Gene therapy for diseases with CNS manifestation

Abstract

The present disclosure relates generally to viral vectors comprising an engineered transgene capable of crossing the blood brain barrier and their use in treating diseases with central nervous system performance, such as, but not limited to, Hunter Syndrome, Gaucher Disease, and Swefil Syndrome.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This PCT application claims the benefit of priority to U.S. Provisional Application No. 63 / 326,780 filed on April 1, 2022, U.S. Provisional Application No. 63 / 350,822 filed on June 9, 2022, and U.S. Provisional Application No. 63 / 478,342 filed on January 3, 2023, each of which is incorporated herein by reference in its entirety.

[0003] Reference to a sequence listing submitted electronically via EFS-WEB

[0004] The contents of the electronically submitted Sequence Listing as an ASCII text file submitted with this application (Name: 3817_141PC03_SequenceListing_ST26; Size: 41,454 bytes; and Creation Date: March 30, 2023) are incorporated herein by reference in their entirety. Technical Field

[0005] The present disclosure generally relates to viral vectors comprising an engineered transgene capable of crossing the blood-brain barrier and their use in treating diseases with central nervous system manifestations. Background Art

[0006] Diseases affecting the central nervous system (CNS) are some of the most challenging diseases to treat. The body's own protection, including the blood-brain barrier (BBB), makes it very difficult or even impossible for large drugs and biologics delivered systemically to work in the CNS. The use of protein-based therapies is particularly limited by minimal brain exposure (see, e.g., Arguello and Mahon et al., J. Exp. Med. 219 (3): e20211057 (2022); Kumar et al., Bioconjug. Chem.; 29 (12): 3937-3966 (2018); Stanimirovic et al., BioDrugs. 32 (6): 547-559 (2018)). Similarly, most polar small molecules (such as antibodies) and nearly all macromolecules are effectively restricted from penetrating the brain at therapeutically relevant concentrations by physical and biochemical barriers, most notably the BBB (Arguello and Mahon et al., J. Exp. Med. 219(3):e20211057 (2022); Abbott et al., Acta. Neuropathol. (2018); Banks, Nat. Rev. Drug Discov. 15(4):275-92 (2016)).

[0007] This barrier to effective treatment is particularly relevant to lysosomal storage diseases (LSDs). LSDs represent a family of more than 50 monogenic diseases, many of which are characterized by defects in a single lysosomal enzyme. Their combined prevalence is estimated to be 1 in 8,000 newborns (see Arguello and Mahon et al., J. Exp. Med. 219(3): e20211057(2022); Schultz et al., Trends Neurosci. 34(8): 401-10(2011)), constituting a considerable underserved patient population. Disease-associated variants result in reduced or lost enzyme activity, leading to substrate accumulation and widespread lysosomal dysfunction (Platt et al., J. Cell Biol. 199(5):723–734 (2012)), which may trigger a pathogenic cascade affecting multiple tissues throughout the body, including the CNS (Bellettato and Scarpa, J. Inherit. Metab. Dis. 33(4):347-62 (2010)). In fact, given the ubiquitous presence of lysosomes in all cells of the body, most LSDs involve progressive CNS damage in addition to syndromic manifestations of peripheral organs. However, the treatment of CNS manifestations in LSDs remains a considerable challenge.

[0008] The standard of care for many LSDs is systemically administered recombinant enzyme replacement therapy (ERT); however, these first-generation enzymes do not readily cross the BBB and are generally ineffective in treating CNS manifestations of the disease (Scarpa et al., Best Pract. Res. Clin. Endocrinol. Metab. 29(2): 159-71 (2015)). Although these therapies are expected to reduce substrate levels outside the CNS, they are often less effective in reducing substrate levels in the brain (see, e.g., Sonoda et al., Mol. Ther. 26: 1366-74 (2018); Morimoto et al., Mol. Ther. 29: 1853-61 (2021)). In addition to the lack of treatments that effectively address the neurological manifestations of these diseases, direct CNS delivery methods are invasive, susceptible to device issues, and have the potential to result in poor brain distribution (Ullman et al. Sci. Transl. Med. 12(545): 1163 (2020)).

[0009] For example, mucopolysaccharidosis II (MPS II), also known as Hunter syndrome, is a lysosomal storage disease caused by mutations in iduronate-2-sulfatase (IDS or I2S), characterized by a variety of somatic and neurological symptoms. Hunter syndrome is a debilitating disease affecting multiple organ systems, including organomegaly (particularly the liver and spleen), progressive joint and bone involvement, and severe cognitive deficits in the form of neuropathy in MPS II. Currently approved intravenous ERT with recombinant IDS is ineffective in treating CNS manifestations because it cannot cross the BBB (Noh and Lee, J. Clin. Pharm. Ther. 39 (3): 215-24 (2014)).

[0010] Mucopolysaccharidosis (MPS) is a group of hereditary lysosomal storage diseases, and in addition to Hunter syndrome, also includes, for example, Hurler syndrome (Hurler syndrome) (MPS I), Sanfilippo syndrome (Sanfilippo syndrome) (MPS III) and Sly syndrome (Sly syndrome) (MPS VII). Hurler syndrome is the most serious form of mucopolysaccharidosis, and is characterized by enzyme α-L-iduronidase deficiency, which can cause the accumulation of dermatan and heparan sulfate. Sanfilippo syndrome has four subtypes (A, B, C and D), which are distinguished by four different enzyme deficiencies, and Sly syndrome is characterized by β-glucuronidase deficiency, causing the accumulation of glycosaminoglycans, dermatan sulfate, heparan sulfate and chondroitin sulfate. Other LSDs include, for example, Gaucher disease, Metachromatic leukodystrophy, Krabbe disorder, and GM1 gangliosidosis. For example, Gaucher disease is characterized by a deficiency of the enzyme glucocerebrosidase, which results in the accumulation of certain lipids (particularly glucocerebroside) throughout the body, particularly in the bone marrow, spleen, and liver. The disease may also affect the brain, lungs, eyes, and bones, so the symptoms vary.

[0011] An emerging strategy to improve brain delivery of protein therapeutics is to utilize receptor-mediated transcytosis (RMT) (Ullman et al. Sci. Transl. Med. 12(545): 1163(2020)). RMT is an endogenous process in which essential biomolecules that cannot diffuse passively from the bloodstream to the brain (e.g., insulin and transferrin-bound iron) are actively transported across the BBB through specific interactions with brain endothelial cell receptors (Johnsen et al., Prog. Neurobiol. 2019 181: 101665(2019)). Transferrin receptor (TfR) is a RMT target at the BBB, in part because it is enriched on brain endothelial cells (Jefferies et al., Nature. 312: 162–163(1984)). However, extensive imaging and biodistribution studies in mouse models suggest that antibodies targeting TfR may be only minimally released into the brain parenchyma (Paris-Robidas et al., Mol Pharmacol. 80(1):32-9 (2011); Paterson and Webster, Drug Discov. 20:49-52 (2016)).

[0012] Therefore, for patients with CNS manifestations of a disease caused by a deficiency of a certain enzyme or protein, there is a need in the art for therapeutic agents that result in broad CNS parenchymal exposure of the specific enzyme or protein. Specifically, in LSDs, there is a need in the art for therapeutic agents that increase CNS penetration to ultimately reduce substrate accumulation. Summary of the invention

[0013] Some aspects of the present disclosure relate to a gene therapy vector comprising: (a) a 5' inverted terminal repeat (ITR), (b) a promoter, (c) a transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG, and (d) a 3' ITR.

[0014] In some aspects, the biologically active polypeptide comprises a therapeutic enzyme. In some aspects, the biologically active polypeptide reduces the level of the substrate in the central nervous system. In some aspects, the biologically active polypeptide comprises idursulfase activity, comprises glucocerebrosidase activity, comprises sulfoglucosamine sulfohydrolase activity or comprises sulfamidase activity. In some aspects, the biologically active polypeptide is idursulfase (IDS), glucocerebrosidase (GCB), N-sulfoglucosamine sulfohydrolase or sulfamidase (SGSH).

[0015] In some aspects, TAG increases the translocation of biologically active polypeptides across the blood-brain barrier. In some aspects, TAG comprises antigen binding molecules. In some aspects, TAG comprises scFv, VHH, vNAR, double antibody, nano antibody, camel antibody or a combination thereof. In some aspects, TAG comprises VHH. In some aspects, TAG comprises an antigen binding molecule that specifically binds to transferrin receptor 1 (TfR1). In some aspects, TAG comprises a VHH that specifically binds to TfR1.

[0016] In some aspects, the TAG comprises a variable heavy chain (VH) domain comprising a VH complementary determining region (CDR) 1, a VH-CDR2, and a VH-CDR3. In some aspects, VH-CDR1 is encoded by the nucleic acid sequence shown in SEQ ID NO: 11. In some aspects, VH-CDR2 is encoded by the nucleic acid sequence shown in SEQ ID NO: 12. In some aspects, VH-CDR3 is encoded by the nucleic acid sequence shown in SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding the TAG comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some aspects, the nucleotide sequence encoding TAG comprises SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some aspects, the nucleotide sequence encoding TAG comprises SEQ ID NO: 14. In some aspects, the nucleotide sequence encoding TAG comprises SEQ ID NO: 15.

[0017] In some aspects, the nucleotide sequence encoding the biologically active polypeptide is located 3' to the nucleotide sequence encoding TAG. In some aspects, the nucleotide sequence encoding the biologically active polypeptide is located 5' to the nucleotide sequence encoding TAG.

[0018] In some aspects, (i) the nucleotide sequence encoding the biologically active polypeptide is further connected to (ii) the nucleotide sequence encoding the TAG via (iii) a nucleotide sequence encoding a peptide linker. In some aspects, the linker is a flexible linker, a cleavable linker, a processable linker, or any combination thereof.

[0019] In some aspects, the promoter is a ubiquitous promoter. In some aspects, the ubiquitous promoter includes chicken beta actin (CBA) promoter, EF-1α promoter, PGK promoter, UBC promoter, LSE beta-glucuronidase (GUSB) promoter or ubiquitous chromatin opening element (UCOE) promoter. In some aspects, the ubiquitous promoter includes cytomegalovirus (CMV) enhancer, chicken beta actin promoter (CBA) and rabbit beta globin intron.

[0020] In some aspects, the promoter is a tissue-specific promoter. In some aspects, the promoter is a liver-specific promoter. In some aspects, the promoter includes hTTR, PGK, chicken beta actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSEβ-glucuronidase (GUSB) promoter or ubiquitous chromatin opening element (UCOE) promoter or any combination thereof.

[0021] In some aspects, the gene therapy vector is a recombinant AAV (rAAV). In some aspects, rAAV comprises an AAV capsid. In some aspects, the AAV capsid is a wide-tropic AAV capsid. In some aspects, the AAV capsid is a wide-tropic AAV capsid selected from the following: AAV1 capsid, AAV2 capsid, AAV3 capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid and variants thereof. In some aspects, the AAV capsid is AAV9.

[0022] In some aspects, the gene therapy vector further comprises a polyA sequence located at the 3' of the transgene. In some aspects, polyA is bovine growth hormone (BGH) polyA or synthetic polyA. In some aspects, polyA is a synthetic polyA designed by computer. In some aspects, the gene therapy vector further comprises a post-transcriptional regulatory element. In some aspects, the post-transcriptional regulatory element is located at the 3' of the transgene. In some aspects, the post-transcriptional regulatory element is located at the 5' of the polyA sequence. In some aspects, the post-transcriptional regulatory element includes a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some aspects, the WPRE sequence is modified. In some aspects, the WPRE sequence is WPRE mut6delATG. In some aspects, the promoter comprises a shortened EF-1α promoter and one or more introns. In some aspects, one or more introns are from CBA and / or rabbit β-globin genes.

[0023] In some aspects, the transgene is codon optimized.

[0024] Some aspects of the present disclosure relate to a method for treating a disease or illness of a subject in need thereof, comprising administering a gene therapy vector encompassed by the present disclosure to the subject. In some aspects, the disease or illness comprises a neuronal disease. In some aspects, the disease or illness comprises a mucopolysaccharidosis. In some aspects, the disease or illness comprises Hurler's syndrome (MPS I), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Sly syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disease, and GM1 gangliosidosis.

[0025] Some aspects of the present disclosure relate to a method of delivering a biologically active polypeptide across the blood-brain barrier in a subject in need thereof, comprising administering to the subject a gene therapy vector encompassed by the present disclosure, wherein such administration results in a reduction in substrate levels in the central nervous system of the subject. Some aspects of the present disclosure relate to a method of reducing a substrate in the central nervous system of a subject, comprising administering to the subject a gene therapy vector disclosed herein.

[0026] Some aspects of the present disclosure relate to a method of treating a mucopolysaccharidosis in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Hurler's syndrome (MPS I) in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Hunter syndrome (MPS II) in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Sanfilippo syndrome (MPS III) in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Sly syndrome (MPS VII) in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Gaucher disease in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating metachromatic leukodystrophy in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating Krabbe disease in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to a method of treating GM1 gangliosidosis in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein.

[0027] In some aspects, the recombinant polypeptide is expressed from a transgene outside the central nervous system, and the TAG facilitates translocation of the recombinant polypeptide across the blood-brain barrier into the central nervous system.

[0028] In some aspects, the recombinant polypeptide reduces the level of the substrate in the central nervous system of the subject. In some aspects, the recombinant polypeptide reduces the level of the substrate systemically.

[0029] Some aspects of the present disclosure relate to a method of treating Hunter syndrome in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises IDS.

[0030] Some aspects of the present disclosure relate to a method of treating Gaucher disease in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises glucocerebrosidase (GCB).

[0031] Some aspects of the present disclosure relate to a method of treating Sanfilippo syndrome in a subject in need thereof, comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises N-sulfoglucosamine sulfohydrolase. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1A-Figure 1C Male IdsKO mice aged 8 to 12 weeks were fed with 2.5 x 10 12 vg / kg and 6.25x10 12 vg / kg brain I2S activity (nmol / hr / mg total protein, Figure 1A ), brain heparan sulfate levels (ng / mg total protein, Figure 1B ) and CSF heparan sulfate levels (ng / mL CSF, Figure 1C ). Also shown are data for a control rAAV9-MY011 (null) treated group and a wild-type (WT:WT) littermate vehicle treated group.

