Method for constructing a tumor xenograft model based on macrophage co-culture
By constructing xenograft tumor models through macrophage co-culture, the problem of slow tumor formation of human tumor cells in nude mice was solved, enabling rapid and stable tumor model construction and drug screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV
- Filing Date
- 2024-10-23
- Publication Date
- 2026-04-28
AI Technical Summary
In existing technologies, the tumor formation rate of human tumor cells in the construction of xenograft models in immunodeficient nude mice is slow, and leakage of the immune system affects tumor growth, resulting in unstable experimental results.
Using a macrophage co-culture method, M0 macrophages were induced from THP-1 cells, co-cultured with A375 melanoma cells, and then subcutaneously inoculated into nude mice to construct a xenograft model.
It significantly improved the growth rate and success rate of xenograft models, enhanced the reliability of tumor drug screening, and reduced drug resistance.
Smart Images

Figure CN119302266B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a method for constructing xenograft tumor models based on macrophage co-culture. Background Technology
[0002] Melanoma is one of the most common malignant tumors. Although various targeted and immunotherapies have achieved some efficacy in the clinical treatment of melanoma over the past decade, the complexity of treatment, high recurrence rate, and severe drug resistance significantly impact patient survival. Regarding melanoma drug resistance, current research has found that intratumoral macrophages are also one of the main causes of tumor development and resistance to immunotherapy or targeted therapy. Therefore, studying the interaction between melanoma and macrophages in the tumor microenvironment is of great significance for addressing the problems of tumor progression and drug resistance.
[0003] Mouse tumor models are an important tool for studying tumor development, progression, and targeted therapies. However, the establishment of human tumor cell lines in animals has always been related to the degree of immunodeficiency in mice; the more severe the immunodeficiency, the easier it is for tumor cells to form tumors in mice. Therefore, for certain human tumor cells, the degree of immunodeficiency in nude mice and the cleanliness of the rearing environment are crucial. Commonly used nude mice include Balb / c Nude, CD-1 Nude, and NUNU. For the same type of tumor, tumor formation and growth time in nude mice are still slower than in mouse xenografts. In some nude mice, such as Balb / c Nude, tumor growth is often slow, taking up to 10 days or even longer after tumor implantation. As the mice age, their immune system may leak, affecting tumor growth and subsequent experiments. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide a method for constructing a xenograft tumor model based on macrophage co-culture, which can improve the growth rate of the prepared xenograft tumor model.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] The method for constructing xenograft tumor models based on macrophage co-culture includes the following steps:
[0007] S1: Macrophage induction: THP-1 cells were seeded in culture flasks and cultured in 1640 complete medium for 24-48 hours. After PMA induction, the cells were washed with PBS and cultured in DMEM complete medium to form adherent macrophages.
[0008] S2: Tumor cell culture, tumor cells are cultured in DMEM complete medium;
[0009] S3: Co-culture: After digesting tumor cells with cell digestion solution, the cells are co-cultured with macrophages from step S1.
[0010] S4: Construction of xenograft model. The mixed cells co-cultured with macrophages and tumor cells in step S3 were digested and separated by cell digestion solution and then inoculated subcutaneously into nude mice.
[0011] Furthermore, the macrophages are M0 type macrophages.
[0012] Furthermore, the PMA was induced and cultured for 48 hours at a concentration of 100 ng / mL.
[0013] Furthermore, the cell digestion solution is 0.25% trypsin-EDTA, and tumor cells and macrophages are co-cultured 1-3 times, with each co-culture lasting 24 hours.
[0014] Furthermore, the number of cells inoculated subcutaneously in nude mice was 2 × 10⁻⁶. 6 indivual.
[0015] Furthermore, the tumor cells are melanoma tumor cells A375.
[0016] Furthermore, the method constructs a drug-resistant xenograft model.
[0017] The beneficial effects of this invention are as follows:
[0018] A method for rapidly preparing xenograft models has been developed, which improves the success rate of constructing animal xenograft models and facilitates the screening of tumor drugs.
