Gene segment and application of dsRNA targeting gene segment

Abstract

The invention belongs to the technical field of insect gene engineering, and particularly relates to a gene segment and application of dsRNA targeting the gene segment. The gene segment is used for preventing and controlling Italian locusts, and the nucleotide sequence of the gene segment is as shown in SEQ ID NO.1. The invention further discloses dsRNA targeting the gene segment, the dsRNA is injected into the abdomen of the Italian locust and used for inhibiting expression of the Tra2 gene of the Italian locust, and the result shows that after the Tra2 gene is inhibited, the egg laying amount of the Italian locust can be remarkably reduced, and a foundation is laid for subsequent development of a new population genetic control method of the species.

Description

Technical Field

[0001] The invention belongs to the technical field of insect genetic engineering, and specifically relates to the application of gene fragments and dsRNA targeting the gene fragments. Background Art

[0002] The Italian locust Calliptamus italicus belongs to the order Orthoptera, family Acrididae, genus Asteropterus. It has a wide diet and likes to eat a variety of Artemisia species in the Asteraceae family, as well as plants in the Rhizomeaceae family and the Gramineae family. It is a dominant pest in grasslands and agricultural and pastoral transition areas. The Italian locust has a very strong reproductive capacity and seriously endangers ecological security.

[0003] The existing methods for controlling Italian locusts include chemical control and biological control. Among them, chemical control will have pesticide residues, which will affect the ecological environment of the grassland. Among biological natural enemies, the predatory natural enemy, the pink starling Sturnus roseus, can prey on locusts, but the locust outbreak is serious and covers a wide range, and it is impossible to ensure the number of starlings and their ability to migrate to all locust outbreak sites every year. The parasitic natural enemy, the locust microsporidia, has a long incubation period in the locust body and is slowly pathogenic. It takes a long time or even many years to achieve the effect of locust control. Biological pesticides such as green muscardine spore powder, different types of green muscardine have their own unique resistance, strains need to be screened, and multiple experiments are required to master the optimal concentration.

[0004] Sex determination and differentiation are key factors affecting insect reproduction, development and population structure. Key genes in the sex determination pathway not only affect each other, but also regulate cascade pathways together with other development-related genes. A large number of studies have shown that Tra2 is a key gene for sex determination in many insects, but the role of the Tra2 gene in the Italian locust is still unclear. Summary of the invention

[0005] In order to solve the defect that the role of Tra2 gene in locusts is still unclear in the prior art, the present invention provides a gene fragment for regulating the egg laying amount of locusts, a dsRNA targeting the gene fragment, a preparation for reducing the egg laying amount of locusts, and applications thereof.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions.

[0007] A gene fragment is used in the prevention and control of Italian locusts, and the nucleotide sequence of the gene fragment is shown as SEQ ID NO.1.

[0008] Preferably, the Italian locust control is to reduce the egg laying amount of Italian locust.

[0009] Preferably, the egg laying amount of Locust esculenta is reduced by inhibiting the expression of the gene fragment.

[0010] Preferably, the expression of the gene fragment is inhibited by using a dsRNA targeting the gene fragment, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.7.

[0011] A primer pair for amplifying dsRNA, wherein the dsRNA is the dsRNA as claimed in claim 4, and the primer pair comprises an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0012] A preparation for reducing the egg laying amount of Italian locust, comprising the dsRNA as claimed in claim 4.

[0013] Preferably, the preparation further comprises an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0014] A method for reducing the egg laying amount of Italian locust, comprising synthesizing the dsRNA of claim 4 and introducing the dsRNA into the Italian locust.

[0015] Preferably, the concentration of the dsRNA is 1.2 μg / μL to 2.0 μg / μL.

