A primer set for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus and its application

Abstract

The present invention discloses a primer set for identifying the nucleotide diversity of the avirulent gene AvrPib of rice blast fungus and its application, belonging to the field of gene detection. The present invention designs four pairs of primers for three SNP sites of the avirulent gene AvrPib of rice blast fungus, utilizes the PCR technology of four primers to amplify the blocked mutation system, and for different SNP sites of the AvrPib gene, places the 3' end of the primer at the nucleotide difference site, the base of the site is completely complementary to one of the genotypes, and does not match the other genotype, and distinguishes PCR products of different sizes through PCR amplification and electrophoresis pattern, so as to directly identify different genotypes of AvrPib. The population distribution of the avirulent gene AvrPib of rice blast fungus in the field is distinguished by different genotypes, so as to guide the rice blast resistance breeding and the reasonable layout and rotation of varieties in various regions, and lay the foundation for designing a new strategy for comprehensive prevention and control of rice blast.

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular to a primer set for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus and an application thereof. Background Art

[0002] The avirulence gene of rice blast fungus is a type of pathogenic gene that can overcome or escape rice's basic immunity during the evolution of rice blast disease. The proteins encoded by them are collectively called effector proteins. This type of effector protein can be specifically recognized by rice's disease resistance R protein, thereby triggering a rapid and strong specialized disease resistance immune response (ETI). Mutations in avirulence genes can lead to the loss of ETI disease resistance. AvrPib is an avirulence gene found in rice blast fungus that can be specifically recognized by the rice disease resistance gene Pib, thereby activating the Pib-mediated ETI disease resistance response. At present, no studies have found that the nucleotide sequence of AvrPib is different in rice blast fungus populations, and no related studies have reported how to identify its polymorphic sites. Summary of the invention

[0003] The purpose of the present invention is to provide a primer set for identifying the nucleotide diversity of the avirulent gene AvrPib of rice blast fungus and its application, so as to solve the problems existing in the above-mentioned prior art, use the primer set to determine the nucleotide polymorphic site, and then distinguish the population distribution of rice blast fungus AvrPib in the field, so as to provide a theoretical basis for rice blast resistance breeding and reasonable variety layout.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a primer set for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus, and the primer set is as follows:

[0006] Outer-F: 5'-TCGAACCCAACACAACTCATTC-3';

[0007] Outer-R: 5'-AAGTTCCAATGTTACCGAAGGC-3';

[0008] 135A-F: 5'-TCCAAAGGGGGAATCCAGAGA-3';

[0009] 135T-R: 5'-ATTTCCACGGATGTTAAATA-3';

[0010] 156A-F: 5'-ATTTAACATCCGTGGAAAATA-3';

[0011] 156C-R: 5'-TCCGACACACTAACAGTAAGAG-3';

[0012] 158T-F: 5'-CAGAGAATTTAACATCCGTGGAAAATATTC-3';

[0013] 158C-R: 5'-TCGTCCGACACACTAACAGTAAGG-3'.

[0014] The invention also discloses a product for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus, comprising the primer set.

[0015] Optionally, the product includes a reagent, a kit or a gene chip.

[0016] The present invention also provides the application of the primer set or the product in identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus.

[0017] Optionally, the identifying of the nucleotide diversity of the rice blast fungus avirulence gene AvrPib includes identifying the genotypes of bases at positions 135, 156 and 158 of the sequence shown in SEQ ID NO:1.

[0018] The present invention also provides the use of the primer set or the product in distinguishing the population distribution of the avirulence gene AvrPib of rice blast fungus in the field.

[0019] The present invention also provides the application of the primer set or the product in rice blast resistance breeding and variety layout.

[0020] The present invention also provides a method for identifying the nucleotide diversity of the rice blast fungus avirulence gene AvrPib, comprising the steps of performing PCR amplification using the primer set and determining the genotype of the polymorphic site of the rice blast fungus avirulence gene AvrPib according to the amplification product; wherein the polymorphic site of the rice blast fungus avirulence gene AvrPib includes the SNP sites at positions 135, 156 and 158 of the sequence shown in SEQ ID NO: 1.

[0021] The sequence shown in SEQ ID NO: 1 is:

[0022] ATGCGTTCCTCAACCACTTTTATCACTATGCCTTTATTGCGATGCAAGCTCTCGGTATTGCGGCCACACAGGTTACTATCTTGAAGAAGGGTGAAAGAATTACTTGGGTAGAAGTTCCAAAGGGGGAATCCAGAGTATTTAACATCCGTGGAAAATCTGTTACTGTTAGTGTGTCGGACGACGGTACACCCAGTATTTCTGGCAGCAAATATACCGTGGAATAA.

[0023] Preferably, there is a T / A mutation at the 135th SNP site of the rice blast fungus avirulence gene AvrPib, a C / A mutation at the 156th SNP site, and a C / T mutation at the 158th SNP site.