[0033] Figure 2A-2H is from the liver injected with the GT construct driven by: rAAV9-GTH077 (I2S; Figure 2A and Figure 2E ), rAAV9-GTH074(VHH-I2S; Figure 2B and Figure 2F ) or rAAV9-GTH071(I2S-VHH; Figure 2C and Figure 2G ); and negative control ( Figure 2D and Figure 2H ) of mice with thalamic neurons undergoing I2S ( Figure 2A-2D ) and LAMP1( Figure 2E-2H ) Representative micrographs of immunostaining.

[0034] Figure 3A-Figure 3L are representative micrographs of: intravenous administration of rAAV9-GTH077 (I2S; Figure 3A , Figure 3E and Fig. 3I ) or rAAV9-GTH074 (VHH-I2S; Figure 3B , Figure 3F and Figure 3J ) in the cortex of IdsKO mice ( Figure 3A-3D )、Seahorse( Figure 3E-3H ) and thalamus ( Figure 3I-Figure 3L ) and compared with the IdsKO control ( Figure 3C , Figure 3G and Figure 3K ) and WT control ( Figure 3D , Figure 3H and Figure 3L ) LAMP1 immunostaining in the same brain region of mice.

[0035] Figure 4A-4F IdsKO mice were given 2.5x10 12 vg / kg and 6.25x10 12 vg / kg after administration of rAAV9-GTH077 (I2S), rAAV9-GTH071 (I2S-VHH) or rAAV9-GTH074 (VHH-I2S) Figure 4A ),liver( Figure 4B ),lung( Figure 4C ),marrow( Figure 4D ),heart( Figure 4E ) and kidneys( Figure 4F ) is a graphical representation of hI2S activity (nmol / hr / mg total protein) in .

[0036] Figure 5A-Figure 5C 2.5x10 12 vg / kg dose of animals administered with rAAV9 vectors expressing I2S driven by a ubiquitous promoter [rAAV9-GTH075(I2S), rAAV9-GTH069(I2S-VHH), and rAAV9-GTH072(VHH-I2S)] (nmol / hr / mg total protein; Figure 5A), brain heparan sulfate levels (ng / mg total protein; Figure 5B ) and CSF heparan sulfate levels (ng / mL CSF; Figure 5C ). Also shown are data for a control rAAV9-MY011 (null) treated group and a wild-type (WT:WT) littermate vehicle treated group.

[0037] Figure 6A-6F 2.5x10 12 vg / kg after administration of rAAV9-GTH075 (I2S), rAAV9-GTH072 (VHH-I2S), or rAAV9-GTH069 (I2S-VHH) to IdsKO mice Fig. 6A ),liver( Figure 6B ),lung( Figure 6C ),marrow( Fig.6D ),heart( Fig. 6E ) and kidneys( Fig. 6F ) is a graphical representation of hI2S activity in .

[0038] Figure 7A-7B is a liver-specific promoter ( Fig. 7A ) or ubiquitous promoter ( Figure 7B ) is a graphical representation of sustained hI2S activity in serum throughout the 4-week study in IdsKO mice treated with an I2S-expressing gene therapy construct.

[0039] Figure 8A-8B is from cell lysate after transfection of Huh7 cells with plasmids expressing tagged and untagged GCB ( Fig. 8A ) and supernatant ( Figure 8B ) is a graphical representation of GCB activity (nmol / hr / mg).

[0040] Figure 9A-9C is the GCB activity in the brain of D409V mice after injection of buffer, pGTG077, or pGTG072 (nmol / hr / mg; Fig. 9A ), GL-1 levels (normalized to total GL1, ng / mg protein; Fig. 9B ) and lyso-GL1 levels (normalized lysoGL1, ng / mg protein; Fig. 9C ) is a graphical representation of .

[0041] Figure 10A-10C Shown are the serum ( Fig. 10A ),liver( Fig. 10B ) and spleen ( Fig. 10C) in a graph showing GCB activity (nmol / hr / ml).

[0042] Fig.11 is a graphical representation of the percentage of SGSH activity after transfection of plasmids expressing tagged and untagged SGSH in Huh7 cells.

[0043] Figure 12A-12C is the brain (hSGSH, ng / mg total; Fig. 12A ), serum (ng / mL; Fig. 12B ) and liver (SGSH, ng / mg total; Fig. 12C ) is shown in the figure.

[0044] Fig.13 Shown are the ratios of brain exposure to serum SGSH following injection of SGSH, SGSH-BBB1 or BBB1-SGSH in WT mice.

[0045] Figures 14A-14D is a schematic diagram of an example vector construct of the present disclosure. Figure 14A-14B Shown are regions containing a ubiquitous promoter ("Ubiq"; Fig.14A ) or liver-specific promoter (“LSP”) and liver-specific enhancer (“LSE”; Fig. 14B )-controlled IDS transgenic sequence construct. Figure 14C-Figure 14D Shown is a construct comprising the SGSH transgene sequence under the control of a liver-specific promoter ("LSP") and a liver-specific enhancer ("LSE"). SP = signal peptide.

[0046] 15A-15B are bar graphs showing the percentage of SGSH protein that crossed the membrane of the in vitro Mimetas system measured at high ( FIG. 15A ) and low ( FIG. 15B ) concentrations of SGSH BBB1 fusion constructs.

[0047] Figures 16A-16E are graphical representations of transcytosis measured using a transwell model. Figure 16A is a representative graph of TEER values ​​compared to cell-free wells 3 days after inoculation of hBMEC cells. Figures 16B-16E are bar graphs showing SGSH activity (Figure 16B) and transcytosis of SGSH protein (Figure 16C) using transfection medium and transcytosis of SGSH protein (Figure 16D) and SGSH activity (Figure 16E) using purified protein.

[0048] 17A-17C are bar graphs showing the concentration of GAGs in cultured fibroblasts compared to normal cells ( FIG. 17A ) and the dose-dependent accumulation of SGSH in fibroblasts at 3 days ( FIG. 17B ) and 5 days ( FIG. 17C ) of culture.

[0049] Figures 18A-18J are representative images of control (Figures 18A-18D) and MPSIIIA patient-derived (Figures 18E-18J) fibroblasts stained with Lysotracker red (Figures 18A, 18C, 18E, 18G, and 18I) and Hoechst (Figures 18B, 18D, 18F, 18H, and 18J).

[0050] 19A-19D are bar graphs showing liver ( FIG. 19A ), serum ( FIG. 19B ), and brain ( FIG. 19C ) SGSH levels and relative brain SGSH activity ( FIG. 19D ) in wild-type mice administered control and SGSH BBB1 fusion constructs by hydrodynamic tail vein injection.

[0051] Figures 20A-20F are sample images of immunohistochemistry of SGSH in brain samples obtained from wild-type mice administered SGSHC terminal (Figures 20C-20D) and N-terminal (Figures 20E-20F) fusion constructs by hydrodynamic tail vein injection compared to mice administered control SGSH.

[0052] Figure 21A-Figure 21G shows the characteristics of the MPSIIIA mouse model. Figure 21A-Figure 21D shows the brain (Figure 21A), kidney (Figure 21B), liver (Figure 21C) and spleen (Figure 21D) SGSH activity of wild-type mice and Sgsh gene knock-in point mutation heterologous or homozygous mice. Figure 21E-Figure 21G shows the sample histology of anti-LAMP1 staining in the cortex of wild-type mice (Figure 21E) and heterologous mice (Figure 21F) or homozygous mice (Figure 21G) of Sgsh gene knock-in point mutation. DETAILED DESCRIPTION

[0053] Some aspects of the present disclosure relate to viral vectors containing transgenes capable of crossing the blood-brain barrier and their use in treating diseases with CNS manifestations. Diseases affecting the CNS can be very difficult to treat, especially when the disease mechanism involves defective or missing proteins (e.g., enzymes). This is the case with various lysosomal storage diseases (LSDs), many of which are characterized by defects in single lysosomal enzymes. The administration of recombinant enzyme replacement therapy (ERT) remains the standard of care for various LSDs; however, these enzymes do not easily cross the blood-brain barrier, significantly limiting the effects of the enzymes on LSD patients. In addition, these therapies must be delivered regularly to maintain the substrate reduction levels required to relieve symptoms. Thus, the compositions and methods disclosed herein provide a novel and effective means for delivering recombinant proteins (e.g., enzymes) across the blood-brain barrier and reducing and / or ameliorating the devastating CNS manifestations of various LSDs, including but not limited to mucopolysaccharidoses, such as Hurler's syndrome (MPSI), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Slater's syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disease, and GM1 gangliosidosis.

[0054] The compositions and methods described herein allow for increased localization across the BBB of proteins that correct cellular dysfunction within the CNS (e.g., lysosomal enzymes that are otherwise defective in the context of LSDs). These compositions further utilize viral vector gene therapy as a means of providing sustained expression of proteins in a subject, thereby avoiding the need for repeated re-dosing and providing patients with sustained substrate reduction and relief of disease symptoms.

[0055] I. Definitions

[0056] As used herein, the term "about" or "approximately" when applied to one or more target values ​​refers to a value similar to a stated reference value. In certain aspects, unless otherwise specified or apparent from the context, the term "about" or "approximately" refers to a range of values ​​that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction of the stated reference value (greater or less than the stated reference value) (except where such a number would exceed 100% of the possible values). It should be understood that when the term "about" or "approximately" is used to modify a stated reference value, the stated reference value itself is encompassed along with values ​​that are close to the stated reference value on either side of the stated reference value.

[0057] As used herein, the term "active" or "activity" refers to a form of a therapeutic protein that retains the biological activity of a corresponding native or naturally occurring polypeptide. The activity may be greater than, equal to, or less than the activity observed for the corresponding native or naturally occurring polypeptide.

[0058] As used herein, the terms "administer, administration, and administering" refer to providing a composition of the present disclosure to a subject in need thereof (e.g., a person affected by Hunter disease). The composition may be administered by any route. In some aspects, the composition is administered by intravenous administration, intraperitoneal administration, intraocular administration, oral administration, inhalation, intrathecal administration, intracranial administration, intracarotid artery, intracisterna magna (ICM), intracerebroventricular (ICV), intraarterial administration, or any combination thereof.

[0059] As used herein, the term "allogeneic" refers to any material derived from a different animal of the same species as the individual into which the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci of the two or more individuals are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently different genetically to produce antigenic interactions.

[0060] As used herein, the term "amino acid substitution" refers to replacing an amino acid residue present in a parent or reference sequence with another amino acid residue. Amino acids can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or by recombinant methods known in the art. Therefore, reference to "substitution at position X" refers to replacing the amino acid at position X in a reference sequence with an alternative amino acid residue. In some aspects, the substitution pattern can be described according to the pattern AnY, wherein A is a single letter code corresponding to an amino acid naturally present or initially present at position n, and Y is a substituted amino acid residue. In other aspects, the substitution pattern can be described according to the pattern An(YZ), wherein A is a single letter code corresponding to an amino acid residue that replaces a naturally present or initially present amino acid at position X, and Y and Z are alternative substituted amino acid residues.

[0061] Abbreviations for the genetically encoded amino acids are conventional and are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V). When a three-letter abbreviation is used, unless specifically preceded by "L" or "D" or otherwise clear from the context in which the abbreviation is used, the amino acid may be about the α-carbon (C α ) of the L or D configuration.

[0062] Substitutions in a protein or polypeptide amino acid sequence can be conservative or non-conservative in nature. Conservative amino acid substitutions refer to the replacement of a residue with a different residue having a similar side chain, and thus generally involve replacing an amino acid in a polypeptide with an amino acid within the same or similar amino acid definition class. As an example and not limitation, an amino acid with an aliphatic side chain can be replaced by another aliphatic amino acid (e.g., alanine, valine, leucine, and isoleucine); an amino acid with a hydroxyl side chain can be replaced by another amino acid with a hydroxyl side chain (e.g., serine and threonine); an amino acid with an aromatic side chain can be replaced by another amino acid with an aromatic side chain (e.g., phenylalanine, tyrosine, tryptophan, and histidine); an amino acid with a basic side chain can be replaced by another amino acid with a basic side chain (e.g., lysine and arginine); an amino acid with an acidic side chain can be replaced by another amino acid with an acidic side chain (e.g., aspartic acid or glutamic acid); and / or a hydrophobic or hydrophilic amino acid can be replaced by another hydrophobic or hydrophilic amino acid, respectively. Non-conservative substitutions refer to the replacement of an amino acid in a polypeptide by an amino acid with significantly different side chain properties. By way of example and not limitation, exemplary non-conservative substitutions may be acidic amino acids substituted for basic or aliphatic amino acids; aromatic amino acids substituted for small amino acids; and hydrophilic amino acids substituted for hydrophobic amino acids.

[0063] In some aspects, substitutions (even when they are referred to as amino acid substitutions) are made at the nucleic acid level, i.e., replacing an amino acid residue with an alternative amino acid residue by substituting a codon encoding a first amino acid with a codon encoding a second amino acid.

[0064] As used herein, the term "animal" refers to any member of the animal kingdom. In some aspects, "animal" refers to a person at any stage of development. In some aspects, "animal" refers to a non-human animal at any stage of development. In some aspects, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, a cow, a primate, or a pig). In some aspects, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some aspects, animals are transgenic animals, genetically engineered animals, or clones.

[0065] As used herein, the term "antibody" refers to an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or a combination of the foregoing, by at least one antigen recognition site in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses polyclonal antibodies, monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single-chain Fv (scFv) mutants, multispecific antibodies (such as bispecific antibodies produced by at least two complete antibodies), chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising the antigenic determinant of the antibody, and any other modified immunoglobulin molecules comprising an antigen recognition site, as long as the antibody exhibits the desired biological activity. Antibodies can be antibodies of any isotype (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass. Light and heavy chains are divided into regions of structural and functional homology. Different classes of immunoglobulins have distinct and well-known subunit structures and three-dimensional configurations. Antibodies may be naked or conjugated to other molecules (such as toxins, radioisotopes, etc.).

