molecule in a blood sample obtained from the patient at a first time point before therapeutic treatment of cancer and the level of the RNA molecule in at least one additional blood sample obtained from the (same) patient at a later time point after therapeutic treatment, and comparing the levels determined at different time points.

46. ​​The method of claim 45, wherein: A level of the RNA molecule that is stable over time or does not decrease over time up to / below a threshold level (representing the lowest level of the RNA molecule achievable by therapeutic treatment of cancer) indicates that the patient has minimal residual disease.

47. The method of claim 46, wherein: Patients with minimal residual disease were assigned / eligible for adjuvant therapy.

48. The method according to any one of claims 40 to 47, wherein: The drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines and antibodies.

49. The method of claim 48, wherein: (i) the immunomodulator is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4, or intrinsic checkpoint blockers, (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, folic acid antagonists, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors and histone deacetylase inhibitors, or (iii) The immunotherapeutic agent is selected from the group consisting of cytokines, antibodies, antigen presenting cells or chimeric antigen receptor T cells.

50. The method according to any one of claims 40 to 49, wherein: Said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy and thermotherapy.

51. The method according to any one of claims 1 to 50, wherein: The cancer is selected from the group consisting of lung cancer, bladder cancer, colon cancer, esophageal cancer, stomach cancer, tonsil cancer and uterine cancer.

52. The method of claim 51, wherein: The cancer is lung cancer.

53. The method of claim 52, wherein: The lung cancer is non-small cell lung cancer (NSCLC).

54. The method according to any one of claims 1 to 53, wherein: The patient is a mammal, preferably a human or a rodent.

55. The method according to any one of claims 1 to 54, wherein: The level of the RNA molecule is determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, flow cytometry or any combination thereof.

56. The method according to any one of claims 1 to 55, wherein: The level of the RNA molecule is the expression level of the RNA molecule.

57. The method according to any one of claims 1 to 56, wherein: The blood sample is whole blood or a blood fraction.

58. The method of claim 57, wherein: The blood fraction is selected from the group consisting of a blood cell fraction, plasma and serum.

59. The method of claim 58, wherein: The blood cell fraction is a fraction of leukocytes or a mixture of erythrocytes, leukocytes and platelets.

60. Use of an RNA molecule for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment for cancer, determining the risk of cancer recurrence in a patient, and / or detecting minimal residual disease in a patient with cancer, in, The RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

61. A kit for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient has responded to therapeutic treatment of cancer, determining the risk of cancer recurrence in a patient, and / or detecting minimal residual disease in a patient with cancer, wherein: The kit comprises: Means for determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

62. The kit according to claim 61, wherein The kit further comprises instructions on how to carry out the method according to any one of claims 1-59.

63. The kit according to any one of claims 61 or 62, wherein The kit is useful for performing the method according to any one of claims 1-59.

Images