[0016] Application of the dsRNA, the primer pair or the preparation in reducing the egg laying amount of Italian locust.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] Based on the ORF sequence of Tra2 of Italian locust, the present invention uses RNAi technology to silence the Tra2 gene of the ovarian tissue of the newly emerged female Italian locust, and uses qRT-PCR technology to detect the expression changes of ovarian Tra2 and its downstream related genes after interference. The results show that the Tra2 gene affects its target gene Vg by regulating Dsx. Tra2 reduces the number of eggs in the ovary through this chain reaction, thereby significantly reducing the amount of eggs laid, indicating that Tra2 is indispensable in the reproductive development of Italian locust. The present invention helps to deeply reveal the molecular mechanism of sex regulation of Italian locust, and lays a foundation for the subsequent development of new methods for population genetic control of this species. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the dissolution curve of Tra2 gene.

[0020] Figure 2 This is the Dsx gene dissolution curve.

[0021] Figure 3 This is the dissolution curve of the Vg gene.

[0022] Figure 4 This is the VgR gene dissolution curve.

[0023] Figure 5 This is the electrophoresis diagram of total RNA from Italian locust eggs; M: DL2000 Marker; Bands 1-4: Italian locust ovary RNA samples.

[0024] Figure 6 It is the electrophoresis diagram of dsRNA; M: DL2000 Marker; Band 1 and Band 3: dsEGFP; Band 2 and Band 4: dsTra2.

[0025] Figure 7 is the relative expression level of Tra2 gene in the ovary of Italian grasshopper after injection of different concentrations of dsTra2; Figure 7 A represents the relative expression level of Tra2 gene after injection of dsTra2 at a concentration of 1.2 μg / μL; Figure 7 B represents the relative expression level of Tra2 gene after injection of dsTra2 at a concentration of 1.6 μg / μL; Figure 7 C in the figure shows the relative expression level of Tra2 gene after injection of dsTra2 at a concentration of 2.0 μg / μL.

[0026] Figure 8 is the relative expression level of Tra2 downstream related genes after 1.6μg / μL dsTra2 gene injection; among them, Figure 8 A represents the relative expression level measurement result of Dsx gene; Figure 8 B represents the result of the relative expression level determination of Vg gene; Figure 8 C represents the results of the relative expression level measurement of the Vgr gene.

[0027] Fig. 9 This is a section of the ovary of Italian locust after dsTra2 injection; Fig. 9 A in the figure indicates ovarian sections after 5 days of ddH2O treatment; Fig. 9 B in the figure shows the ovarian section after 5-day treatment with 1.6 μg / μL dsEGFP; Fig. 9 C in the figure represents ovarian sections treated with 1.6 μg / μL dsTra2 for 5 days; Fig. 9 D in the figure indicates ovarian sections after 10 days of ddH2O treatment; Fig. 9 E in the figure indicates ovarian sections treated with 1.6 μg / μL dsEGFP for 10 days; Fig. 9 F in the figure indicates ovarian sections treated with 1.6 μg / μL dsTra2 for 10 days; Fig. 9 G in the figure indicates ovarian sections after 15 days of ddH2O treatment; Fig. 9H in the figure indicates ovarian sections treated with 1.6 μg / μL dsEGFP for 15 days; Fig. 9 Panel I indicates ovarian sections treated with 1.6 μg / μL dsTra2 for 15 days.

[0028] Fig.10 This is the result of measuring the egg laying amount of Italian locust after dsTra2 injection. DETAILED DESCRIPTION

[0029] The present invention is described in detail below in conjunction with specific examples, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0030] The existing methods for controlling Italian locusts include chemical control and biological control. Among them, chemical control will have pesticide residues, which will affect the ecological environment of grasslands. Among biological natural enemies, the predatory natural enemy, the pink starling Sturnus roseus, can prey on locusts, but the locust outbreak is serious and covers a wide range, and it is impossible to ensure the number of starlings and their ability to migrate to all locust outbreak sites every year. The parasitic natural enemy, the locust microsporidia, has a long incubation period in the locust body and is slowly pathogenic. It takes a long time or even many years to achieve the effect of locust control. Biological pesticides such as green muscardine spore powder, different types of green muscardine have their own unique resistance, strains need to be screened, and multiple experiments are required to master the optimal concentration. A large number of studies have shown that Tra2 is a key gene for sex determination in many insects, and the role of the Tra2 gene in the Italian locust is still unclear.

