Artificial fusion gene for regulating generation and stress adaptability of plant 22-nt siRNA

Abstract

The invention discloses an artificially fused nucleic acid, which comprises a sequence of a DCL2 gene and a sequence of a DCL4 gene with a carbon short containing a second dsRBD, compared with a wild type DCL2 gene, the artificially fused nucleic acid comprises DCL2-RBD2 and a plant expression factor for expressing the DCL2-RBD2 gene, and the DCL2 and DCL4 genes are derived from plants. According to the application, it is creatively found that expression of the DCL2-RBD2 artificial fusion gene in the plant can improve the expression quantity of 22-nt siRNA of the plant and significantly promote the adaptability of the plant to adversity.

Description

Technical Field

[0001] The present application relates to the field of plant technology, and in particular, to genes and applications for regulating the production of 22-nt siRNA in plants. Background Art

[0002] Small RNA is a type of non-coding RNA molecule with a length of 18 to 30 nt that is widely present in various eukaryotic organisms. It regulates gene expression at the transcriptional, post-transcriptional and translational levels. After nearly 20 years of research, scientists have made significant research results on the synthesis and mechanism of small RNA. Small RNAs of different sources and lengths regulate plant growth and development and environmental responses in different ways in plants. The exploration and research of the mechanism of action and biological functions of small RNAs have enriched people's understanding of the specificity and complexity of small RNA regulation of gene expression, and are also of great significance for agricultural production applications. Recent studies have shown that 22-nt siRNAs specifically produced by DCL2 proteins in plants can be amplified and efficiently regulate plant gene expression and respond to external stresses. In plant mutants highly enriched with 22-nt siRNAs, plant stress signals such as high salt, ABA, drought, and disease resistance are significantly activated, and play an important role in the process of plant response to extreme nitrogen stress. However, under normal plant growth conditions, the content of endogenous 22-nt siRNA in plants is very low due to factors such as competition between DCL4, which is responsible for producing 21-nt siRNA in the plant, and DCL2 dsRNA substrate. Therefore, developing a method to significantly increase the content of 22-nt siRNA in plants will be an effective way to improve plant adaptability to various adversities. Summary of the invention

[0003] In order to solve the above problems, the present application invents a method for effectively increasing the production of 22-nt siRNA in plants through an artificial gene fusion method. Therefore, the first purpose of the present application is to provide an artificially fused nucleic acid, which comprises a gene of DCL2 and a sequence containing a second dsRBD derived from the carbon terminus of DCL4 (named DCL2-RBD2), as well as an expression factor for expressing DCL2-RBD2 in plants, and both the DCL2 and DCL4 gene sequences are from plants.

[0004] The present application found that when DCL2 in Arabidopsis thaliana is fused with a sequence containing a second dsRBD from the carbon end of DCL4 (named DCL2-RBD2), expressing the gene in the plant can significantly increase the content of 22-nt siRNA and increase the adaptability of the plant to multiple resistances. Based on this, the present application also found that plant DCL2 and DCL4 proteins are very conservative, suggesting that the protein after DCL2 in other plants is fused with the dsRBD (DCL2-RBD2) of DCL4 may also have the same function as the homologous protein in Arabidopsis thaliana. Therefore, after expressing DCL2-RBD2, the content of plant 22-nt siRNA and the adaptability to adversity can be significantly increased.

[0005] In one embodiment, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and liverwort.

[0006] In one embodiment, the function-enhanced DCL2-RBD2 gene must contain the following features: a DCL2 gene sequence and a sequence containing a second dsRBD at the carbon terminus of DCL4.

[0007] In one embodiment, the nucleic acid further comprises a tag fragment.

[0008] In one embodiment, the tag fragment is used to encode GST, GFP, 6His or Flag.