[0066] As used herein, "VHH" refers to the variable domains of the VHH molecule with only heavy chain. In some aspects, VHH is the VHH molecule with only heavy chain of camelids. In some aspects, VHH is produced by human antibodies, humanized antibodies or synthetic antibodies. The size of VHH is generally about 15kDa, and it contains single-chain molecules that can be used to bind its cognate antigen using a single domain. VHH generally includes four framework regions (FR) and three complementary determining regions (or CDRs), and its sequence content and structural conformation are highly variable, and participate in antigen binding and provide antigen specificity. In some aspects, VHH is modified to enhance affinity, stability, solubility and / or anti-aggregation. For example, compared with conventional human antibody VH, one or more amino acids in the FR2 region and CDR of VHH can be replaced in the FR2 region and complementary determining region (CDR) of VHH. In some aspects, one or more highly conserved hydrophobic amino acids in the FR2 region (e.g., Val47, Gly49, Leu50 and / or Trp52) are replaced with hydrophilic amino acids (e.g., Phe42, Glu49, Arg50, Gly52) to make the overall structure more hydrophilic and contribute to high stability, solubility and anti-aggregation.

[0067] As used herein, the term "codon substitution" or "codon replacement" in the context of sequence optimization refers to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be replaced in a reference nucleic acid sequence, for example, via chemical peptide synthesis or by recombinant methods known in the art. Thus, when referring to a "replacement" or "replacement" at a certain position in a nucleic acid sequence (e.g., mRNA) or in a certain region or subsequence of a nucleic acid sequence (e.g., mRNA), it is meant that a codon is replaced with a replaceable codon at that position or region.

[0068] As used herein, the term "codon optimized" or "codon optimization" refers to changes in the codons of a polynucleotide encoding a protein so that the encoded protein is more efficiently expressed, for example, in a cell or organism. In some aspects, the nucleotide sequences disclosed herein (e.g., transgenes) are codon optimized for expression in human cells (e.g., in vivo).

[0069] As used herein, the term "gene" refers to a DNA region encoding a protein or polypeptide, and all DNA regions regulating the production of a protein or polypeptide, regardless of whether such regulatory sequences are adjacent to coding and / or transcribed sequences. Therefore, a gene includes but is not necessarily limited to a promoter sequence, a terminator, a translation regulatory sequence such as a ribosome binding site and an internal ribosome entry site, an enhancer, a silencer, an insulator, a boundary element, a replication origin, a matrix binding site, and a locus control region. As used herein, the term "transgenic" refers to a heterologous DNA region encoding a polypeptide. Transgenic does not necessarily include a promoter sequence, a terminator, a translation regulatory sequence such as a ribosome binding site and an internal ribosome entry site, an enhancer, a silencer, an insulator, a boundary element, a replication origin, a matrix attachment site, and a locus control region. In some aspects, transgenic is composed of a polypeptide coding region. In some embodiments, transgenic comprises a nucleic acid encoding a biologically active polypeptide (e.g., an enzyme), which is connected to a nucleic acid encoding a tag (e.g., a nucleic acid encoding an antigen binding molecule). In some embodiments, the transgene comprises a nucleic acid molecule encoding a biologically active polypeptide, which is linked to a nucleic acid molecule encoding a tag, wherein there is a linker sequence between the nucleic acid encoding the polypeptide and the nucleic acid encoding the tag. In some embodiments, the nucleic acid encoding the tag is located 5' of the nucleic acid encoding the polypeptide. In other embodiments, the nucleic acid encoding the tag is located 3' of the nucleic acid encoding the polypeptide.

[0070] As used herein, the term "genomic particles (gp)" or "genome equivalent" in reference to viral titer refers to the number of virions containing the recombinant AAV (rAAV) DNA genome, regardless of their infectivity or functionality.

[0071] The terms “iduronic acid 2-sulfatase”, “IDS”, “iduronate 2-sulfatase” and “I2S” are used interchangeably to refer to a lysosomal enzyme involved in the degradation pathway of dermatan sulfate and heparan sulfate (see UniProtKB–P22304).

[0072] The terms “lysosomal acid glucosylceramidase”, “β-glucocerebrosidase”, “GBA”, “acid β-glucosidase”, “cholesterol glucosyltransferase”, “cholesterol-β-glucosidase”, “D-glucosyl-N-acylsphingosine glucohydrolase” and “GCB” are used interchangeably to refer to the lysosomal enzyme involved in the pathway that degrades glucosylceramide to free ceramide and glucose (see UniProtKB–P04062).

[0073] The terms "N-sulfoglucosamine sulfohydrolase", "sulfoglucosamine sulfamidase", "SGSG", "HNS", "sulfamidase" are used interchangeably and refer to a lysosomal enzyme involved in the lysosomal heparan sulfate degradation pathway (see UniProtKB-P51688).

[0074] As used herein, the term "joint" refers to any molecule or bond that connects two or more parts. In some aspects, the joint is a peptide joint, for example, the joint comprises one or more peptide bonds. In some aspects, the peptide joint comprises one or more peptides, for example, a polypeptide. In some aspects, the joint is a chemical joint.

[0075] As used herein, the term "nervous system" includes both the central nervous system and the peripheral nervous system. The term "central nervous system" or "CNS" includes all cells and tissues of the brain and spinal cord of vertebrates. The term "peripheral nervous system" refers to all cells and tissues of the nervous system part outside the brain and spinal cord. Therefore, the term "nervous system" includes but is not limited to cells in neuronal cells, glial cells, astrocytes, cells in cerebrospinal fluid (CSF), cells in the interstitial space, cells in the protective layer of the spinal cord, epidural cells (i.e., cells outside the dura mater), cells in non-neural tissues adjacent to or in contact with neural tissue or dominated by neural tissue, epineurium, perineurium, endoneurium, nerve cord, nerve bundles, etc.

[0076] As used herein, the terms "nucleic acid," "polynucleotide," and "oligonucleotide" are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in linear or circular conformations, single-stranded or double-stranded forms. For the purposes of this disclosure, these terms should not be construed as limiting with respect to the length of the polymer. The terms may encompass known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moieties (e.g., phosphorothioate backbones). Typically, analogs of a particular nucleotide have the same base pairing specificity; i.e., an analog of A will base pair with T.

[0077] As used herein, the terms "operative linkage" and "operatively linked / operably linked" are used interchangeably and refer to the juxtaposition of two or more components (such as sequence elements) in which the arrangement of the components allows both components to function normally and allows at least one component to mediate the function of at least one other component. For example, a transcriptional regulatory sequence (such as a promoter) is operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is typically operably linked to a coding sequence in cis, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operably linked to a coding sequence, even if they are not adjacent.

[0078] The terms "polypeptide" and "protein" or the nucleotide sequence encoding it used interchangeably herein refer to proteins or nucleotide sequences representing native sequences, variants thereof, or fragments thereof, respectively. Full-length proteins and fragments thereof with or without signal sequences, as well as proteins modified to native sequences, such as deletions, additions, and substitutions (conservative or non-conservative in nature), are suitable for use herein, as long as the protein maintains the desired activity. These modifications may be intentional, such as by site-directed mutagenesis, or may be accidental, such as by mutations of the host producing the protein or errors caused by PCR amplification. Therefore, it is contemplated herein to use active proteins that are substantially homologous to the parent sequence, such as proteins having 70% ... 80% ... 85% ... 90% ... 95% ... 98% ... 99% identity and retaining the desired activity of the native molecule.

[0079] As used herein, the term "promoter" encompasses a DNA sequence that directs RNA polymerase binding and thereby promotes RNA synthesis, i.e., a minimal sequence sufficient to direct transcription. Promoters and corresponding protein or polypeptide expression may be ubiquitous, meaning that they are strongly active or cell type-specific, tissue-specific, or species-specific in a wide range of cells, tissues, and species. In some aspects, liver-specific promoters include, for example, transthyretin promoter (TTR); thyroxine-binding globulin (TBG) promoter; hybrid liver-specific promoter (HLP) and alpha-1-antitrypsin (AAT) promoter. Promoters may be "constitutive", meaning continuously active, or "inducible", meaning that the promoter can be activated or inactivated by the presence or absence of biological or non-biological factors. The nucleic acid construct or vector of the present disclosure also includes an enhancer sequence, which may be adjacent or non-adjacent to the promoter sequence. The enhancer sequence affects promoter-dependent gene expression and may be located in the 5' region or 3' region of the natural gene. In some aspects, the enhancer is a tissue-specific enhancer. In some aspects, the enhancer is a liver-specific enhancer. In certain aspects, the construct comprises a liver-specific enhancer and a liver-specific promoter upstream of the transgene.

[0080] As used herein, the term "sequence optimization" refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases to produce a nucleic acid sequence with improved properties (e.g., improved protein expression or increased activity).

[0081] The terms "subject", "individual" and "patient" are used interchangeably herein and refer to a vertebrate, preferably a mammal. Mammals include, but are not limited to, mice, rodents, apes, humans, farm animals, sports animals and pets.

[0082] As used herein, the term "TAG" or "tag" refers to a polypeptide that contributes to the targeted positioning of a related second polypeptide connected thereto. In some aspects, the TAG comprises an antibody or antigen binding portion thereof that specifically binds to human transferrin receptor 1 (TfR1). In some aspects, the TAG comprises a VHH that specifically binds to human TfR1. In some embodiments, the transgene contained in the viral vector encompassed by the disclosure herein comprises a nucleic acid encoding a polypeptide (e.g., an enzyme mutated or missing in LSD), which is connected to the nucleic acid encoding the TAG (directly or indirectly (e.g., via a linker nucleic acid sequence)). In some embodiments, the tag is located at the N-terminus of the polypeptide. In other embodiments, the tag is located at the C-terminus of the polypeptide. In yet other embodiments, the tag is simultaneously present at the N-terminus and C-terminus of the polypeptide. In some embodiments, more than one tag may be connected (directly or indirectly via a linker) to the polypeptide.

[0083] As provided herein, the terms "therapeutically," "effective amount," or "therapeutically effective amount" of a composition or agent refer to an amount of a composition or agent sufficient to provide a desired response, such as preventing, delaying the onset of, or ameliorating symptoms in a subject, or achieving a desired biological outcome.

[0084] The term "transferrin receptor" or "TfR" refers to a type II homodimeric transmembrane glycoprotein composed of two identical 90kDa subunits connected by two disulfide bonds (Jing and Trowbridge, EMBO J.6 (2): 327-31 (1987); McClelland et al., Cell 39 (2): 267-74 (1984)). Each monomer has a short cytoplasmic N-terminal domain consisting of 61 amino acids containing a YTRF (tyrosine-threonine-arginine-phenylalanine) internalization motif, a single hydrophobic transmembrane segment consisting of 27 amino acids, and a wide C-terminal extracellular domain consisting of 670 amino acids containing a trypsin cleavage site and a transferrin binding site. Each subunit is capable of binding to a transferrin molecule. The extracellular domain has one O-glycosylation site and three N-glycosylation sites, which are particularly important for the correct folding and transport of the receptor to the cell surface. There is also a palmitoylation site in the intramembrane domain that can anchor the receptor and allow its endocytosis. In addition, there is an intracellular phosphorylation site whose function is unknown and which does not play a role in endocytosis.

[0085] As used herein, the term "vector" refers to a nucleic acid molecule capable of transferring a gene sequence to a target cell. Generally, "vector construct", "expression vector" and "gene transfer vector" mean any nucleic acid construct capable of directing the expression of a target gene and capable of transferring a gene sequence to a target cell. Therefore, the term includes cloning and expression vectors and integration vectors. In some aspects, a vector is a virus, including, for example, an encapsulated form of a vector nucleic acid, and a viral particle in which a vector nucleic acid is packaged. In some aspects, a vector is not a wild-type strain of a virus because it comprises artificial mutations or modifications. In some aspects, a vector is derived from a wild-type virus strain by genetic manipulation (i.e., by deletion) to comprise a conditional replicative virus, as further described herein. In some aspects, a vector is delivered by non-viral means. In some aspects, a vector described herein is a gene therapy vector, which is used as a carrier for delivering a polynucleotide sequence to a cell. In some embodiments, a gene therapy vector is a viral vector. In other embodiments, a gene therapy vector is a non-viral vector. In particular aspects, a gene therapy vector described herein is a recombinant AAV vector (e.g., AAV8 or AAV9).

[0086] Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.9, 4, and 5). It should also be understood that all numbers and fractions thereof are assumed to be modified by the term "about."

[0087] Various aspects of the present disclosure are described in detail in the following sections. The use of these sections is not intended to limit the present disclosure. Each section may apply to any aspect of the present disclosure. In this application, unless otherwise indicated, the use of "or" means "and / or". As used herein, unless the context clearly indicates otherwise, the singular forms "a", "an", and "the" include singular and plural referents.

[0088] II. Compositions of the Disclosure

[0089] Some aspects of the present disclosure relate to a viral vector comprising a promoter and a transgene, wherein the transgene comprises (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG. In some aspects, the viral vector comprises an adeno-associated virus, a lentivirus, a retrovirus, a variant thereof, or a combination thereof. Some aspects of the present disclosure relate to a recombinant AAV (rAAV) vector comprising: (a) a 5' inverted terminal repeat (ITR), (b) a promoter, (c) a transgene, wherein the transgene comprises (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG, and (d) a 3'ITR. In some aspects, TAG increases the translocation of the biologically active polypeptide across the blood-brain barrier. In some embodiments, a linker nucleic acid sequence is present between (i) and (ii).

[0090] In some aspects, the transgene comprises (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG in a 5' to 3' order. Thus, in some aspects, the nucleotide sequence encoding the biologically active polypeptide is located 5' to the nucleotide sequence encoding the TAG. In some aspects, the transgene comprises (i) a nucleotide sequence encoding a TAG and (ii) a nucleotide sequence encoding a biologically active polypeptide in a 5' to 3' order. Thus, in some aspects, the nucleotide sequence encoding the biologically active polypeptide is located 3' to the nucleotide sequence encoding the TAG. In some embodiments, a linker nucleic acid sequence is present between (i) and (ii).

[0091] In some aspects, the nucleotide sequence encoding the biologically active polypeptide is connected to the nucleotide sequence encoding the TAG through the nucleotide sequence encoding the peptide linker. In some aspects, the linker is a flexible linker, a cleavable linker, a processable linker or any combination thereof. In some aspects, the linker is a flexible linker. In some aspects, the linker is a cleavable linker.