[0031] The present invention provides a gene fragment for regulating the egg-laying amount of Italian locust, and the nucleotide sequence of the gene fragment is shown in SEQ ID NO.1. Based on the ORF sequence of Italian locust Tra2, the present invention uses RNAi technology to silence the Tra2 gene of the ovarian tissue of the newly emerged female Italian locust, and uses qRT-PCR technology to detect the expression changes of ovarian Tra2 and its downstream related genes after interference. The results show that the Tra2 gene affects its target gene Vg by regulating Dsx. Tra2 may reduce the number of eggs in the ovary through this chain reaction, thereby significantly reducing the egg-laying amount, indicating that Tra2 is indispensable in the reproductive development of Italian locust. The present invention helps to deeply reveal the molecular mechanism of sex regulation of Italian locust, and lays a foundation for the subsequent development of new methods for population genetic control of this species.

[0032] 1. Sample collection

[0033] Italian locust nymphs were collected from Qingshuihe Township, Manas County, Xinjiang Uygur Autonomous Region, raised in laboratory insect cages, and fed with alfalfa Medicago sativa until they emerged. The ovaries of one-day-old female nymphs were obtained after emergence.

[0034] Example 1

[0035] 1. Total RNA extraction and cDNA synthesis

[0036] The ovaries of one-day-old female locusts of Italian locusts were taken, RNA was extracted and reverse transcribed into cDNA. The experimental method is as follows:

[0037] 100 mg of newly emerged adult ovaries were weighed and ground with liquid nitrogen, and total RNA was extracted using Trizol Reagent (Invitrogen, USA). RNA concentration and purity were determined by NanoDrop 2000, and its quality was tested by 1% agarose gel electrophoresis. RNA of qualified quality was reverse transcribed using PrimeScript TM The cDNA synthesized by RT reagent Kit with gDNA Eraser (Takara, Japan) was frozen at -80°C.

[0038] 2. Acquisition of Tra2 gene of Italian locust

[0039] Acquisition method: Based on the reported sex determination gene TRA2 protein sequence as the index, T-blastn homology comparison was performed with the Italian locust egg transcriptome database. The comparison results were expressed as E-value <1e -6

[0040] 3. RNAi

[0041] (1) Plasmid extraction and linearization

[0042] Select dsTra2 and dsEGFP primers, 50 μL PCR reaction system, specifically including: ddH2O 20 μL, Tra2 or EGFP upstream and downstream primers (dsTra2-F and dsTra2-R or dsEGFP-F and dsEGFP-R) 2 μL each (10 μmol / L), primer sequences are shown in Table 1, 2×Taq PCR Mix 25 μL, cDNA template 1 μL, reaction conditions are as follows: first cycle: 95°C denaturation 5 min; 30 cycles: 95°C denaturation 30 s, annealing 30 s (Tra2 = 55°C; EGFP = 60°C), 72°C extension 34 s; final cycle: 72°C extension 10 min.

[0043] After the PCR product was detected by 1% agarose gel electrophoresis, the target fragment was cut out and recovered using the EZ-10 column DNA recovery kit (Shanghai, Biotech), and connected with the pMD19-T vector (Japan, Takara), and transformed into Escherichia colii DH5α competent cells after overnight at 4°C, and then spread on LB solid medium for overnight culture. The blue-white screening was performed every other day, and the appropriate single colony was selected for expansion culture and bacterial liquid PCR was performed to detect whether the PCR fragment was inserted. The qualified bacterial liquid samples were selected and sent to Shanghai Biotech for sequencing. The qualified bacterial liquid was sequenced according to the instructions of the small plasmid kit (Shanghai, Biotech) to obtain plasmids, and the plasmid DNA was used as a template for PCR amplification and product recovery again to obtain the linearized plasmid DNA of Tra2 and EGFP, respectively.The nucleotide sequence of EGFP is shown in SEQ ID NO.2, specifically: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG CCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA。

[0044] Table 1 Interference primers

[0045]

[0046] Note: The underlined part "TAATACGACTCACTATAGGG" in Table 1 is the T7 promoter.