[0009] In one embodiment, the expression factor includes at least one of a DCL2 native promoter, a strong promoter, a transcriptionally activated promoter, and a stress-activated promoter;

[0010] Optionally, the native promoter is a sequence of the DCL2 genome;

[0011] Optionally, the strong promoter is selected from at least one of CaMV35S, NOS, UBQ10, and Actin1;

[0012] Optionally, the transcription activator is selected from at least one of dCas9-VP64, dCas9-VP16, dCas9-VPR, dCas9-SunTag, and dCas9-SAM;

[0013] Optionally, the stress-activated promoter is selected from at least one of Lea, RD29A, ABA2, DREB2A, COR15, and PRs.

[0014] The second object of the present application is to provide an isolated protein, including DCL2 and a protein encoded by a dsRBD gene fused with DCL4.

[0015] In one embodiment, compared to the wild-type DCL2 protein, DCL2-RBD2 includes the full length of the DCL2 protein and the amino acid fragment after 1581 of DCL4.

[0016] The third object of the present application is to provide a nucleic acid construct containing the above-mentioned nucleic acid.

[0017] In one embodiment, the nucleic acid construct is a cloning vector or an expression vector.

[0018] The fourth object of the present application is to provide a host cell that satisfies at least one of the following characteristics (1) to (3):

[0019] (1) containing the above-mentioned nucleic acid which is foreign to the host cell;

[0020] (2) containing the above-mentioned nucleic acid construct;

[0021] (3) Express the above proteins.

[0022] In one embodiment, the host cell is Agrobacterium.

[0023] The fifth object of the present application is to provide a plant cell, tissue or organ that satisfies at least one of the following features (1) to (4):

[0024] (1) The genome contains the above-mentioned nucleic acid;

[0025] (2) containing the above-mentioned nucleic acid construct;

[0026] (3) containing the above-mentioned host cell;

[0027] (4) expressing the above proteins;

[0028] In one embodiment, the plant cell or tissue or organ is derived from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and Marchantia polyphylla.

[0029] The sixth object of the present application is to provide a method for constructing a transgenic plant with increased expression of 22nt siRNA, the method comprising:

[0030] (1) providing a nucleic acid delivery medium material carrying a DC12-RBD2 gene expression vector;

[0031] (2) contacting the plant cells, tissues or organs with the nucleic acid delivery medium in step (1), so that the nucleic acid contained in the expression vector is transferred into the plant cells and the DCL2-RBD2 expression function corresponding to the nucleic acid delivery medium is exerted;

[0032] (3) using the plant cells or tissues / organs contacted with the nucleic acid delivery medium in step (2) to generate new plant materials, and screening the new plant materials expressing DCL2-RBD2;

[0033] (4) The newly grown plant materials are further cultured into plants to obtain transgenic plants with increased expression of 22-nt sRNA.

[0034] In one embodiment, the transgenic plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens, and liverwort.

[0035] The seventh object of the present application is to provide the use of the above-mentioned transgenic plants in regulating plant growth and development and plant stress response.

[0036] In one embodiment, the plant growth and development activities include at least one of seed germination, tissue and / or organ growth, flowering, fruit ripening, organ senescence, leaf shedding, bud shedding, bud shedding, pod shedding, and fruit shedding;

[0037] Plant stress responses include biological stress responses of plants to at least one of insects, bacteria, fungi, and viruses and / or non-biological stress responses to at least one of planting density, heat, low temperature, drought, waterlogging, and salinity-alkali stress.

[0038] The eighth object of the present application is to provide an agent for increasing the expression level of the plant DCL2-RBD2 gene and / or an agent for inhibiting or activating the activity of the plant DCL2-RBD2 protein for use in preparing a method for regulating the 22-nt siRNA content in a plant, regulating the sensitivity of a plant to stress response, or preparing a plant with increased stress resistance.

[0039] In one embodiment, the agent that inhibits or activates the activity of the plant DCL2-RBD2 protein comprises a chemical inhibitor or a chemical agonist; and / or

[0040] The preparation for increasing the expression level of the plant DCL2-RBD2 gene comprises at least one of a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist that activates the expression of the DCL2-RBD2 gene.