[0092] A. Bioactive Peptides

[0093] In some aspects, the biologically active polypeptide comprises a therapeutic enzyme, an antibody or its antigen binding portion thereof, a growth factor, a hormone, a cytokine, a chemokine, an inhibitory ligand, an agonist ligand, or any combination thereof. In some aspects, the biologically active polypeptide comprises a protein that corrects a cell dysfunction (e.g., a cell dysfunction in the CNS). In some aspects, the biologically active polypeptide comprises a therapeutic enzyme. In some embodiments, the biologically active polypeptide comprises an enzyme that would otherwise mutate or be missing in the case of a metabolic disorder such as a lysosomal storage disease. In some aspects, the biologically active polypeptide has activity, binds to a target, interacts with a receptor, interacts with a ligand, catalyzes a reaction, or acts as a substrate in the central nervous system (CNS).

[0094] In some aspects, the bioactive polypeptide comprises a therapeutic enzyme. In some aspects, the therapeutic enzyme is active in the CNS. In some aspects, the processing of a substrate in the therapeutic enzyme catalysis CNS, thereby reducing the level of the substrate in the CNS. In some aspects, the therapeutic enzyme is active in one or more other parts of the CNS and health. In some aspects, the processing of a substrate in one or more other parts of the therapeutic enzyme catalysis CNS and health, thereby reducing the level of the substrate.

[0095] In some aspects, the biologically active polypeptide has idursulfase activity. In some aspects, the biologically active polypeptide is idursulfase (I2S) or a functional variant thereof. In some aspects, the biologically active polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, wherein the biologically active polypeptide has idursulfase activity. In some aspects, the biologically active polypeptide comprises the amino acid sequence shown in SEQ ID NO: 1.

[0096] In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2, wherein the biologically active polypeptide encoded by the nucleotide sequence has idursulfase activity. In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 2.

[0097] In some aspects, the nucleotide sequence encoding the biologically active polypeptide is codon optimized. In some aspects, the nucleotide sequence encoding the biologically active polypeptide is codon optimized for expression in the human body. In some aspects, the codon optimized nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the nucleic acid sequence shown in SEQ ID NO: 3 or 4, wherein the biologically active polypeptide encoded by the nucleotide sequence has idursulfase activity. In some aspects, the codon optimized nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence shown in SEQ ID NO: 3 or 4.

[0098] Table 1: Transgenic sequences

[0099]

[0100]

[0101]

[0102]

[0103]

[0104] In some aspects, the biologically active polypeptide has glucocerebrosidase activity. In some aspects, the biologically active polypeptide is glucocerebrosidase (GCB) or a functional variant thereof. In some aspects, the biologically active polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 41, wherein the biologically active polypeptide has glucocerebrosidase activity. In some aspects, the biologically active polypeptide comprises the amino acid sequence shown in SEQ ID NO: 41.

[0105] In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 42, wherein the biologically active polypeptide encoded by the nucleotide sequence has glucocerebrosidase activity. In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 42.

[0106] In some aspects, the biologically active polypeptide has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some aspects, the biologically active polypeptide is N-sulfoglucosamine sulfohydrolase (SGSH) or a functional variant thereof. In some aspects, the biologically active polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 43, wherein the biologically active polypeptide has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some aspects, the biologically active polypeptide comprises the amino acid sequence shown in SEQ ID NO: 43.

[0107] In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 44, wherein the biologically active polypeptide encoded by the nucleotide sequence has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some aspects, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 44.

[0108] B.TAG part

[0109] In some aspects, TAG increases the translocation of biologically active polypeptides across the blood-brain barrier. In some aspects, TAG interacts with receptors on the outer surface of blood-brain barrier endothelial cells. In some aspects, TAG comprises an antibody, an antigen-binding portion of an antibody, a ligand, or any combination thereof. In some aspects, TAG comprises an antibody, wherein the antibody is a VHH, a vNAR, a scFv, a double antibody, a nanobody, a camel antibody, an antigen-binding portion thereof, or any combination thereof. In some aspects, TAG comprises VHH. In some aspects, TAG comprises a vNAR. In some aspects, TAG comprises a scFv. In some aspects, TAG comprises a nanobody.

[0110] In some aspects, TAG interacts with the transferrin receptor on the outer surface of blood-brain barrier endothelial cells. In some aspects, TAG comprises an antigen binding molecule that specifically binds to the transferrin receptor on the outer surface of blood-brain barrier endothelial cells. In some aspects, TAG comprises an antigen binding portion of an antibody that specifically binds to the transferrin receptor on the outer surface of blood-brain barrier endothelial cells. In some aspects, TAG comprises a VHH that specifically binds to the transferrin receptor on the outer surface of blood-brain barrier endothelial cells. In some aspects, VHH specifically binds to human transferrin receptor 1 (TfR1).

[0111] In some aspects, TAG comprises an antigen binding molecule containing a variable heavy chain (VH) domain, wherein VH comprises VH-CDR1, VH-CDR2, and VH-CDR3. In some aspects, VH-CDR-3 comprises an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:13. In some aspects, VH-CDR-2 comprises an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:12. In some aspects, VH-CDR-1 comprises an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:11. In some aspects, TAG comprises: VH-CDR1 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:11, VH-CDR2 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:12, and VH-CDR3 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO:13, wherein TAG specifically binds to TfR1.

[0112] In some aspects, the TAG comprises a VHH, wherein the VHH comprises: a VH-CDR1 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 11, a VH-CDR2 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 12, and a VH-CDR3 comprising an amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO: 13, wherein the VHH specifically binds to TfR1.

[0113] In some aspects, the VHH is encoded by a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 14. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 15. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 16. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 17. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 18. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 19. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 20. In some aspects, the VHH is encoded by the nucleic acid sequence set forth in SEQ ID NO: 21.

[0114] In some aspects, the TAG is any anti-TfR binding protein disclosed in International Publication No. WO / 2020 / 144233, which is incorporated herein by reference in its entirety.

[0115] Table 2: TAG sequences

[0116]

[0117]

[0118]

[0119] C. Viral vector

[0120] A variety of methods can be used to introduce a transgenic vector delivered into a target cell. For example, a viral or non-viral vector can be used to deliver the target transgenic. The method provided herein contemplates both viral and non-viral methods of vector delivery. Therefore, in some aspects, the vector described herein is delivered in a viral vector. In some aspects, the vector described herein is delivered in a non-viral vector.

[0121] Carrier described herein can be introduced into cell as a part of virus or non-viral vector molecule, and described virus or non-viral vector molecule has other sequence, such as for example replication origin, promoter and one or more genes.In some respects, carrier can be used as naked nucleic acid, as with the nucleic acid compounded with the agent such as liposome or poloxamer (poloxamer), or can be delivered by virus (for example adenovirus, adeno-associated virus (AAV), herpes virus, retrovirus, slow virus and integrase defect slow virus (IDLV)).In some respects, carrier is introduced using viral vector.

[0122] Various viral vectors are known in the art and include, for example, integrating or non-integrating vectors. In some aspects, the viral vector is a non-integrating viral vector. Non-integrating viral vectors include, for example, non-integrating lentiviral vectors or AAV vectors. Therefore, in some aspects, the viral vector is an adeno-associated virus (AAV) vector.

[0123] In some aspects, the AAV vector is modified in one or more regions, such as the AAV capsid. In some aspects, the viral vector is selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 with a ubiquitous promoter. In some aspects, suitable viral vectors with wide tropism can be engineered with a combination of elements of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 with a ubiquitous promoter.

[0124] In some aspects, the viral vectors encompassed by the present disclosure comprise a tissue-specific promoter, such as a liver-specific promoter upstream of the nucleic acid sequence encoding the I2S polypeptide linked to the anti-TfR1 VHH.

[0125] In some aspects, the intrinsic transgenic expression system provided herein comprises a viral vector, which improves exposure or distribution of a transgenic (e.g., a transgenic encoding an I2S polypeptide connected to an anti-TfR1 VHH) in various tissues of a mammal. In some aspects, the improved exposure or distribution of the I2S polypeptide connected to an anti-TfR1 VHH in various tissues improves symptoms associated with, for example, Hunter syndrome. In some aspects, the use of a viral vector supplements the use of a ubiquitous promoter, thereby providing a robust tissue distribution of the I2S polypeptide connected to an anti-TfR1 VHH. In some aspects, the viral vector is selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 with a ubiquitous promoter. In some aspects, a suitable viral vector with wide tropism can be engineered with a combination element of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 with a ubiquitous promoter. In some aspects, the rAAV vector is a rAAV9 vector.

[0126] In some aspects, the rAAV vectors described herein comprise one or more of the following: (a) 5' inverted terminal repeats (ITRs); (b) a promoter sequence; (c) a transgene encompassed by the disclosure herein, the transgene comprising a nucleic acid sequence encoding a biologically active polypeptide and a nucleic acid encoding a tag; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), (e) poly A; and (f) a 3'ITR sequence. In some aspects, the rAAV vectors described herein comprise one or more of the following: (a) 5' inverted terminal repeats (ITRs); (b) an enhancer sequence; (c) a promoter sequence; (d) a transgene encompassed by the disclosure herein; (e) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), (f) poly A; and (g) a 3'ITR sequence. In some embodiments, the transgene further comprises a nucleic acid linker sequence between the nucleic acid encoding the polypeptide and the nucleic acid sequence encoding the tag.

[0127] In various aspects, the rAAV vectors described herein for delivering the transgenics covered by the disclosure herein can be packaged using techniques known in the art, and as described herein. For example, in some aspects, rAAV packaging utilizes packaging cells to form viral particles capable of infecting host cells. Such cells include, for example, HEK293, HeLa, HEK293T, Sf9 cells or A549 cells, which are used to package adenoviruses. The viral vectors used in gene therapy are generally produced by a production cell line that packages nucleic acid vectors into viral particles. The vector generally contains the minimum viral sequences required for packaging nucleic acids and subsequent transduction into the host, and other viral sequences are replaced by expression cassettes encoding proteins to be expressed. In this case, the transgenic comprises a nucleotide sequence encoding a biologically active polypeptide and a nucleotide sequence encoding TAG. The missing viral function can be provided in trans by a packaging cell line. For example, the AAV vectors used for gene therapy generally only have reverse terminal repeat (ITR) sequences required for packaging and transduction into host cells from the AAV genome. Viral DNA is packaged in a cell line that contains a helper plasmid encoding other AAV genes (i.e., rep and cap) but lacks ITR sequences. The cell line is also transfected with an adenovirus plasmid as an aid. The helper plasmid promotes the replication of the AAV vector and wraps the nucleic acid into a protein capsid. Due to the lack of ITR sequences and packaging size restrictions, the helper plasmid cannot be packaged into AAV. Contamination with adenovirus or adenovirus-derived plasmids can be reduced by inactivation during purification, such as heat treatment, which is more sensitive to heat treatment than AAV.

[0128] In many gene therapy applications, it is desirable that gene therapy vectors be delivered specifically to specific tissue types. Therefore, the vector designs provided herein have a wide distribution of tissues and cell types once administered to a subject in need thereof. The rAAV vectors described herein may contain any tissue-specific or constitutively active promoter, thereby allowing systemic expression or specific expression in specific tissues (such as the liver).

[0129] In some aspects, the present disclosure encompasses gene therapy vectors comprising modified bioactive polypeptide encoding gene (e.g., I2S gene) sequences. Such modifications can be performed to improve expression characteristics. Such modifications may include, but are not limited to, inserting a translation start site (e.g., methionine), adding a Kozak sequence, inserting a signal peptide, and / or codon optimization. Therefore, in some aspects, a bioactive polypeptide encoding gene (e.g., I2S gene) is modified to include inserting a translation start site. In some aspects, a bioactive polypeptide encoding gene (e.g., I2S gene) is modified to include adding a Kozak sequence. In some aspects, a bioactive polypeptide encoding gene (e.g., I2S gene) is modified to include a signal peptide. In some aspects, a signal peptide includes an immunoglobulin signal peptide. In some aspects, a signal peptide includes an IgG signal peptide. In some aspects, a bioactive polypeptide encoding gene (e.g., I2S gene) is codon optimized. In other aspects, a bioactive polypeptide encoding gene (e.g., I2S gene) is engineered. In yet other aspects, the biologically active polypeptide encoding gene (eg, I2S gene) is codon optimized and engineered.

[0130] In some aspects, the vector comprises an ID tag, such as a stuffer sequence. The purpose of the ID tag includes, for example, the ability of a technician to identify the vector. In some aspects, the vector comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) element. In some aspects, the vector comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Various optimizations or variant forms of WPRE are known in the art, and include WPRE3, WPREmut6delATG, etc. Other variant WPRE forms include, for example, WPRE2, WPRE_wt (GenBank Accession No. J04514); WPRE_wt (GenBank Accession No. J02442) and WPREmut6. The WPRE element may include a wild-type sequence or a modified WPRE element sequence. Various mutant forms of WPRE are known, and include, for example, mut6delATG. In some aspects, the vector comprises mut6delATG.

[0131] Vectors described herein include one or more promoter sequences. In some aspects, the promoter sequence is a ubiquitous promoter sequence. Any suitable promoter region or promoter sequence can be used, as long as the promoter region promotes the expression of the coding sequence in mammalian cells. In some aspects, the promoter region promotes the expression of the coding sequence in mammalian cells. In some aspects, the promoter controlling transgenic expression is a ubiquitous promoter. In some aspects, the ubiquitous promoter is selected from one or more of the following: GAPDH promoter, minimal EF1 promoter, CMV promoter EF-1α promoter, PGK promoter, UBC promoter, LSEβ-glucuronidase (GUSB) promoter or ubiquitous chromatin open element (UCOE) and / or chicken beta actin promoter. In some aspects, the ubiquitous promoter includes a ubiquitous promoter containing: cytomegalovirus (CMV) enhancer, chicken beta actin promoter (CBA) and rabbit beta globin intron.

[0132] In some aspects, the promoter sequence is a tissue-specific promoter sequence. In some aspects, the promoter region promotes the expression of the coding sequence in the liver, i.e., a liver-specific promoter. In some aspects, the promoter includes human TTR, PGK, chicken beta actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSEβ-glucuronidase (GUSB) promoter or ubiquitous chromatin opening element (UCOE) promoter.

[0133] In some embodiments, the ubiquitous promoter comprises CBh (CMV enhancer, chicken β-actin promoter, chicken β-actin MVM hybrid intron). Thus, in some embodiments, the ubiquitous promoter is a chicken β-actin (CBA) promoter. In some embodiments, the ubiquitous promoter is an EF-1α promoter. In some embodiments, the EF-1α promoter is combined with chimeric introns from chicken β-actin and rabbit β-globin genes. In some embodiments, the ubiquitous promoter is a UBC promoter. In some embodiments, the ubiquitous promoter is a LSE β-glucuronidase (GUSB) promoter. In some embodiments, the ubiquitous promoter is a ubiquitous chromatin opening element (UCOE) promoter. (Powell SK et al. Discov Med. 2015 Jan; 19(102): 49-57.)