[0047] (2) In vitro synthesis of dsRNA

[0048] Refer to T7 RiboMAX TMAccording to the instructions of the Express RNAi System kit (manufacturer: Promega, USA, catalog number: P1700), dsTra2 and dsEGFP were synthesized using the linearized plasmid DNA of Tra2 and EGFP as templates, respectively, and stored at -80°C for future use. The sequence of dsTra2 is shown in SEQ ID NO.7, specifically: GTGGTCGGTACAGGTCAAGAAGCAGATCTCGTTCCCCCAGA AGATATAGGTCTCGTTACTCACATTCGAGATCACGTTCCTACAGTCCCCGAGGTAAATACTATGGTTACAGTGACAGGCGGAAAGAATTCTACCGCAGCCATTCTCGCAGTCCTATGTCATCTAGGAAGACACATTGGCAGCAGGGAAAACCCACAACCTAGTCGGTGCCTGGGCATATTTGGCTTGAGCATCTACACCACAGAACAGCA GCTGCATCACATCATGTCAAAGTATGGGCCTGTGGAAAGGGTTCAGGTCGTTATTGATGCAAAGACTGGCAGGTCCCGTGGGTTCTCATTTGTGTACTTCGAAAGTGCTGAGGATGCAAAGGTGGCAAAAGAACAATGTACAGGAATGGAAATTGATGGAAGGCGAATTAGAGTAGACTTTTCAATCACGCAAAGAGCC, the sequence of dsEGFP is as SEQ ID NO.8, specifically CACCTACGG CAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCG CATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCA. .

[0049] (3) Optimal concentration screening and dsRNA injection

[0050] To screen the optimal concentration, three groups of dsTra2 concentrations (1.2 μg / μL, 1.6 μg / μL, and 2 μg / μL) were set. One-day-old female insects with relatively consistent body size were selected, and 5 μL of dsTra2 was injected into the third segment of the abdomen using a microinjector. The same amount of dsEGFP with the same concentration was injected as a negative control, and the same amount of ddH2O was injected as a blank control (CK). The injected female insects were kept at room temperature, and the active locusts at 12h, 24h, 48h, and 72h were taken, dissected, and the ovaries were obtained and frozen at -80℃ for subsequent optimal dsTra2 concentration screening and detection of the expression of Tra2 downstream associated genes after interference.

[0051] (4) Detection of downstream related gene expression

[0052] Extract RNA from female ovarian samples treated with ddH2O, optimal concentrations of dsTra2, and dsEGFP, synthesize the treated cDNA, and perform qRT-PCR. Use the treated cDNA as a template and β-actin as an internal reference gene. The 15μL qRT-PCR reaction system is as follows: ddH2O 5.3μL, 0.6μL (10μmol / L) of each upstream and downstream primer of SEQ ID NO.9-18 shown in Table 2, 2×TB Premix Ex Taq TMII 7.5 μL, treated cDNA template 1 μL.

[0053] qRT-PCR reaction conditions: 95℃5min; 95℃30s, (Tra2=55℃, Dsx=60℃, Vg=54℃, VgR=49℃)30s, 72℃15s, 40 cycles; 95℃10s, 65℃60s, 97℃1s, generate melting curve, 3×3 parallel samples were made for detection, the results are as follows Figure 1 , Figure 2 , Figure 3 and Figure 4 As shown, the melting curve peak of the female insect ovary sample treated with ddH2O, the optimal concentration of dsTra2, and dsEGFP was single, which proved that the selected primers had good specificity and could be used for subsequent experiments.