[0041] The ninth objective of the present application is to provide a method for preparing a plant with increased 22-nt siRNA expression, including normal expression, overexpression and / or stress-induced expression of DCL2-RBD2.

[0042] In one embodiment, DCL2-RBD2 is normally expressed in plants, specifically: using the DCL2 gene's own promoter to drive expression; and / or

[0043] Overexpression of DCL2-RBD2 in plants specifically includes:

[0044] The expression level of the plant is increased using at least one of a gene delivery vehicle material containing a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist. The DCL2-RBD2 gene overexpression vector includes a vector containing a strong promoter for overexpressing the DCL2-RBD2 gene and the DCL2-RBD2 gene and / or a vector containing CRISPR-mediated induction of DCL2-RBD2 expression.

[0045] Stress-induced expression of DCL2-RBD2 in plants specifically includes:

[0046] A gene delivery vehicle material containing a DCL2-RBD2 gene adversity-induced expression vector is used, wherein the DCL2-RBD2 gene adversity-induced expression vector is a vector containing a promoter for adversity-induced expression of the DCL2-RBD2 gene.

[0047] In one embodiment, the controlled 22-nt siRNA sensitivity is selected from the group consisting of seed germination, tissue and organ growth, flowering, fruit ripening, organ senescence, leaf abscission, bud abscission, bud abscission, pod abscission, fruit abscission, biological stress response to at least one of insects, bacteria, fungi, and viruses, and non-biological stress response to at least one of planting density, heat, low temperature, drought, waterlogging, and saline-alkali stress.

[0048] In one embodiment, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and liverwort.

[0049] In one embodiment, the plant is Arabidopsis thaliana, and the gene expressed is DCL2-RBD2, which comprises a DCL2 gene and a second dsRBD2 sequence at the carbon terminus derived from DCL4. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0051] Figure 1 This is a diagram showing the structural analysis of DCL2 and DCL4 domains in Example 1 of the present application;

[0052] Figure 2 Schematic diagram of the gene structure of DCL2-RBD2 and the pCAMBIA1300 vector structure used in Example 2 of the present application;

[0053] Figure 3 This is a schematic diagram of the DCL2-RBD2 phenotype analysis and siRNA analysis in Example 3 of the present application;

[0054] Figure 4 The DCL2-RBD2 transcriptome analysis diagram and the adversity signal analysis diagram in Example 4 of the present application;

[0055] Figure 5 This is a diagram of the DCL2-RBD2 adversity physiological test analysis in Example 5 of the present application;

[0056] Figure 6 This is a diagram of the conservation analysis of the DCL2 and DCL4 protein sequences in Example 6 of the present application. DETAILED DESCRIPTION

[0057] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each embodiment is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0058] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0059] As mentioned above, the 22-nt siRNA specifically produced by the DCL2 protein in plants can be amplified and efficiently regulate plant gene expression and respond to external stress. In plant mutants with high enrichment of 22-nt siRNA, plant stress signals such as high salt, ABA, drought, and disease resistance are significantly activated, and play an important role in the plant response to extreme nitrogen stress. However, under normal plant growth conditions, in the process of dsRNA being cut into siRNA by DCL protein, DCL2 and DCL4 responsible for the production of 21-nt siRNA are in a competitive relationship. DCL4 usually takes precedence over DCL2, resulting in a very low content of endogenous 22-nt siRNA in plants. At present, the mechanism by which DCL2 and DCL4 recognize and compete for dsRNA substrates and produce 22nt and 21nt siRNAs respectively remains unclear.

[0060] Although 22-nt siRNA has the function of activating stress signals, the content of endogenous 22-nt siRNA in plants is very low. Therefore, developing a method to significantly increase the content of 22-nt siRNA in plants will be an effective way to improve the adaptation of plants to various stresses.

[0061] In order to solve the above technical problems, the first aspect of the present application provides an artificially fused nucleic acid, which can increase the expression of plant 22-nt siRNA and thus promote the stress resistance of plants. The nucleic acid comprises a gene of DCL2 and a sequence containing a second dsRBD at the carbon end of DCL4 (named DCL2-RBD2), and an expression factor for expressing DCL2-RBD2 in plants, and the DCL2 and DCL4 gene sequences are from plants.