[0134] In some embodiments, the ubiquitous promoter comprises a cytomegalovirus (CMV) enhancer, a chicken beta actin promoter, and a rabbit beta globin intron.

[0135] In some embodiments, the ubiquitous promoter comprises a shortened EF-1α promoter and one or more introns.

[0136] In some embodiments, one or more introns are from the chicken β-actin and / or rabbit β-globin genes.

[0137] In some aspects, the promoter comprises the following nucleic acid sequence:

[0138] ggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcag cggtgccgaccctgggtctcgcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctacccttgtgggcccccc ggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtctcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctg ctcagcggggcgcgccgagagcagcggccgggaaggggcggtgcgggaggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccag(SEQ ID NO:30)

[0139] In some aspects, the promoter comprises the following nucleic acid sequence:

[0140] aaatgacctattaagaatatttcatagaacgaatgttccgatgctctaatctctctagacaaggttcatatttgtatgggttacttattctctctttgttgactaagtcaataatcag aatcagcaggtttgcagtcagattggcagggataagcagcctagctcaggagaagtgagtataaaagccccaggctgggagcagccatcacagaagtccactcattcttggcagg(SEQ ID NO:31)

[0141] In some aspects, the vectors described herein comprise one or more polyA sequences. In some aspects, the polyA is selected from human growth hormone polyA (hGHpA), synthetic polyA (SPA), simian virus 40 late poly A (SV40pA), and bovine growth hormone (BGH) poly A.

[0142] In some aspects, the present disclosure provides an expression cassette comprising a polynucleotide sequence comprising: (a) 5' inverted terminal repeat (ITR); (b) AAT enhancer and hTTR promoter; (c) a transgene comprising (i) a nucleotide sequence encoding I2S and a linker polypeptide, and (ii) a nucleotide sequence encoding a VHH that specifically binds to hTfR1; (d) optionally, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a mut6delATG mutation; (e) poly A; and (f) 3'ITR. In some aspects, the elements in the above expression cassette are present in a 5' to 3' order. In some aspects, one or more of (a) to (f) are operably linked in a 5' to 3' order.

[0143] In some aspects, the vector is introduced into a cell. Thus, in some aspects, a cell is provided, the cell comprising the vector described herein. In some aspects, the cell is in vitro, in situ, or in vivo. Thus, in some aspects, the cell comprising the vector described herein is in vitro. In some aspects, the cell comprising the vector described herein is in situ. In some aspects, the cell comprising the vector described herein is in vivo.

[0144] D. Pharmaceutical Composition

[0145] Exemplary pharmaceutical compositions comprising the vectors described herein are described in detail below.

[0146] Pharmaceutically acceptable carriers depend in part on the particular composition being administered, as well as the particular method used to administer the composition. Thus, a wide variety of suitable formulations of pharmaceutical compositions may be used.

[0147] Preparations for both ex vivo and in vivo administration include suspensions in liquids or emulsified liquids. The active ingredient is usually mixed with a pharmaceutically acceptable excipient that is compatible with the active ingredient. Suitable excipients include, for example, water, saline, glucose, glycerol, ethanol, etc. and combinations thereof. In addition, the composition may contain a small amount of auxiliary substances, such as wetting agents or emulsifiers, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition.

[0148] III. Methods of the Disclosure

[0149] Some aspects of the present disclosure relate to methods of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a viral vector disclosed herein (e.g., a rAAV vector). Some aspects of the present disclosure relate to methods of delivering a biologically active polypeptide across the blood-brain barrier in a subject, comprising administering to the subject a viral vector disclosed herein (e.g., a rAAV vector).

[0150] In some respects, the disease or illness comprises a neuronal disease. In some respects, the disease or illness comprises one or more manifestations affecting the CNS. In some respects, the disease or illness comprises a defect in the CNS. In some respects, the disease or illness comprises a deficiency in the CNS.

[0151] In some aspects, the disease or illness comprises the accumulation of high concentration substrates in the CNS of the subject. In some aspects, the disease or illness comprises the accumulation of high concentration I2S substrates (e.g., lysosomal glycosaminoglycans (GAGs)) in the CNS of the subject. In some aspects, the disease or illness comprises mucopolysaccharidosis (MPS). In some aspects, the disease or illness comprises Hurler's syndrome (also referred to as MPS I). In some aspects, the disease or illness comprises Hunter syndrome (also referred to as MPS II). In some aspects, the disease or illness comprises Sanfilippo syndrome (also referred to as MPS III). In some aspects, the disease or illness comprises Sly syndrome (also referred to as MPS VII). In some aspects, the disease or illness comprises Gaucher disease. In some aspects, the disease or illness comprises metachromatic leukodystrophy. In some aspects, the disease or illness comprises Krabbe disease. In some aspects, the disease or illness comprises GM1 gangliosidosis.

[0152] In some aspects, the disease or illness include I2S defects (e.g., Hunter syndrome). In some aspects, using viral vectors disclosed herein (e.g., rAAV vectors) causes the I2S levels of the subject to increase. In some aspects, systemic I2S levels are observed to increase. In some aspects, using viral vectors disclosed herein (e.g., rAAV vectors) causes the I2S levels in the CNS of the subject to increase. In some aspects, the I2S levels of increase continue at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 15 months, at least about 18 months, at least about 21 months, at least about 2 years or longer. In some aspects, functional levels of an I2S polypeptide can be detected in plasma, serum, or CSF for at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, or at least about 20 years after administration of a viral vector (e.g., a rAAV vector).

[0153] In some aspects, use viral vector disclosed herein (for example, rAAV vector) to cause the GAG ​​level of experimenter to reduce.In some aspects, the GAG ​​level in whole body and CNS can reduce.In some aspects, compared with the GAG ​​level in experimenter before use, the GAG ​​level after using viral vector disclosed herein (for example, AAV vector) is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2% or less than about 1%. In some aspects, following administration of a viral vector (e.g., an AAV vector), the level of GAGs in a subject is comparable to the level of GAGs in a healthy subject, e.g., ± less than about 10%, ± less than about 9%, ± less than about 8%, ± less than about 7%, ± less than about 6%, ± less than about 5%, ± less than about 4%, ± less than about 3%, ± less than about 2%, or ± less than about 1%.

[0154] In some aspects, the level of GAG in the brain of a subject after administration of a viral vector disclosed herein (e.g., an AAV vector) is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%, compared to the level of I2S substrate in the brain of the subject before administration. In some aspects, following administration of a viral vector (e.g., an AAV vector), the level of GAGs in the subject's brain is comparable to the level of GAGs in the brain of a healthy subject, e.g., ± less than about 10%, ± less than about 9%, ± less than about 8%, ± less than about 7%, ± less than about 6%, ± less than about 5%, ± less than about 4%, ± less than about 3%, ± less than about 2%, or ± less than about 1%.

[0155] In some aspects, administration of a rAAV comprising an I2S transgene reduces GAG levels in a subject for at least about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more than 5 years. In some aspects, administration of a rAAV comprising an I2S transgene reduces GAG levels in the brain of a subject for at least about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more than 5 years.

[0156] Viral vectors disclosed herein (e.g., rAAV vectors) can be administered using any approach. In some aspects, viral vectors (e.g., rAAV vectors) are administered by intravenous, intraperitoneal, intraarterial, intrathecal (cistern, lumbar puncture), subcutaneous or intradermal administration. In some aspects, viral vectors (e.g., rAAV vectors) are administered by intravenous administration. In some aspects, intradermal administration includes administration by using a "gene gun" or biolistic particle delivery system. In some aspects, viral vectors (e.g., rAAV vectors) are administered via non-viral lipid nanoparticles. For example, a composition comprising a viral vector (e.g., rAAV vector) may include one or more diluents, buffers, liposomes, lipids, lipid complexes. In some aspects, viral vectors (e.g., rAAV vectors) are contained in microspheres or nanoparticles such as lipid nanoparticles.

[0157] The compositions and methods of the present invention may also be used in combination with other therapies known in the art for treating Hunter syndrome or its complications, including but not limited to enzyme replacement therapy (eg, I2S).

[0158] Methods for producing and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO 2003 / 042397; WO 2005 / 033321; WO 2006 / 110689; and US 7,588,772 B2. In one system, a cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct encoding rep and cap. In a second system, a packaging cell line that stably provides rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpes virus, and it is necessary to separate rAAV from contaminating viruses. Recently, systems have been developed that do not require infection with a helper virus to recover AAV (i.e., adenovirus E1, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase), which are also provided in trans. In these newer systems, the helper function can be provided by transiently transfecting the cells with a construct encoding the desired helper function, or the cells can be engineered to stably contain a gene encoding the helper function, the expression of which can be controlled at the transcriptional or post-transcriptional level.

[0159] In some aspects, the expression cassette flanked by the ITRs and the rep / cap gene are introduced into the desired cell or cell line by infection with a baculovirus-based vector.

[0160] In some aspects, expression cassettes flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For a review of these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of which are incorporated herein by reference in their entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. Patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, for example, Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med 10: 717-733; and the references cited below, each of which is incorporated herein by reference in its entirety.

[0161] Methods for constructing vectors as described herein are known to those skilled in the art of nucleic acid manipulation, and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Similarly, methods for producing rAAV virions are well known, and selection of an appropriate method is not a limitation of the present invention. See, e.g., K. Fisher et al., (1993) J. Virol, 70: 520-532 and U.S. Pat. No. 5,478,745.

[0162] Many plasmids and other cloning and expression vectors that can be used according to the present invention are well known and readily available to those skilled in the art. In addition, those skilled in the art can easily construct any number of other plasmids suitable for use with the present invention. The properties, construction, and use of such plasmids and other vectors in the present invention will be apparent to those skilled in the art in light of this disclosure.

[0163] In one aspect, the production plasmid is a plasmid described herein, or a plasmid as described in WO2012 / 158757, which is incorporated herein by reference. Various plasmids are known in the art for producing rAAV vectors and are useful herein. The production plasmid is cultured in a host cell expressing AAV cap and / or rep proteins. In the host cell, each rAAV genome is rescued and packaged into capsid proteins or envelope proteins to form infectious viral particles.

[0164] In some aspects, rAAV expression cassette, vector (such as rAAV vector), virus (such as rAAV), production plasmid comprises AAV reverse terminal repeat sequence, the codon optimized nucleic acid sequence of the I2S polypeptide connected with anti-TfR1 VHH sequence and the expression control sequence of instructing the expression of the encoded protein is present in the host cell. In other aspects, rAAV expression cassette, virus, vector (such as rAAV vector), production plasmid further comprises one or more of enhancer, promoter, intron, Kozak sequence, polyA, post-transcriptional regulatory element etc. In one aspect, post-transcriptional regulatory element is woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE). In various aspects, nucleic acid sequence comprises the signal peptide of the upstream of the transgenic of the I2S polypeptide connected with anti-TfR1 VHH sequence. In some aspects, signal peptide is located at the N-terminal of the I2S polypeptide connected with anti-TfR1 VHH sequence. In some aspects, signal peptide is located at the C-terminal of the I2S polypeptide connected with anti-TfR1 VHH sequence.

[0165] A variety of methods related to the production and purification of AAV vectors are known in the art. See, for example, Mizukami, Hiroaki, et al. A Protocol for AAV vector production and purification, available at dnaconda.riken.jp / rvd / SOP / AAV / AAVProtocol.pdf; U.S. Patent Publication Nos. US20070015238 and US20120322861. For example, a plasmid containing a gene of interest can be combined with one or more auxiliary plasmids, such as an auxiliary plasmid containing a rep gene (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and a cap gene (encoding VP1, VP2, and VP3, including the modified VP2 region described herein), and transfected into a recombinant cell so that rAAV can be packaged and subsequently purified.

[0166] In some aspects, packaging is performed in a helper cell or a production cell, such as a mammalian cell or an insect cell. Exemplary mammalian cells include, but are not limited to, HEK293 cells, COS cells, HeLa cells, BHK cells, or CHO cells (see, e.g., CRL-1573 TM , CRL-1651 TM , CRL-1650 TM , CCL-2, CCL-10 TM or CCL-61 TM ). Exemplary insect cells include, but are not limited to, Sf9 cells (see, e.g. CRL-1711 TM ). The helper cells may contain a rep gene encoding a Rep protein and / or a cap gene encoding a Cap protein for use in the methods described herein. In some aspects, packaging is performed in vitro.

[0167] In some aspects, a plasmid containing the gene of interest is combined with one or more helper plasmids, such as a helper plasmid containing the rep gene of a first serotype and the cap gene of the same serotype or a different serotype, and transfected into helper cells such that the rAAV is packaged.

[0168] In some aspects, one or more auxiliary plasmids include a first auxiliary plasmid comprising a rep gene and a cap gene and a second auxiliary plasmid comprising one or more of the following auxiliary genes: Ela gene, Elb gene, E4 gene, E2a gene and VA gene. For clarity, auxiliary genes are genes encoding auxiliary proteins Ela, Elb, E4, E2a and VA. In some aspects, the cap gene is modified so that one or more of proteins VP1, VP2 and VP3 are not expressed. In some aspects, the cap gene is modified so that VP2 is not expressed. Methods for carrying out such modifications are known in the art (Lux et al. (2005), J. Virology, 79: 11776-87).

[0169] Helper plasmids and methods for making such plasmids are generally known in the art and are generally commercially available (see, e.g., pDF6, pRep, pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from Plasmid Factory, Bielefeld, Germany; other products and services are available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA; Agilent Technologies, Santa Clara, CA; and Addgene, Cambridge, MA; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adeno associated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kem, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type2Capsids, Journal of Virology, Volume 77, 11072-11081; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al., J. Virol. 79(9):5296-5303 (2005)).

[0170] Example

[0171] Example 1 - Evaluation of gene therapy constructs expressing liver-specific or ubiquitous promoter-driven VHH-I2S in a Hunter disease mouse model

[0172] Hunter disease is characterized by defective activity of the lysosomal enzyme iduronate-2-sulfatase (I2S). The defective enzyme activity leads to pathological accumulation of lysosomal glycosaminoglycans (GAGs), which ultimately leads to progressive damage and dysfunction of cells, tissues, and organs throughout the body.