[0054] Table 2 Quantitative primers

[0055] name sequence serial number Dsx-F 5′-GACTTGGCGTCCTTGAG-3′ SEQ ID NO.9 Dsx-R 5′-CCAACGGAAGGGAGTAGAAG-3′ SEQ ID NO.10 Tra2-F 5′-AAATCAAGACGGAGGGT-3′ SEQ ID NO.11 Tra2-R 5′-TGCCGCACAGACATAGA-3′ SEQ ID NO.12 Vg-F 5′-AAGCTCCATGCACCACCTAC-3′ SEQ ID NO.13 Vg-R 5′-CAAGAAGACGGCACACAC-3′ SEQ ID NO.14 VxF 5′-GAGAAGACCTGGTTTACTGGAGT-3′ SEQ ID NO.15 VxR 5′-GCGCTATTTCTGTYGGCTTTC-3′ SEQ ID NO.16 β-action-F 5′-AAGGCATCAGGGTGTGATGG-3′ SEQ ID NO.17 β-action-R 5′-GCCACCCTAAGCTCGTTGTA-3′ SEQ ID NO.18

[0056] (5) Observation of ovarian morphology

[0057] Newly emerged females were treated with ddH2O, optimal concentrations of dsTra2 and dsEGFP, and their ovaries were dissected and sectioned every 5 days.

[0058] (6) Statistics on egg laying of Italian locusts

[0059] Newly emerged females were treated with ddH2O, optimal concentrations of dsTra2 and dsEGFP, males were selected and caged with the treated females at a ratio of 1:1, and the egg-laying capacity of each treatment group was measured within 15 days.

[0060] 4. Data Analysis

[0061] 2 -ΔΔCt The relative expression of genes was calculated by the method; the one-way ANOVA in SPASS26.0 software was used to analyze the differences in the expression of Tra2 and its downstream related genes and the amount of egg laying after interference. P < 0.05 indicated a significant difference.

[0062] 5. Results and Analysis

[0063] (1) Ovarian total RNA extraction and dsRNA synthesis

[0064] The total RNA electrophoresis pattern of Italian locust ovary samples is as follows Figure 5 As shown, no obvious degradation and dragging were observed, indicating that the extracted RNA was of qualified quality and could be used for subsequent experiments.

[0065] The electrophoresis pattern of dsRNA synthesized by linearized plasmid is as follows Figure 6 As shown, the synthesized band is bright and single, consistent with the size of the target fragment, and can be used for subsequent experiments.

[0066] (2) Screening of the optimal dsTra2 injection concentration

[0067] The interference effects of different concentrations of dsTra2 on the ovarian tissue of newly emerged adults are shown in Figure 2. Figure 5 As shown: There was no significant difference in the expression of Tra2 between the CK group and the dsEGFP group (P>0.05), indicating that the injection of dsEGFP would not affect the normal expression of other genes in the ovary and could be used as a negative control for subsequent comparisons.

[0068] The results are as follows Figure 7 As shown in Figures AC, after treatment with different concentrations of dsTra2, the expression of Tra2 in the ovary was not significantly different from that of the negative control only at 12h after treatment (P>0.05). As the interference time prolonged, the expression of Tra2 was significantly decreased compared with the negative control group (P<0.05). After treatment with different concentrations of dsTra2 (1.2μg / μL, 1.6μg / μL, 2μg / μL), the expression of Tra2 dropped to the lowest level at 72h, which was significantly decreased by 79.4%, 88.7% and 86.6% compared with the negative control, respectively (P<0.05). Therefore, the subsequent study used 1.6μg / μL dsTra2 for RNAi experiments.

[0069] (3) Analysis of expression patterns of downstream related genes after Tra2 interference