[0024] Preferably, the conditions for determining the genotype of the AvrPib polymorphic site according to the amplification product are:

[0025] For the 135th SNP site, when the amplified bands are 458 bp and 360 bp, it indicates that the base of the 135th SNP site is T; when the amplified bands are 458 bp and 139 bp, it indicates that the base of the 135th SNP site is A;

[0026] For the 156th SNP site, when the amplified bands are 458 bp and 382 bp, it indicates that the base of the 156th SNP site is C; when the amplified bands are 458 bp and 118 bp, it indicates that the base of the 156th SNP site is A;

[0027] For the SNP site at position 158, when the amplified bands are 458bp and 385bp, it indicates that the base of the SNP site at position 158 is C; when the amplified bands are 458bp and 118bp, it indicates that the base of the SNP site at position 158 is T.

[0028] The present invention discloses the following technical effects:

[0029] The present invention discloses a primer set and method for detecting the difference of three SNP sites of the avirulent gene AvrPib of rice blast fungus. The SNP of the avirulent gene AvrPib of rice blast fungus makes AvrPib have nucleotide diversity, which leads to the mutation of the effector protein encoded by AvrPib, and cannot be recognized by the disease resistance gene Pib of rice. The present invention uses the PCR technology of four-primer amplification blocked mutation system to design universal outer primers Outer-F and Outer-R, and two inner primers for different SNP sites of the AvrPib gene, and by placing the 3' end of the inner primer at the nucleotide difference site, the 3' terminal base of the forward inner primer is the same or complementary to one SNP, and the 3' terminal base of the reverse inner primer is complementary or the same to another SNP. Through PCR amplification and electrophoresis pattern, PCR products of different sizes can be distinguished, and then different genotypes of AvrPib can be directly identified. The present invention supplements and improves the identification primer set of the AvrPib nucleotide polymorphism site, so as to be used for analyzing the population structure of AvrPib, so as to guide the application of the rice disease resistance gene Pib in rice breeding and layout, and effectively improve the application of the Pib gene in disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 The PCR identification results of three SNPs of the rice blast avirulence gene AvrPib; M is a standard DNA molecule, the templates of lanes 1 and 3 are the genomic DNA of the rice blast fungus LZJ-32-5, the templates of lanes 2, 4, and 5 are the genomic DNA of the rice blast fungus R01-1, and the template of lane 6 is the genomic DNA of the rice blast fungus YN716. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] The main experimental materials involved in the following examples are:

[0038] The rice blast fungus strains RO1-1 and YN716 are both common rice blast fungus biological materials, which are preserved in the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0039] The field-collected strain LZJ-35-2 has been disclosed in the following literature: Hu P, Liu Y, Zhu X, Kang H.ABCC Transporter Gene MoABC-R1 Is Associated with Pyraclostrobin Tolerance inMagnaporthe oryzae. J Fungi (Basel). 2023 Sep 11;9(9):917. doi: 10.3390 / jof9090917. PMID: 37755025; PMCID: PMC10532721. The rice blast fungus is deposited in the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. The applicant promises that the rice blast fungus will survive and be open to the public for 20 years from the date of application.

[0040] Example 1

[0041] 1. Discovery of different nucleotide polymorphisms of the avirulent gene AvrPib

[0042] 1) Our laboratory has completed the whole genome sequencing of about 100 rice blast fungus strains in the early stage (reference: Hu P, Liu Y, Zhu X, Kang H. ABCC Transporter Gene MoABC-R1 Is Associated with Pyraclostrobin Tolerance in Magnaporthe oryzae. J Fungi (Basel). 2023 Sep 11;9(9):917.);

[0043] 2) Use Perl bioinformatics technology to extract the nucleotide sequence of the avirulent gene AvrPib in the genome sequences of different strains;

[0044] 3) The AvrPib nucleotide sequences from different strains were compared and analyzed using the software MEGA11.0.13.

[0045] The results of statistical analysis showed that the AvrPib gene had three nucleotide polymorphic sites in different strains, namely 135, 156, and 158; the representative strains of the three nucleotide sites were RO1-1, YN716, and LZJ-32-5, as shown in Table 1.

[0046] Table 1 AvrPib nucleotide polymorphism sites

[0047]

[0048] 2. Cloning of different genotypes of the avirulent gene AvrPib

[0049] The experiments were conducted using rice blast fungus strains RO1-1, YN716 and LZJ-35-2 as examples.

[0050] 2.1 Experimental methods

[0051] 1) Extraction of genomic DNA

[0052] The mycelium of rice blast fungus was cultured in CM medium, dried thoroughly with filter paper, quickly frozen and crushed with liquid nitrogen in a mortar and pestle, and transferred into a 1.5 mL EP tube containing 2% CTAB lysis buffer. After thorough shaking, genomic DNA was extracted and the DNA concentration and quality were measured by NanoDrop.

[0053] 2) Identification of different AvrPib genotypes

[0054] Using the DNA extracted in step 1) as a template, Phanta Max Super-Fidelity DNA Polymerase from Novagen was used to perform PCR amplification of the four-primer amplification blocked mutation system.

[0055] Universal outer primers (Outer-F, Outer-R) and specific inner primers for each polymorphism were designed according to the AvrPib gene, see Table 2; the genotype and amplification product information of different SNP sites are shown in Table 3.