[0173] This example demonstrates that gene therapy constructs expressing VHH-I2S driven by either a liver-specific or ubiquitous promoter achieve significantly higher brain activity and GAG clearance than constructs expressing untagged I2S in a Hunter disease mouse model.

[0174] The presence of the VHH tag does not impede I2S expression or catalytic activity

[0175] Plasmids expressing I2S with and without VHH tags (Table 3) were first transfected into Huh7 cells and then tested in a Hunter disease mouse model. The molecular weight of the protein products of these plasmids confirmed the integrity of the labeled I2S. The purified protein was then analyzed for I2S activity. It is worth noting that the activity of the labeled I2S protein was similar to that of the unlabeled I2S protein (Table 4). These results indicate that the presence of the VHH tag does not hinder the catalytic activity of I2S.

[0176] Evaluation of the binding affinity of VHH-I2S and I2S-VHH to mouse and human TfR1 receptors via surface plasmon resonance analysis (Table 5). VHH-I2S binds to hTfR1 with subnanomolar affinity and to mouse TfR1 with single-digit nanomolar affinity.

[0177] Table 3: Description of tool molecules driven by liver-specific promoters fused with VHH and I2S (GTH077, GTH071, GTH074) and tool molecules driven by ubiquitous promoters fused with VHH and I2S (GTH075, GTH069, GTH072)

[0178] Constructs Promoter genetically modified GTH077 Liver specific I2S GTH071 Liver specific I2S-VHH GTH074 Liver specific VHH-I2S GTH075 Ubiquitous I2S GTH069 Ubiquitous I2S-VHH GTH072 Ubiquitous VHH-I2S

[0179] Table 4: hI2S activity is not affected by VHH tag

[0180]

[0181] Table 5: Preliminary binding affinity of purified hI2S protein to mouse and human transferrin receptor 1 (TFR1)

[0182] protein <![CDATA[K d mTFR1(M)]]> <![CDATA[K d hTFR1(M)]]> I2S Comparison Unbound Unbound I2S-VHH Unquantified 2.3E-08 VHH-I2S 1.3E-09 1.6E-10

[0183] Liver-directed gene therapy constructs expressing VHH-I2S showed significantly higher brain activity and GAG clearance than constructs expressing untagged I2S.

[0184] Next, plasmids expressing tagged and untagged I2S were packaged into rAAV9 capsids and evaluated in 8-12 week old male IdsKO mice. rAAV9-MY011(null) treated groups and wild type (WT:WT) littermate vehicle treated groups were used as controls and evaluated in a 4 week study. For tool molecules with liver specific promoters (GTH077, GTH071, GTH074), 2.5x10 12 vg / kg and 6.25x10 12 vg / kg doses were administered using a single intravenous administration, and for tool molecules with ubiquitous promoters (GTH075, GTH069, GTH072) only at 2.5x10 12 vg / kg dose using a single intravenous administration.

[0185] Mice treated with rAAV9-GTH071(I2S-VHH) and rAAV9-GTH074(VHH-I2S) showed significantly higher brain hI2S activity compared to mice treated with the unlabeled control rAAV9-GTH077(I2S) ( Figure 1A This resulted in a significant reduction (>90%) in heparan sulfate (HS) GAG in the brain ( Figure 1B and Table 6), and CSF GAG was normalized to WT levels ( Figure 1C and Table 6).

[0186] Table 6: The number of cells expressing rAAV9-GTH077 (I2S), rAAV9-GTH071 (I2S-VHH), or rAAV9-GTH074 (VHH-I2S) at 2.5 x 10 12 vg / kg and 6.25x10 12 The percentage of heparan sulfate reduction in the brain and CSF of mice treated with vg / kg

[0187]

[0188]

[0189] Immunohistochemical analysis of brain tissue confirmed the presence of hI2S exposure in neurons of deep brain regions such as the thalamus and hippocampus, and a subsequent reduction in lysosomal burden measured by LAMP1 staining (Figures 2 and 3). Specifically, intravenous administration of rAAV9-GTH074 (VHH-I2S) normalized LAMP1 staining in the cortex, hippocampus, and thalamus of I2SKO mice to WT levels. This clearly demonstrates that the N-terminally tagged VHH-I2S protein produced in the liver is able to more effectively penetrate the BBB to cross-correct HS GAG accumulation in the brain and CSF, significantly better than untagged I2S.

[0190] In contrast, administration of rAAV9-GTH074(VHH-I2S) resulted in the lowest levels of circulating hI2S compared with administration of equivalent doses of rAAV9-GTH077(I2S) or rAAV9-GTH071(I2S-VHH) (Figure 4), likely due to increased tissue uptake. Strong hI2S activity was detected in all key tissues examined, including the lung ( Figure 4C ),liver( Figure 4B ),marrow( Figure 4D ),heart( Figure 4E ) and kidneys( Figure 4F ). hI2S activity in peripheral tissues resulted in normalization of heparan sulfate levels in these tissues as well as in the spleen and quadriceps to WT levels (Table 7). This clearly demonstrates that N-terminally tagged VHH-I2S protein produced in the liver is able to more efficiently penetrate the BBB, be taken up by neurons, and robustly cross-correct HS GAG accumulation in the brain and CSF, significantly better than untagged I2S, as well as resulting in substantial clearance of GAGs from key peripheral organs within 4 weeks of administration.

[0191] Gene therapy constructs expressing ubiquitous promoter-driven VHH-I2S showed significantly higher brain activity and GAG clearance than constructs expressing untagged I2S.

[0192] In 2.5x10 12The same pattern of I2S expression and GAG reduction was observed in animals treated with rAAV9 vectors expressing I2S driven by a ubiquitous promoter at a dose of 100 vg / kg. Significantly higher hI2S activity was observed in the brains of mice treated with rAAV9-GTH069 (I2S-VHH) or rAAV9-GTH072 (VHH-I2S) compared to mice treated with rAAV9-GTH075 (I2S) (Figure 5). Thus, significantly greater GAG reduction was also observed in the brains and CSF of animals treated with rAAV9-GTH072 (VHH-I2S) compared to the other groups (Figure 5). Strong hI2S exposure was measured in all tissues tested ( Figure 6A-6F ), and resulted in normalization of GAG levels in peripheral tissues such as liver and spleen (Table 7).

[0193] Table 7: Percentage of HS GAGs remaining in the CNS and key peripheral tissues after treatment of IdsKO mice with the indicated molecules.

[0194]

[0195]

[0196] In IdsKO mice treated with a gene therapy construct expressing I2S, sustained hI2S activity was observed in serum over a 4-week study

[0197] All rAAV9-based GT constructs, regardless of the promoter used, resulted in sustained supraphysiological levels of circulating hI2S activity compared with WT normal mice from week 1 to week 4 of the study ( Figure 7A-7B ). In 2.5x10 12 At 1.4 vg / kg dose, gene targeting (GT) constructs with ubiquitous promoters (GTH075, GTH069, GTH072) resulted in higher serum hI2S activity than GT constructs with liver-specific promoters (GTH077, GTH071, GTH074).

[0198] Materials and methods

[0199] Identification of single domain anti-TfRl antibodies: Various approaches using phage and yeast display technologies were used to identify anti-TfRl single domain antibodies (sdAbs) utilizing a combined in vivo and in vitro approach to ensure a large and diverse set of binders were obtained from the library.

[0200] The discovery of sdAbs can come from camelid immunization (immune libraries) or from a simple synthetic library approach.

[0201] The sdAb can be derived from camels, alpacas, camelids, or can be from synthetically designed sources. Depending on the library used, the sdAb can have a full camelid, humanized or human framework. The sdAb can have CDR sequences of camelids, humans or a combination thereof.

[0202] Generation of recombinant enzyme-antibody fusion proteins: Plasmids containing polynucleotide sequences of different his-tagged enzyme-single domain antibody (sdAb) fusion proteins (e.g., VHH-I2S and I2S-VHH) were generated. The sdAb was fused to the N-terminus or C-terminus of the enzyme and connected by a short linker (5G).

[0203] Use a flow electroporation system (such as the MaxCyte MaxCyte or MaxCyte The plasmid was introduced into the host cells (CHO cells) using a transfection system. The transfected host cells expressed the enzyme-sdAb protein at a level sufficient to allow fed-batch cell culture. The conditioned medium of the transfected cells was collected 6 days after transfection and used for purification.

[0204] The protein was purified using an affinity column followed by a SEC column. A 5 ml complete His-tag purification column (Cat. No. 06781535001) was pre-equilibrated with PBS. 1 L of CM was loaded onto the column and rinsed with PBS. The column was washed with PBS, 1 M NaCl, followed by PBS. The protein was eluted with PBS, 250 mM imidazole, pH 7.5. The eluted peak was collected and loaded onto a 5 ml column pre-equilibrated with PBS. 16 / 600 200 pg (Cat. No. 28-9893-35). 2 ml fractions were collected along 1.2 CV. Elution peak fractions were analyzed on SDS-PAGE and pooled based on peak shape and appearance on the gel. The purified protein was formulated in 1xPBS pH 7.4.

[0205] Surface plasmon resonance (SPR) determination: Biacore 8K+ instrument (Cytiva; Danaher Corporation) is used to determine the binding affinity between human / mouse receptor and iduronate 2 sulfatase or idurosulfase (I2S) labeled with anti-transferrin receptor binding single domain antibody (VHH). In this experiment, the sample is fixed on S series sensor chip CM5 (catalog number 29104988) via amine coupling. The immobilized sample (ligand) is i) I2S-VHH ii) VHH-I2Siii) I2S as negative control iv) Holo transferrin peptide as positive control. The 1ug / mL ligand reconstructed in acetate at pH 4.0 is fixed on a single flow cell for 420s, reaching a final immobilization level of about 350 response units. Recombinant human TfR protein (R&D Systems; catalog number 2474-TR) and mouse TfR1 (TR06671428-001; Takeda) were injected onto this surface (as analytes) at concentrations ranging from 5ug / mL, 2.5ug / mL, 1.25ug / mL, 0.625ug / mL, and 0.156ug / mL. The analyte series was injected for 120s, followed by a dissociation phase, the duration of which allowed the analyte to achieve at least 10% dissociation. The resulting sensorgrams were analyzed using a 1:1 binding model.

[0206] Plasmids: Plasmids expressing human idursulfase (I2S) with and without anti-hTfR1 receptor binding single domain antibody (VHH) under a liver-specific promoter were first tested in Huh7 cells via transfection. Plasmids expressing human idursulfase (I2S) with and without anti-hTfR1 receptor binding single domain antibody (VHH) under a liver-specific promoter or a ubiquitous promoter were tested in the Hunter disease mouse model.

[0207] Transfection: Huh7 (human hepatoma) cells were transfected with a plasmid expressing hI2S using a Lipofectamine 3000 kit (Thermo Fisher Scientific) according to the manufacturer's instructions. In brief, cells were seeded in 12-well plates at 125,000 cells per well, 1 mL of growth medium per well, and maintained overnight at 37°C, 5% CO2. On the second day, fresh culture medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul P3000 reagent, 1.5 ul of Lipofectamine 3000, and sufficient OptiMEM culture medium, to make up 100 ul, and incubated at room temperature for 10 to 15 minutes. This mixture was then added to the cells and incubated overnight at 37°C, 5% CO2. On the second day, the culture medium was renewed, and the cells were incubated for another day, and the supernatant was then collected for analysis of I2S activity.

[0208] Viral vectors: rAAV9 stock was produced using HEK-293T cells by adenovirus-free, three-plasmid co-transfection method and purified using column chromatography and cesium chloride ultracentrifugation. The titer of viral genome (vg) particle number was determined by droplet digital PCR. The following recombinant adeno-associated viral vectors expressing I2S under a liver-specific promoter (GTH071, GTH074, and GTH077) or the following recombinant adeno-associated viral vectors expressing I2S under a ubiquitous promoter (GTH069, GTH072, and GTH075) were prepared in a formulation buffer consisting of 1.5 mM KH2PO4, 2.7 mM KCI, 8.1 mM Na2HPO4, 136.9 mM NaCl, and 0.001% Pluronic F-68. Constructs GTH069 and GTH071 express I2S with a C-terminal single domain antibody (VHH) tag that binds to transferrin receptor (TfR1), while GTH072 and GTH074 express I2S with an N-terminal VHH tag. Plasmids GTH075 and GTH077 express untagged I2S. A null vector with rAAV9 capsid (rAAV9-MY011) was used as a control.

[0209] Animals: The Mus musculus IdsKO mouse model was generated by targeted disruption of the X-linked I2S locus (replacing exon 5 and part of exon 4 with a neomycin resistance gene expression cassette, deleting 1.5 kb), thereby completely eliminating endogenous I2S enzyme activity (Muenzer et al. 2002). IdsKO mice exhibit a progressive, degenerative phenotype, including both peripheral and neurological symptoms that correspond to the clinical condition. Due to limited I2S activity, glycosaminoglycan (GAG) accumulation is present in urine, liver, kidney, spleen, heart, and brain, accompanied by vacuolization and increased lysosomal size, which is confirmed by LAMP-1 staining in the IdsKO model at 3 months (Garcia et al. 2007; Cardone et al. 2006).

[0210] In vivo studies: 10-12 week old I2Sko male mice were intravenously administered a single dose of 2.5x10 12 vg / kg or 6.25x10 12vg / kg, and monitored for 4 weeks after administration. WT:WT sibling mice with the same genetic background are used as controls, and only vehicle is administered. Based on body weight before administration, mice are assigned to each test article group in a semi-randomized process to ensure that each group is balanced. Serum is collected at multiple time points during the study. Blood is collected via submandibular or caudal vein during the study, and blood is collected via cardiac puncture at the end of the study, and then processed to collect serum. At the end of the study, terminal serum is collected, and mice are perfused for collecting organs (including liver, lung, bone marrow, kidney and heart). The tissue is then quickly frozen in dry ice and stored at -80 ℃ The samples were fixed with 10% neutral buffered formalin (NBF) for histological evaluation. Analytical evaluation included measurement of I2S enzyme activity, as well as analysis of substrate levels in serum and various tissues.