[0019] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description
[0020] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein:
[0021] Figure 1 To detect the CD68 expression level after THP-1-induced M0 macrophages by RT-PCR;
[0022] Figure 2The sensitivity of A375 cells and A375 cells co-cultured with M0 macrophages to PLX4032 is shown. The dashed line represents a survival rate of 50%, corresponding to the drug concentration IC50. The IC50 of A375 cells and A375 cells co-cultured with M0 macrophages once (A375+M0 1) is around 0.1 μM. The IC50 of A375 cells co-cultured with M0 macrophages twice (A375+M0 2) and three times (A375+M0 3) is close to 10 μM, which is about 100 times the original IC50.
[0023] Figure 3 A schematic diagram (a) and volume statistics (b) of tumor size in nude mice 9 days after tumor cell inoculation. A375+M0 3 represents A375 cells co-cultured with M0 macrophages 3 times. The growth rate of A375 cells co-cultured with M0 macrophages 3 times in nude mice was significantly faster than that of primary A375 cells, ****, P<0.0001;
[0024] Figure 4 Tumor growth curves for A375+M0 3 (A375 cells co-cultured with M0 macrophages three times). Day 0 represents the first day of drug administration, and data were recorded up to day 8. Vehicle represents the drug solvent (control group). PLX4032 represents 10 mg / kg (drug-treated group). ns, no significant difference;
[0025] Figure 5 The size of tumor A375+M03 on day 8. Vehicle represents the drug solvent (control group). PLX4032 is 10 mg / kg (drug-treated group);
[0026] Figure 6 The image shows the tumor growth curve for A375. Day 0 represents the first day of drug administration, and data was recorded up to day 14. Vehicle represents the drug solvent (control group). PLX4032 represents 10 mg / kg (drug-treated group). *, P < 0.05;
[0027] Figure 7 The size of the A375 tumor on day 14. Vehicle represents the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). Detailed Implementation
[0028] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic representations of the basic concept of the present invention. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0029] The accompanying drawings are for illustrative purposes only and are schematic diagrams, not actual pictures. They should not be construed as limiting the invention. To better illustrate the embodiments of the invention, some parts in the drawings may be omitted, enlarged, or reduced, and do not represent the actual product dimensions. It is understandable to those skilled in the art that some well-known structures and their descriptions may be omitted in the drawings.
[0030] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components. In the description of the present invention, it should be understood that if terms such as "upper," "lower," "left," "right," "front," and "rear" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, the terms used to describe positional relationships in the drawings are only for illustrative purposes and should not be construed as limiting the present invention. For those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.
[0031] Example 1 Macrophage Induction Culture
[0032] 1. Human monocytic leukemia cells THP-1 (catalog number #CL-0233, purchased from Pronosai) were cultured in 1640 complete medium (1640 basal medium containing 10% Gibco serum, 1% streptomycin / penicillin antibiotics, and 0.05 mM β-mercaptoethanol) at 37°C and 5% CO2. 2 24-48 hours, when the cells reach a certain density, approximately 1-2 × 10⁻⁶. 6 When the cell count is 5 × 10⁶ cells / mL, inoculate each T75 square flask with 5 × 10⁶ cells / mL. 6 After induction with PMA (Invivogen, 100 ng / mL) for 48 hours, the cells were washed twice with PBS and then replaced with DMEM complete medium (DMEM basal medium containing 10% Gibco serum and 1% streptomycin / penicillin antibiotics) for continued culture (culture conditions as before, 37℃, 5% CO2). 2 At this point, the cells have changed from suspension cells to adherent cells, and are M0 type macrophages.
[0033] 2. RT-PCR detection of CD68 expression levels in induced M0 macrophages: THP-1 cells were divided into groups of 1×10⁶ cells per well. 6 Cells were seeded into 6-well plates and induced with 100 ng / mL PMA for 48 h. After washing twice with PBS, the cells were cultured in DMEM complete medium for another 24 h. The medium was then removed, and 1 mL of RNAiso Plus (Takara) was added to each well to collect the cells. The cells were then transferred to 1.5 mL centrifuge tubes, and 1 × 10⁶ cells were collected. 6 THP-1 was lysed in the same manner, and the RNA extraction steps are as follows:
[0034] (1) Place the TRIzol-lysed cell samples at room temperature for 5 min;
[0035] (2) Add 200 μL of chloroform to each sample tube, vortex thoroughly for 30-60 seconds until the sample turns milky white, and let stand at room temperature for 5 minutes.