[0056] Table 2 Primer names and sequences

[0057]

[0058] Table 3 Target fragment size

[0059]

[0060] The PCR reaction system is shown in Table 4.

[0061] Table 4 Amplification reaction system

[0062]

[0063] The PCR amplification procedure was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 56 °C for 15 s, extension at 72 °C for 30 s, and extension at 72 °C for 10 min after 35 cycles. The size of the PCR product was observed by agarose gel electrophoresis, and the genotype of Avr-Pib was determined by the size of the product 458 bp and another product, as shown in Figure 1 shown.

[0064] 2.2 Experimental Results

[0065] from Figure 1It can be seen that the outer primers Outer-F and Outer-R in all lanes amplify a 458bp target product. According to the differences in SNPs at different sites, when the SNP matches the primers, the target fragment of the corresponding size can be amplified. Taking the 135 site as an example, if the SNP site is base T, when PCR amplification is performed using four primers Outer-F, Outer-R, 135A-F, and 135T-R, the 458bp target product amplified by the outer primers Outer-F and Outer-R and the 360bp target product amplified by Outer-F and 135T-R can be obtained. Conversely, if the SNP at the 135 site is base A, the target fragment size is 458bp and 139bp. Therefore Figure 1 The results in Table 2 and Table 3 are consistent, indicating that this primer pair is applicable. The SNP sites at positions 156 and 158 can also determine the genotype of Avr-Pib through the product 458 bp and the size of another product, and the results are consistent with Table 1 and Table 3.

[0066] The invention provides a primer set capable of identifying the polymorphism of the nucleotide sequence of AvrPib based on the gene polymorphism of the avirulent gene AvrPib of the rice blast fungus, so as to distinguish the genotypes of AvrPib of different strains in the field, and then quickly establish a molecular detection system for the pathogenic variation of AvrPib in the natural population of the rice blast fungus, understand and grasp the distribution of the above gene in the natural population in the field and its dynamic change law, so as to guide the rice blast resistance breeding and the reasonable layout and rotation of varieties in various regions, so as to improve the breeding efficiency, more effectively control the occurrence of rice blast, and thus design a new strategy for the comprehensive prevention and control of rice blast.

[0067] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus, characterized in that: The primer set is as follows: Outer-F: 5'-TCGAACCCAACACAACTCATTC-3'; Outer-R: 5'-AAGTTCCAATGTTACCGAAGGC-3'; 135A-F: 5'-TCCAAAGGGGGAATCCAGAGA-3'; 135T-R: 5'-ATTTCCACGGATGTTAAATA-3'; 156A-F: 5'-ATTTAACATCCGTGGAAAATA-3'; 156C-R: 5'-TCCGACACACTAACAGTAAGAG-3'; 158T-F: 5'-CAGAGAATTTAACATCCGTGGAAAATATTC-3'; 158C-R: 5'-TCGTCCGACACACTAACAGTAAGG-3'.

2. A product for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus, characterized in that: Comprising the primer set of claim 1.

3. The product according to claim 2, characterized in that The products include reagents, kits or gene chips.

4. Use of the primer set according to claim 1 or the product according to any one of claims 2 to 3 in identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus.

5. The use according to claim 4, characterized in that The identification of the nucleotide diversity of the rice blast fungus avirulence gene AvrPib includes identifying the genotypes of the 135th, 156th and 158th bases of the sequence shown in SEQ ID NO:

1.

6. Use of the primer set according to claim 1 or the product according to any one of claims 2 to 3 in distinguishing the population distribution of the avirulence gene AvrPib of rice blast fungus in the field.

7. Use of the primer set according to claim 1 or the product according to any one of claims 2 to 3 in rice blast resistance breeding and variety planning.

8. A method for identifying the nucleotide diversity of the avirulence gene AvrPib of rice blast fungus, characterized in that: The method comprises the steps of performing PCR amplification using the primer set described in claim 1, and determining the genotype of the polymorphic site of the rice blast fungus avirulence gene AvrPib according to the amplification product; wherein the polymorphic site of the rice blast fungus avirulence gene AvrPib comprises the SNP sites at positions 135, 156 and 158 of the sequence shown in SEQ ID NO:

1.

9. The method according to claim 8, characterized in that The 135th SNP site of the rice blast fungus avirulence gene AvrPib has a T / A mutation, the 156th SNP site has a C / A mutation, and the 158th SNP site has a C / T mutation.

10. The method according to claim 8, characterized in that The conditions for determining the genotype of the AvrPib polymorphic site according to the amplification product are: For the 135th SNP site, when the amplified bands are 458 bp and 360 bp, it indicates that the base of the 135th SNP site is T; when the amplified bands are 458 bp and 139 bp, it indicates that the base of the 135th SNP site is A; For the 156th SNP site, when the amplified bands are 458 bp and 382 bp, it indicates that the base of the 156th SNP site is C; When the amplified bands are 458 bp and 118 bp, it indicates that the base of the SNP site at position 156 is A; For the 158th SNP site, when the amplified bands are 458 bp and 385 bp, it indicates that the base of the 158th SNP site is C; When the amplified bands are 458 bp and 118 bp, it indicates that the base of the SNP site at position 158 is T.

Images