[0211] Idursulfase activity: The tissue was homogenized in lysis buffer containing 10 mM HEPES and 0.5% Triton-X 100 and 1.5x Halt protease inhibitor cocktail, EDTA-free, centrifuged and the supernatant was collected for analytical determination. Idursulfase activity in the supernatant or serum was measured using a two-step activity assay using a fluorescent substrate. During the first step (1), the lysosomal enzyme idursulfase (I2S) hydrolyzes 4-methylumbelliferyl α-L-iduronidase-2-sulfate (4-MUS) to 4-methylumbelliferyl α-L-iduronidase (MUBI). During the second step (2), another lysosomal enzyme α-L-iduronidase (IDUA) hydrolyzes MUBI to the final product 4-methylumbelliferyl α-L-iduronidase (4-MU). 4-MU emits fluorescence, and the signal can be quantified. In brief, 10ul of biological sample was incubated with 20uL of 4-MUS solution at 37°C for 60 minutes. After 1 hour, add 45ul IDUA solution, and incubate at 37 ℃ for 4 hours.Terminate the enzymatic reaction by adding 200uL 0.5M sodium carbonate stop solution (pH 10.7).Measure 4-MU product by fluorescence plate reader at excitation wavelength 365nm and emission wavelength 450nm.The concentration of 4-MU in the test sample is calculated by the 4-MU calibration curve in the same plate.Tissue activity is normalized to the total protein concentration determined by BCA assay (Thermo Scientific, catalog number 23225).

[0212] Heparan sulfate glycosaminoglycan quantification: Substrates from serum and tissue samples were analyzed using an LC-MS method. Samples were first extracted using chloroform:methanol (vol / vol 2:1) and formic acid and then run on HPLC and LC-MS / MS (Applied Biosystem API5000, turbo ion spray ionization, positive ion mode).

[0213] Statistical analysis methods: All statistical analyses were performed in GraphPad Prism software version 8 using one-way analysis of variance (ANOVA) or two-way ANOVA with multiple comparisons, including but not limited to Dunnette and Turkey post hoc tests. The analysis of the treatment groups was compared with the control group as shown in each figure. P values ​​< 0.05 are marked with "*", < 0.01 are marked with "**", < 0.001 are marked with "***" and < 0.0001 are marked with "****".

[0214] Example 2 - Evaluation of plasmids expressing GCB-VHH in a mouse model of Gaucher disease

[0215] Gaucher disease is characterized by a defect in the lysosomal enzyme β-glucocerebrosidase (GCB), with subsequent accumulation of the enzyme substrate glucocerebroside primarily in the liver, spleen, and bone marrow.

[0216] This example shows that administration of GCB-VHHs results in high brain exposure of GCB in the D409V mouse model of Gaucher disease. The D409V mouse model carries a homozygous single-point mutation in the mouse Gba1 gene and results in 5% residual GCB activity in the periphery, 18% residual GCB activity in the CNS, accumulation of glycolipids, GL1, and lyso-GL1 (Sardi et al., 2013, PNAS 110(9):3537-42). Substrate accumulation and associated neurological symptoms, including epilepsy, motor dysfunction, and memory impairment, begin to be progressive and evident at 10-14 weeks (Dai et al., 2016, PLoS One 11(9):e0162367).

[0217] The presence of the VHH tag does not impede GCB expression, secretion or catalytic activity

[0218] Plasmids expressing GCB with anti-transferrin receptor binding nanobody (VHH) tags at the C-terminus (pGTG077) or GCB without any tags (pGTG072) were transfected into Huh7 (human liver) cells, and then cell lysates and supernatants were collected to analyze GCB activity. Fig. 8A ) or supernatant ( Figure 8B ) when assessed by PCR. The fusion tag did not inhibit GCB activity or secretion compared to untagged GCB.

[0219] In D409V mice, hydrodynamic tail vein (HTV) injection of a plasmid expressing GCB-VHH resulted in significantly higher brain exposure of GCB than that of a plasmid expressing untagged GCB.

[0220] D409V mice injected with plasmid pGTG077 using hydrodynamic tail vein injection (HTV) as described below in the "Methods and Materials" section had significantly higher levels of GCB activity in the brain compared to mice injected with pGTG072 ( Fig. 9A This leads to GL-1 in the brain ( Fig. 9B ) and lyso-GL1 levels ( Fig. 9C ) was slightly decreased. This higher brain exposure was not due to increased GCB production or secretion, as liver ( Fig. 10B ) and circulation (assessed via serum; Fig. 10A GCB was also found in other tissues examined, such as the spleen ( Fig. 10C ), indicating that GCB is absorbed by these tissues.

[0221] Materials and methods

[0222] Plasmids: Plasmids expressing human glucocerebrosidase (GCB) with and without an anti-hTfR1 receptor-binding single domain antibody (VHH) tag under a liver-specific promoter were first tested in Huh7 cells via transfection and then in a mouse model of Gaucher disease. pGTG072 expressed untagged GCB, while pGTG077 expressed GCB-VHH.

[0223] Transfection: Huh7 (human hepatoma) cells were transfected with a plasmid expressing GCB using a Lipofectamine 3000 kit (Thermo Fisher Scientific) according to the manufacturer's instructions. In brief, cells were seeded in 12-well plates at 125,000 cells per well, 1 mL growth medium per well, and maintained overnight at 37°C, 5% CO2. On the second day, fresh medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul P3000 reagent, 1.5 ul of Lipofectamine 3000, and sufficient OptiMEM medium, to make up 100 ul, and incubated at room temperature for 10 to 15 minutes. This mixture was then added to the cells and incubated overnight at 37°C, 5% CO2. On the second day, the medium was renewed, and the cells were incubated for another day, and the supernatant was then collected for GCB activity analysis.

[0224] Animals: In this example, the Mus musculus D409V mouse model was used.

[0225] Hydrodynamic gene delivery: Hydrodynamic tail vein injection (HTV) was performed according to the method described by Zhang et al., Hum. Gene Ther. 10: 1735-37 (1999) and Herweijer and Wolff, Gene Ther. 14: 99-107 (2007). Briefly, mice were administered with the test article (plasmid) in a solution with a volume equivalent to 8% of the animal weight (based on mL / g). The injection period did not exceed 8 seconds.

[0226] In vivo studies: Male D409V mice aged 8-12 weeks were administered 50 ug of plasmid DNA each via hydrodynamic gene delivery via tail vein injection. A group was included in the study in which D409V mice were injected with buffer only as a negative control. Animals were sacrificed 2 days after injection. Serum was collected by cardiac puncture at the end point, and tissues such as brain, liver and spleen were collected after perfusion with PBS. Samples were snap frozen and stored at -80 ℃ Serum and tissue samples were analyzed for GCB activity and GL-1 and lyso-GL1 levels.

[0227] GCB activity assay: Tissues were lysed in cold lysis buffer (10 mM HEPES; 0.5% Triton-X 100 and 2x Halt protease inhibitor cocktail, EDTA-free (Thermo Fisher, Halt protease inhibitor cocktail, 100x, EDTA-free, catalog number 78425) at a concentration of 250 mg tissue per mL, followed by freeze-thaw cycles three times. Lysates were centrifuged at 16,000 x g for 10 minutes at 4°C, and supernatants were collected for BCA (to normalize protein levels) and activity assays.

[0228] GCB activity is assessed using a fluorometric assay that measures the ability of GCB to hydrolyze substrate 4-MU-pyranoglucoside (4-MU-GPS, Sigma, catalog number M3633) to 4-methylumbelliferone (4-MU). Briefly, biological samples appropriately diluted in sample buffer (0.05M citric acid, 0.1M sodium phosphate, 2mg / mL BSA, pH 5.0) are incubated with 4-MU-GPS in a substrate solution (0.05M citric acid, 0.1M sodium phosphate, 0.3% tween-20, 0.6% sodium taurocholate, pH 5.0, 5x higher than Km=1mM) at 37°C for 60 minutes. Enzymatic reaction is terminated by adding a glycine carbonate stop solution (pH 10.7) (333mM glycine, 207mM sodium carbonate). 4-MU product is measured by a fluorescence plate reader at an excitation wavelength of 360nm and an emission wavelength of 465nm. The concentration of 4-MU in the test sample was calculated from the 4-MU calibration curve in the same plate. An equivalent plate was run at a final concentration of 3 mM using the lysosomal glucocerebrosidase inhibitor Conduritol B Epoxide (CBE, molecular weight: 162.1 g / mol, Millipore, catalog number 234599) to subtract any non-lysosomal residual activity in all biological samples. One activity unit is expressed as the conversion of 1 millimole of 4-MU-GPS to 4-MU in 1 hour at 37°C.

[0229] GL1 (glucosylceramide) and lyso-GL1 (glucosylceramide) quantification: The substrates in serum and tissue samples were analyzed using an LC-MS method. The samples were first extracted with chloroform:methanol (vol / vol 2:1) and formic acid and then run on HPLC and LC-MS / MS (Applied Biosystem API5000, turbo ion spray ionization, positive ion mode).

[0230] Example 3 - Mucopolysaccharidosis IIIA, Sanfilippo A (San A) disease

[0231] Mucopolysaccharidosis type IIIA, also known as Sanfilippo A (San A) disease, is characterized by mutations in the SGSH gene. These mutations reduce or eliminate the function of the enzyme involved, ultimately impairing the breakdown of heparan sulfate.

[0232] This example shows that injection of a plasmid expressing SGSH-VHH in WT mice results in high brain exposure of SGSH.

[0233] The presence of the VHH tag does not impede SGSH expression, secretion or catalytic activity

[0234] Plasmids expressing SGSH tagged with an anti-transferrin receptor binding nanobody (VHH) were transfected into Huh7 (human liver) cells, and cell lysates and supernatants were then collected to analyze SGSH activity. The fusion tag did not inhibit SGSH activity or secretion compared to untagged SGSH ( Fig.11 ).

[0235] In WT mice, HTV injection of a plasmid expressing SGSH-VHH resulted in significantly higher brain exposure of SGSH than that of a plasmid expressing untagged SGSH.

[0236] The SGSH activity level in the brain of WT mice injected with plasmid pBBB1-SGSH was significantly higher than that of mice injected with pSGSH ( Fig. 12A Compared with SGSH or VHH-SGSH, liver ( Fig. 12C ) and serum ( Fig. 12B ). However, the brain exposure to serum ratio of SGSH-VHH and VHH-SGSH was significantly higher compared with VHH alone ( Fig.13 ).

[0237] Materials and methods

[0238] Plasmids: Plasmids expressing human sulfamidase (SGSH) with and without an anti-hTfR1 receptor binding single domain antibody (VHH) tag under a ubiquitous promoter were first tested in Huh7 cells via transfection and then in a mouse model of SanA disease. pSGSH-BBB1 expresses SGSH tagged with a VHH at the C-terminus, while pBBB1-SGSH expresses SGSH with an N-terminal VHH tag. pSGSH expresses untagged SGSH. Example constructs are as follows Figures 14A-14D shown.

[0239] Transfection: Huh7 (human hepatoma) cells were transfected with plasmids expressing SgSh using the Lipofectamine 3000 kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, cells were seeded in 12-well plates at 125,000 cells per well with 1 mL of growth medium per well and maintained overnight at 37°C, 5% CO2. The next day, fresh medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul of P3000 reagent, 1.5 ul of Lipofectamine 3000, and enough OptiMEM medium to make up to 100 ul and incubated at room temperature for 10 to 15 minutes. This mixture was then added to the cells and incubated overnight at 37°C, 5% CO2. The next day, the medium was renewed, the cells were incubated for another day, and the supernatant was then collected for SgSh activity analysis.

[0240] Animals: In this example, wild-type C57B16 mice were used.

[0241] Hydrodynamic gene delivery: Hydrodynamic tail vein injection (HTV) was performed as previously described.

[0242] In vivo studies: Male WT mice aged 8-12 weeks were administered 50 ug of plasmid DNA each via hydrodynamic gene delivery via tail vein injection. A group was included in the study in which mice were injected with buffer only as a negative control. Animals were sacrificed 2 days after injection. Serum was collected by cardiac puncture at the end point, and tissues such as brain and liver were collected after perfusion with PBS. Samples were snap frozen and stored at -80 ℃ Serum and tissue samples were analyzed for SgSh concentrations.

[0243] SgSh ELISA assay: Immunoquantification of SGSH was performed using the mesoscale discovery (MSD) technology. A total of 100 μL of anti-SGSH antibody R3074 (10 μg / mL) from Shire was diluted in 0.05 M carbonate-bicarbonate buffer (pH 9.6) for coating multiwell plates overnight at 4°C, 200 rpm. After incubation with MSD-A blocking buffer for 1 h, the samples or standards were incubated at 37°C for 1 h, and then 100 μL of rabbit anti-SGSH antibody R3074 (10 μg / mL) coupled to the sulfonyl tag was incubated at 37°C for 1 h. The plate was then incubated with 2X read buffer and read using an MSD instrument. Washing steps between incubations were performed using 0.05% PBS-Tween.

[0244] SgSh activity assay: SGSH activity was measured by mixing 10 μl of sample (cell / tissue lysate) with 20 μl 1 mM 4MUGlcNS in Michaelis' barbital CH3COONa buffer (29 mM sodium barbital, 29 mM CH3COONa, and 0.68% (wt / vol) NaCl; pH 6.5) and incubating at 37°C for 17 h, followed by the addition of 16 μl PiCi buffer (400 mL milliQ H2O, 10.36 g disodium hydrogen phosphate, 2.3 g citric acid, pH to 6.5) and 500 U / mL of a-glucosidase in H2O. The sample was incubated at 37°C for another 5 h, followed by the addition of 0.2 mL glycine buffer (0.5 M Na2CO3 / NaHCO3 0.025% Triton X-100; pH 10.7) to terminate the reaction. The samples were aliquoted into black microtiter plates and fluorescence was measured using a Spectramax M3 reader with an excitation wavelength of 360 nm and an emission wavelength of 460 nm. Enzyme activity was determined by correlating the fluorescence of the samples with that of known concentrations of 4MU and was expressed in nmol / mg protein.

[0245] Example 4 - In vitro model of blood-brain barrier transcytosis

[0246] The transcytosis ability of SGSH-BBB1 (SGSH tagged with VHH at the C-terminus) and BBB1-SGSH (SGSH with an N-terminal VHH tag) was tested using an in vitro model compared to a control SGSH construct that does not contain VHH, as described in Example 3 above. First, the transcytosis of SGSH, SGSH-BBB1 and BBB1-SGSH was measured using Mimetas 3D cell culture organ chip technology. Figures 15A-15B show the percentage of proteins that passed through the chamber after 7 days of treatment with 62.7 μg / ml (Figure 15A) or 31.25 μg (Figure 15B) of SGSH-BBB1 or BBB1-SGSH fusion protein. Although some non-fusion proteins were measured from the transcytosis medium, it is clear that the abundance of the fusion protein in the lower chamber showed an increase of almost 2-fold to 3-fold, indicating that these constructs are able to improve transcytosis compared to the control.