[0036] (3) Centrifuge at 12000×g, 4℃ for 15min, and transfer the supernatant to another new centrifuge tube;
[0037] (4) Add an equal volume of isopropanol to the supernatant, invert the centrifuge tube to mix thoroughly, and let stand at room temperature for 10 minutes.
[0038] (5) Centrifuge at 12000×g, 4℃ for 10 min, and discard the supernatant.
[0039] (6) Add 1 mL of 75% ethanol, gently invert several times to resuspend the RNA precipitate several times, centrifuge at 7500×g at 4℃ for 5 min and carefully discard the supernatant.
[0040] (7) Dissolving RNA: Open the centrifuge tube cap and let the precipitate dry at room temperature for 10-15 min. After the precipitate is dry, add an appropriate amount of TE buffer (30-50 μL) to dissolve the RNA precipitate for 10 min.
[0041] Reverse transcription was performed immediately after RNA extraction using the PrimeScript kit. TM The RT reagent kit (Takara, catalog number #RR037A) was used for RT-PCR, and the kit was from TB. Premix Ex Taq TMII (Takara, catalog number #RR820A) uses the following primer sequences: CD68 upstream primer “TCCAAGCCCAGATTCAGATTCG”, CD68 downstream primer “CCTTGGTTTTGTTGGGGTTCAG”, β-actin upstream primer “CACTCTTCCAGCCTTCCTTC”, and β-actin downstream primer “GTACAGGTCTTTGCGGATGT”.
[0042] The results are as follows Figure 1 As shown, RT-PCR was used to detect the CD68 expression level after THP-1 induced M0 macrophages, ***, P<0.005;
[0043] Example 2: Co-culture of M0 macrophages with A375 and drug sensitivity test
[0044] 1. Melanoma tumor cells A375 were purchased from Pronosai (catalog number CL-0014) and cultured in DMEM complete medium (containing 10% Gibco serum and 1% streptomycin / penicillin antibiotics). A375 cells in the logarithmic growth phase were seeded into flasks containing M0 macrophages (removed cytokines 24 hours prior), approximately 2 × 10⁶ cells per flask. 6 The cells were cultured in DMEM complete medium and co-cultured with macrophages and A375 in a 37°C incubator for 24 hours. At this time, the tumor cells underwent their first co-culture.
[0045] 2. Digest the A375 cells, which were co-cultured with macrophages for the first time, using 0.25% trypsin-EDTA cell digestion solution. Count the cells using a Boehringer's indexing chamber, at a rate of 2 × 10⁶ cells per T75 flask. 6 Tumor cells A375 were seeded into new T75 flasks containing M0 macrophages (removed cytokines 24 h) and co-cultured for a second time for 24 h. The tumor cells underwent a second co-culture, and steps 1-2 were repeated until the third co-culture.
[0046] 3. After each co-culture, a portion of A375 cells was used for drug sensitivity testing: A375 cells are BRAF-mutated tumor cells. A375 cells that had not undergone macrophage co-culture were sensitive to the BRAF inhibitor (PLX4032, Selleck#S1267). The PLX4032 concentration gradient was set at 0, 0.01, 0.1, 1, and 10 μM. After 72 h of drug treatment, cell viability was measured using CCK8 assays to evaluate the changes in A375 cell sensitivity to the drug after co-culture with macrophages. Figure 2As shown, the dashed line represents a survival rate of 50%, corresponding to the drug concentration IC50. The IC50 of A375 and A375 after one co-culture with M0 macrophages (A375+M0 1) is around 0.1 μM. The IC50 of A375 after two co-cultures (A375+M0 2) and three co-cultures (A375+M0 3) with M0 macrophages is close to 10 μM, which is about 100 times the original IC50.