[0070] After the Italian grasshopper ovaries were injected with 1.6 μg / μL dsTra2, the expression levels of its downstream related genes changed at different levels (e.g. Figure 8 After dsTra2 treatment, the expression trends of Dsx and Vg were basically the same, showing a trend of first increasing and then decreasing. They significantly increased to the highest level at 12h (P<0.05), and were significantly increased by 87.3% (Dsx) and 123.9% (Vg) compared with the negative control, respectively. The expression levels of Dsx and Vg after other treatment times were significantly lower than those of the control group (P<0.05), and dropped to the lowest level at 72h, which were significantly reduced by 92.2% (Dsx) and 89% (Vg) compared with the negative control, respectively (as shown in Figure 8As shown in A and B in the figure). After dsTra2 treatment, the expression of VgR first increased and then decreased, indicating that interfering with Tra2 has an impact on Dsx, Vg, and VgR, and there may be a hierarchical relationship between them. Among them, the expression levels at 12h and 24h after treatment were significantly higher than those in the negative control group (P<0.05), and the expression level at 12h was significantly increased by 165% compared with the control group (P<0.05). After 48h, there was no significant difference with the negative control group (P>0.05) ( Figure 8 as shown in C in the figure).

[0071] (4) Effects of Tra2 interference on female ovarian morphology

[0072] The ovary of Italian locust is a non-fertile ovary, with a layer of follicular cells surrounding the oocyte, forming a microenvironment for the development of the oocyte. Fig. 9 From the AI ​​in the figure, we can see that there are still a large number of oocytes in the ovaries on the 5th day after Tra2 interference, but the number is less than that in the CK group and the EGFP group; on the 10th day after Tra2 interference, the number of oocytes in the interference group decreased and the gaps between the eggs were larger, which were more scattered and irregularly arranged; on the 15th day after Tra2 interference, the number of eggs was obviously scarce and scattered.

[0073] (5) Effect of interfering with the Tra2 gene on the egg production of female insects

[0074] Depend on Fig.10 It can be seen that after interfering with the Tra2 gene of newly emerged female insects, the egg-laying amount of the CK group and the dsEGFP group had no significant difference (P>0.05), but both were significantly higher than that of the dsTra2 group (P<0.05).

[0075] 6. Summary and discussion

[0076] (1) Expression patterns of downstream genes after interference with Tra2 gene in Locustina italicum

[0077] Downstream of the complex and changeable initial signal, Tra gene, Tra2 gene and Dsx gene are relatively conservative compared with the upstream signal, among which Tra2 gene and Dsx gene have obvious conservative domains, and their homologs have been found in many insects, but the protein sequence of Tra is quite different, and its conservation is mainly reflected in function rather than structure, so homologous genes of Tra gene have not been found in some insects (such as silkworm Bombyx mori). The present invention found Tra2 gene and Dsx gene by T-blastn comparison and search of sex-related genes of Italian locust, but no homologs of Tra gene were found.

[0078] In the study of Tribolioium castaneum, it was found that the Tra2 gene is necessary for the formation of sex-specific spliceosomes of the Dsx gene. After the female Italian locust ovaries were treated with dsTra2 for 12 hours, the expression of Tra2 was slightly reduced, but there was no significant change compared with the negative control, and the expression of its downstream associated genes (Dsx, Vg, VgR) was significantly increased. This may be to increase the expression of Dsx to maintain the number of female-specific spliceosomes in the body when Tra2 decreases slightly, thereby ensuring the stable production of sex-specific proteins. Vg and VgR are affected by Dsx regulation and their expression levels increase in the short term to maintain the yolk accumulation requirements in the ovaries. Different from the results of the present invention, after the fragrant pear Euzophora pyriella was treated with dsTra2, Dsx was significantly low in the early stage, and overexpression occurred after 48 hours. It is speculated that the specific regulation of Tra2 is different due to the different sex determination cascade pathways of different species.