[0247] Next, transcytosis was measured using the transwell model. Transwell plates were prepared with 6, 12, or 24 wells containing a porous filter insert that divides the Transwell into an upper apical or blood compartment and a lower basolateral or brain compartment. A uniform layer of brain endothelial cells (BECs) was seeded on top of the filter and coated with the extracellular matrix (ECM) derived protein collagen I, with or without astrocytes seeded at the apical or basolateral sides. hBMEC cells were seeded in the upper chamber.

[0248] Figure 16C shows a representative graph of the TEER value compared with the cell-free wells after 3 days of inoculation of hBMEC cells. The SGSH activity measured from the transfection medium using fusion and non-fusion SGSH plasmid constructs simultaneously shows similar activity levels (Figure 16B). It was found that after 3 days of treatment with transfection medium collected from Huh7 cells, the percentage of protein passing through the chamber in the BBB1-SGSH construct was more than 3 times higher than that of the SGSH-BB1 construct and the control (Figure 16C), and similar increases were also observed when purified BBB1-SGSH was used (Figure 16D). Transcytosis using this model is dose-dependent (Figure 16E).

[0249] Taken together, these results indicate that upon transfection of human liver cells, the secreted proteins are very similar to the BBB transcytosis observed for the purified proteins. Furthermore, the N-terminal fusion proteins showed better efficacy in terms of higher transcytosis.

[0250] Example 5 - Characterization of MPSIIIA patient fibroblasts

[0251] Fibroblasts obtained from patients with mucopolysaccharidosis type IIIA (MPSIIIA) are characterized by the accumulation of glycosaminoglycans (GAGs). After two days of culture, GAGs were detected using mass spectrometry. It was observed that GAGs accumulated at higher levels in patient fibroblasts (P1, P2, and P3) compared with normal cells (C1 and C2) (Figure 17A). Time- and dose-dependent accumulation of SGSH was observed in fibroblasts (Figures 17B-17C). It was observed that as the number of days in culture increased, SGSH activity in both healthy cells and patient fibroblasts increased.

[0252] Next, the lysosome abundance in the fibroblasts derived from MPSIIA patients is compared with healthy fibroblasts. Cells are seeded in 12-well glass-bottom plates at a density of 75k / well and cultured for five days. Then cells are dyed with lysotrackerred and Hoechst. Representational diagrams illustrate that, compared with the cells of healthy subjects (Figure 18 A-Figure 18 D), the lysosome abundance in patient fibroblasts increases (Figure 18 E-Figure 18 J).

[0253] Example 6 In vivo mouse model of blood-brain barrier transcytosis

[0254] A proof-of-concept study was designed in wild-type mice to evaluate the pharmacokinetics and BBB permeability of a TfRc binding tag fused to the SGSH protein. Transfection of the liver was achieved via the hepatic vein by injecting large amounts of plasmid into the tail vein to generate pressure. Brain, liver, serum, spleen, and kidney samples were collected on day 2 after injection. Human SGSH protein levels and activity were determined and compared with untreated controls.

[0255] Two days after injection, hydrodynamic tail vein injection successfully delivered the GGT plasmid to the liver of WT animals, resulting in the expression of SGSH with and without the BBB1 fusion tag (Figure 19A). SGSH is secreted into the circulation, thereby providing systemic delivery of SGSH protein (Figure 19B). The antibody used for this measurement is for human SGSH, resulting in little or no background level in control mice. SGSH fused to BBB1 in the brain is quantified by MSD (Figure 19C). When animals were treated with SGSH-BBB1 fusion constructs, it was found that the SGSH activity level in the brain was higher than the wild-type level, and brain activity was increased by at least 30% of the wild-type activity (a total of 130%) by 2 days of HTV (Figure 19D). As expected, some activity was observed in control mice because the assay detected the SGSH activity of humans and mice at the same time, and the control mice were healthy mice expected to have normal SGSH activity. Immunohistochemistry of SGSH showed brain biodistribution of SGSH C-terminal and N-terminal fusion constructs in the cerebral cortex ( FIG. 20A , FIG. 20C , and FIG. 20E ) and hippocampus ( FIG. 20B , FIG. 20D , and FIG. 20F ).

[0256] Fluorescent immunohistochemistry was used to determine the biodistribution of SGSH in the brain two days after HTV administration. In the whole section, SGSH co-localized with GFAP staining, indicating strong biodistribution in astrocytes (a key target cell type for MPSIIIA) (data not shown). Some neuronal colocalization of SGSH was also observed.

[0257] To further test the effect of the SGSH BBB1 construct, a MPSIIIA mouse model was developed that contained a knock-in point mutation so that in homozygotes, the animals had about 3%-4% of the wild-type level of SGSH activity (Figures 21A-21D). The model was removed from cryopreservation and reduced SGSH activity and lysosomal dysfunction were verified by lysosomal marker LAMP1 IHC (Figures 21E-21G). The mouse model can be used to further measure the reduction of substrates of various plasmids described herein.

Claims

1. A gene therapy vector comprising: (a) 5' inverted terminal repeat (ITR), (b) a promoter, (c) a transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG, and (d) 3'ITR.

2. The gene therapy vector of claim 1, wherein the biologically active polypeptide comprises a therapeutic enzyme.

3. The gene therapy vector of claim 1 or 2, wherein the biologically active polypeptide reduces the level of a substrate in the central nervous system.

4. The gene therapy vector according to any one of claims 1 to 3, wherein the biologically active polypeptide has idursulfase activity, has glucocerebrosidase activity or has sulfamidase activity.

5. The gene therapy vector according to any one of claims 1 to 4, wherein the biologically active polypeptide is idursulfase (IDS), glucocerebrosidase (GCB) or sulfamidase (SGSH).

6. The gene therapy vector of any one of claims 1 to 5, wherein the TAG increases the translocation of the biologically active polypeptide across the blood-brain barrier.

7. The gene therapy vector of any one of claims 1 to 6, wherein the TAG comprises an antigen binding molecule.

8. The gene therapy vector of any one of claims 1 to 7, wherein the TAG comprises scFv, VHH, vNAR, diabody, nanobody, camel antibody, or a combination thereof.

9. The gene therapy vector of any one of claims 1 to 8, wherein the TAG comprises VHH.

10. The gene therapy vector of any one of claims 1 to 9, wherein the TAG comprises an antigen binding molecule that specifically binds to transferrin receptor 1 (TfR1).

11. The gene therapy vector of any one of claims 1 to 10, wherein the TAG comprises a VHH that specifically binds to TfR1.

12. The gene therapy vector of any one of claims 1 to 11, wherein the TAG comprises a variable heavy chain (VH) domain comprising VH complementarity determining region (CDR) 1, VH-CDR2 and VH-CDR3.

13. The gene therapy vector of claim 12, wherein the VH-CDR1 is encoded by the nucleic acid sequence shown in SEQ ID NO:

11.

14. The gene therapy vector according to claim 12 or 13, wherein the VH-CDR2 is encoded by the nucleic acid sequence shown in SEQ ID NO:

12.

15. The gene therapy vector according to any one of claims 12 to 14, wherein the VH-CDR3 is encoded by the nucleic acid sequence shown in SEQ ID NO:

13.

16. The gene therapy vector of any one of claims 12 to 15, wherein the nucleotide sequence encoding TAG comprises a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% identical to SEQ ID NO: 14, 15, 16, 17, 18, 19, 20 or 21.

17. The gene therapy vector of claim 16, wherein the nucleotide sequence encoding TAG comprises SEQ ID NO: 14, 15, 16, 17, 18, 19, 20 or 21.

18. The gene therapy vector of claim 16 or 17, wherein the nucleotide sequence encoding TAG comprises SEQ ID NO:

14.

19. The gene therapy vector of any one of claims 1 to 18, wherein the nucleotide sequence encoding TAG comprises SEQ ID NO:

15.

20. The gene therapy vector of any one of claims 1 to 19, wherein the nucleotide sequence encoding the biologically active polypeptide is located 3' to the nucleotide sequence encoding TAG.

21. The gene therapy vector of any one of claims 1 to 19, wherein the nucleotide sequence encoding the biologically active polypeptide is located 5' to the nucleotide sequence encoding TAG.

22. The gene therapy vector according to any one of claims 1 to 21, wherein (i) the nucleotide sequence encoding the biologically active polypeptide is further linked to (ii) the nucleotide sequence encoding TAG via (iii) a nucleotide sequence encoding a peptide linker.

23. The gene therapy vector of claim 22, wherein the linker is a flexible linker, a cleavable linker, a processable linker, or any combination thereof.

24. The gene therapy vector of any one of claims 1 to 23, wherein the promoter is a ubiquitous promoter.

25. The gene therapy vector of claim 24, wherein the ubiquitous promoter comprises a chicken beta actin (CBA) promoter, an EF-1α promoter, a PGK promoter, a UBC promoter, a LSE beta-glucuronidase (GUSB) promoter, or a ubiquitous chromatin opening element (UCOE) promoter.

26. The gene therapy vector of claim 24 or 25, wherein the ubiquitous promoter comprises a cytomegalovirus (CMV) enhancer, a chicken beta actin promoter (CBA), and a rabbit beta globin intron.

27. The gene therapy vector of any one of claims 1 to 26, wherein the promoter is a tissue-specific promoter.

28. The gene therapy vector of claim 27, wherein the promoter is a liver-specific promoter.

29. The gene therapy vector of claim 27 or 28, wherein the promoter comprises hTTR, PGK, chicken β-actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSE β-glucuronidase (GUSB) promoter or ubiquitous chromatin opening element (UCOE) promoter or any combination thereof.

30. The gene therapy vector of any one of claims 1 to 29, which is a recombinant AAV (rAAV).

31. The gene therapy vector of claim 30, wherein the rAAV comprises an AAV capsid.

32. The gene therapy vector of claim 31, wherein the AAV capsid is a broadly tropic AAV capsid.

33. The gene therapy vector of claim 31 or 32, wherein the AAV capsid is a broadly tropic AAV capsid selected from the group consisting of AAV1 capsid, AAV2 capsid, AAV3 capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid, and variants thereof.

34. The gene therapy vector of any one of claims 31 to 33, wherein the AAV capsid is AAV9.

35. The gene therapy vector of any one of claims 1 to 34, further comprising a polyA sequence located 3' to the transgene.

36. The gene therapy vector of claim 35, wherein the poly A is bovine growth hormone (BGH) polyA or synthetic polyA.

37. The gene therapy vector of claim 36, wherein the synthetic poly A is designed by computer.

38. The gene therapy vector of any one of claims 1 to 37, further comprising a post-transcriptional regulatory element.

39. The gene therapy vector of claim 38, wherein the post-transcriptional regulatory element is located 3' to the transgene.

40. The gene therapy vector of claim 38 or 39, wherein the post-transcriptional regulatory element is located 5' to the polyA sequence.

41. The gene therapy vector of any one of claims 38 to 40, wherein the post-transcriptional regulatory element comprises a Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE).

42. The gene therapy vector of claim 41, wherein the WPRE sequence is modified.

43. The gene therapy vector of claim 41 or 42, wherein the WPRE sequence is WPRE mut6delATG.

44. The gene therapy vector of any one of claims 1 to 43, wherein the promoter comprises a shortened EF-1 alpha promoter and one or more introns.

45. The gene therapy vector of claim 44, wherein the one or more introns are from CBA and / or rabbit β-globin genes.

46. ​​The gene therapy vector of any one of claims 1 to 45, wherein the transgene is codon optimized.

47. A method of treating a disease or condition in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

48. The method of claim 47, wherein the disease or disorder comprises a neuronal disease.

49. The method of claim 47 or 48, wherein the disease or disorder comprises a mucopolysaccharidosis.

50. The method of any one of claims 47 to 49, wherein the disease or condition comprises Hurler's syndrome (MPS I), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Sly syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disease, and GM1 gangliosidosis.

51. A method of delivering a biologically active polypeptide across the blood-brain barrier in a subject, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

52. A method of reducing the level of a substrate in the central nervous system of a subject, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

53. A method of reducing a substrate in the central nervous system of a subject, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

54. A method of treating mucopolysaccharidosis in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

55. A method of treating Hurler's syndrome (MPS I) in a subject in need thereof, comprising administering to the subject the gene therapy vector of any one of claims 1 to 46.

56. A method of treating Hunter syndrome (MPS II) in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

57. A method of treating Sanfilippo Syndrome (MPS III) in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

58. A method of treating Slater's syndrome (MPS VII) in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

59. A method of treating Gaucher disease in a subject in need thereof, comprising administering to the subject the gene therapy vector of any one of claims 1 to 46.

60. A method of treating metachromatic leukodystrophy in a subject in need thereof, comprising administering to the subject the gene therapy vector of any one of claims 1 to 46.

61. A method of treating Krabbe disease in a subject in need thereof, comprising administering to the subject the gene therapy vector of any one of claims 1 to 46.

62. A method of treating GM1 gangliosidosis in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46.

63. The method of any one of claims 47 to 62, wherein a recombinant polypeptide is expressed by the transgene outside the central nervous system, and wherein the TAG facilitates translocation of the recombinant polypeptide across the blood-brain barrier into the central nervous system.

64. The method of any one of claims 47 to 63, wherein the recombinant polypeptide reduces the level of a substrate in the central nervous system of the subject.

65. The method of any one of claims 47 to 64, wherein the recombinant polypeptide reduces the level of the substrate systemically.

66. A method of treating Hunter syndrome in a subject in need thereof, comprising administering to the subject the gene therapy vector of any one of claims 1 to 46, wherein the biologically active polypeptide comprises IDS.

67. A method of treating Gaucher disease in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46, wherein the biologically active polypeptide comprises glucocerebrosidase (GCB).

68. A method of treating Sanfilippo syndrome in a subject in need thereof, comprising administering to the subject a gene therapy vector as described in any one of claims 1 to 46, wherein the biologically active polypeptide comprises N-sulfoglucosamine sulfohydrolase.

Images