[0047] Example 3: Preparation of xenograft tumor model and drug sensitivity test
[0048] 1. Four-week-old male Balb / c Nude nude mice were purchased from Vital Rivers Beijing. After one week of acclimatization in an SPF-grade animal facility, A375 cells from the third co-culture were digested, washed once with PBS, resuspended in 1640 basal medium, and the cell density was adjusted to 1×10⁻⁶ cells / year. 7 Cells / mL, 200 μL of cells were seeded onto the right side of the back of nude mice each time, equivalent to 2 × 10⁶ cells. 6 The tumor size was observed one week later. The results were as follows... Figure 3 As shown, A375+M0 3 represents A375 cells co-cultured with M0 macrophages three times. The A375 tumors co-cultured with M0 macrophages three times grew significantly faster in nude mice than the primary A375 tumors. ****, P<0.0001.
[0049] 2. When the tumor volume reaches 100-200mm 3 At that time, PLX4032 was administered intraperitoneally. The PLX4032 preparation method was: 5% DMSO + 40% PEG300 + 5% Tween 80 + 50% ddH2O. The control group received a drug-free solvent (vehicle), while the experimental group received 10 mg / kg PLX4032, administered in 100 μL volumes, daily. Tumor size was measured every two days, and tumor volume was calculated using the formula: tumor volume (mm). 3 = length × width × width / 2.
[0050] 3. Results Analysis: For example... Figure 4 As shown, day 0 is the first day of administration, and data are recorded up to day 8. Vehicle represents the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). ns, no significant difference. Figure 5 Tumor size of A375+M03 on day 8. Vehicle was the drug solvent (control group). PLX4032 was 10 mg / kg (drug treatment group).
[0051] As shown in the figure Figure 6A375 tumor growth curve on day 14. Day 0 is the first day of drug administration, and data are recorded up to day 14. Vehicle represents the drug solvent (control group). PLX4032 is 10 mg / kg (drug-treated group). *, P < 0.05. Figure 7 A375 tumor size on day 14. Vehicle was the drug solvent (control group). PLX4032 was 10 mg / kg (drug treatment group).
[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A method for constructing xenograft tumor models based on macrophage co-culture, characterized in that: The method steps are as follows: S1: Macrophage induction: THP-1 cells were seeded in culture flasks and cultured in 1640 complete medium for 24-48 hours. After PMA induction, the cells were washed with PBS and cultured in DMEM complete medium to form adherent macrophages. The macrophages were M0 type macrophages. S2: Tumor cell culture, tumor cells are cultured in DMEM complete medium; S3: Co-culture. After digesting tumor cells with cell digestion solution, they are co-cultured with macrophages from step S1. Tumor cells and macrophages are co-cultured 3 times, each time for 24 hours. S4: Construction of xenograft model. The mixed cells co-cultured with macrophages and tumor cells in step S3 were digested and separated by cell digestion solution and then inoculated subcutaneously into nude mice.
2. The method for constructing a xenograft tumor model based on macrophage co-culture according to claim 1, characterized in that: The PMA was induced and cultured for 48 hours at a concentration of 100 ng / mL.
3. The method for constructing a xenograft tumor model based on macrophage co-culture according to claim 1, characterized in that: The cell digestion solution was 0.25% trypsin-EDTA.
4. The method for constructing a xenograft tumor model based on macrophage co-culture according to claim 1, characterized in that: The number of cells inoculated subcutaneously into nude mice was 2. 10 6 indivual.
5. The method for constructing xenograft tumor models based on macrophage co-culture according to any one of claims 1-4, characterized in that: The tumor cells were melanoma tumor cells A375.
6. The method for constructing a xenograft tumor model based on macrophage co-culture according to claim 5, characterized in that: The method described above constructs a drug-resistant xenograft model.
Citation Information
Patent Citations
Construction method and application of M2-type tumor-associated macrophage model
CN106244546A
Method for inducing THP-1 to be differentiated into macrophages and application of method in construction of macrophage-tumor hybrid cell model
CN118109412A