[0079] Dsx is the bottom gene in the insect sex determination cascade and is selectively spliced ​​by upstream genes to produce the sex-specific protein DSX. F or DSX M This protein regulates the downstream genes responsible for expressing sexual dimorphic characteristics, promotes the development of sexually dimorphic organs in insects, amplifies sex determination signals, and ultimately enables males and females to be morphologically and physiologically different in order to maintain the reproduction of the species. Studies on Drosophila melanogaster have shown that Vg is a direct target of Dsx. Vg is synthesized in the fat body of oviparous animals, binds to its receptor (vitellogenin receptor, VgR) and is transported to the oocyte via endocytosis. Vg that enters the oocyte dissociates from VgR, and VgR returns to the surface of the oocyte membrane, mediating the Vg transport process in a cycle. Vg is retained and precipitated as yolk protein (vitelloin, Vn) after modification and processing. The important links of female sexual differentiation and reproduction are ovarian development and oogenesis. Vitellogenesis is the key period of oogenesis. The accumulation of yolk protein provides nutrients for ovarian development and egg maturation, promoting female sexual differentiation and reproduction. In the present invention, 24 hours after the Italian locust ovary was treated with dsTra2, the expression of Tra2 decreased significantly, and the expression of Dsx and Vg also decreased significantly. In the fragrant pear Euryops oleraceus, the phenomenon of interference with Tra2 leading to a significant decrease in the expression of Dsx also occurred, indicating that there may be a cascade regulatory relationship between Tra2 and Dsx in the Italian locust. In the Italian honey bee Apis mellifera, the Vg content decreased significantly with the downregulation of Dsx, which is consistent with the results of the present invention. It is speculated that in the Italian locust, Vg may also be a direct target of Dsx to carry out a series of regulation to affect the development of sexual organs.

[0080] The expression of VgR increased significantly 12h after dsTra2 treatment, which is speculated to be due to the significant increase in Vg, which requires more VgR to participate in the transport process; 24h later, the interference effect was significant, Vg was significantly reduced by Dsx, and the demand for VgR decreased accordingly, and the expression of VgR gradually dropped to normal levels. At 48-72h after interference, although the expression of Vg continued to decrease significantly with Dsx, the normal level of VgR content was sufficient to maintain the current transport of Vg, so the expression of VgR at this stage was not significantly different from the negative control.

[0081] (2) Changes in the ovaries of Italian locust females after Tra2 interference

[0082] Studies have found that Tra2 has many effects on insect fertility. For example, after the Chilean phytoseiulus persimlis was treated with dsTra2, its reproductive capacity did not change significantly, but the hatching rate of eggs was significantly reduced. After the leek late-eye fungus midge Bradysia odoriphag was treated with dsTra2, its ovaries were damaged, and the egg laying amount and offspring hatching rate were also seriously affected. After the third-instar brown planthopper Nilaparvata lugens nymphs were treated with dsTra2, the ovaries of the female insects did not develop after their eclosion. In the present invention, after the Italian locust was interfered with by Tra2, the number of eggs in its ovaries decreased, which was the main reason for the significant reduction in its egg laying amount. Studies on its downstream genes found that Tra2 affects its target gene Vg by regulating Dsx. Tra2 may reduce the number of eggs in the ovaries through this chain reaction, thereby significantly reducing the egg laying amount, indicating that Tra2 is indispensable in the reproductive development of the Italian locust.

[0083] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0084] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of a gene fragment in the prevention and control of Italian locusts, characterized in that: The nucleotide sequence of the gene fragment is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The Italian locust control is to reduce the egg laying amount of Italian locust.

3. The use according to claim 2, characterized in that: The egg laying amount of Italian locust is reduced by inhibiting the expression of the gene fragment.

4. The use according to claim 3, characterized in that: The expression of the gene fragment is inhibited by using a dsRNA targeting the gene fragment, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

7.

5. A primer pair for amplifying dsRNA, characterized in that: The dsRNA is the dsRNA described in claim 4, and the primer pair comprises an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.

4.

6. A preparation for reducing the egg laying amount of Locust spp., characterized in that: The formulation comprises the dsRNA as claimed in claim 4.

7. The preparation according to claim 6, characterized in that The preparation also includes an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.

4.

8. A method for reducing the egg laying amount of Locust spp., characterized in that: The dsRNA of claim 4 is synthesized and introduced into the locust.

9. The method according to claim 8, characterized in that The concentration of the dsRNA is 1.2 μg / μL to 2.0 μg / μL.

10. Use of the dsRNA according to claim 4, the primer pair according to claim 5, or the preparation according to claim 6 for reducing the egg laying amount of Locust esculenta.

Images