[0062] In some specific embodiments, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and liverwort.

[0063] The present application also found that plant DCL2 and DCL4 proteins are very conservative, suggesting that the protein after DCL2 fusion with DCL4 dsRBD (DCL2-RBD2) in other plants may also have the same function as the homologous protein in Arabidopsis. Therefore, the present application believes that the expression of DCL2 and DCL4 dsRBD2 fused with different plant sources in plants may significantly increase the content of plant 22-ntsiRNA and affect the adaptability to adversity.

[0064] In one embodiment, the function-enhanced DCL2-RBD2 gene must contain the following features: a DCL2 gene sequence and a second dsRBD sequence at the carbon terminus of DCL4.

[0065] In one embodiment, the nucleic acid further comprises a tag fragment for distinguishing endogenous DCL2.

[0066] In one embodiment, the tag fragment is used to encode GST, GFP, 6His or Flag.

[0067] In one embodiment, the expression factor includes at least one of a DCL2 native promoter, a strong promoter, a transcriptionally activated promoter, and a stress-activated promoter;

[0068] In some specific embodiments, the self promoter is a sequence of the DCL2 genome;

[0069] In some specific embodiments, the strong promoter is selected from at least one of CaMV35S, NOS, UBQ10, and Actin1;

[0070] In some specific embodiments, the transcription activator is selected from at least one of dCas9-VP64, dCas9-VP16, dCas9-VPR, dCas9-SunTag, and dCas9-SAM;

[0071] In some specific embodiments, the stress-activated promoter is selected from at least one of Lea, RD29A, ABA2, DREB2A, COR15, and PRs.

[0072] The second aspect of the present application is to provide an isolated protein, including DCL2 and a protein encoded by a gene after fusion of dsRBD of DCL4D.

[0073] In one embodiment, compared to the wild-type DCL2 protein, DCL2-RBD2 includes the full length of the DCL2 protein and the amino acid fragment after 1581 of DCL4.

[0074] Under the above circumstances, the DCL2-RBD2 fusion protein can efficiently produce 22-nt siRNA, thereby improving the plant's resistance to adverse environments.

[0075] The third aspect of the present application is to provide a nucleic acid construct containing the above-mentioned DCL2-RBD2 nucleic acid for expressing DCl2-RBD2 in plants, thereby increasing the expression level of 22-nt siRNA.

[0076] In some embodiments, the nucleic acid construct is a cloning vector or an expression vector, which is used to transfer the nucleic acid into a host cell to achieve replication and expression of the nucleic acid.

[0077] The fourth aspect of the present application provides a host cell for replication and expression of the above-mentioned nucleic acid, and further for improving the abundance of plant 22-nt siRNA and adaptability to adversity, wherein the host cell satisfies at least one of the following characteristics (1) to (3):

[0078] (1) containing the above-mentioned nucleic acid which is foreign to the host cell;

[0079] (2) containing the above-mentioned nucleic acid construct;

[0080] (3) Express the above proteins.

[0081] In some embodiments, the host cell is Agrobacterium.

[0082] The fifth aspect of the present application provides a plant cell, tissue or organ, which enables the plant to have a higher abundance of 22-nt siRNA, and the plant cell, tissue or organ satisfies at least one of the following characteristics (1) to (4):

[0083] (1) The genome contains the above-mentioned nucleic acid;

[0084] (2) containing the above-mentioned nucleic acid construct;

[0085] (3) containing the above-mentioned host cell;

[0086] (4) expressing the above proteins;

[0087] In some embodiments, the plant cell is derived from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, Nymphaea cyanea, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and Marchantia polyphylla.

[0088] The present application discovered that the above-mentioned plants have DCLs homologous proteins, and the DCLs proteins of the above-mentioned plants have very high similarity to each other. The DCLs proteins in the above-mentioned plants may have similar functions. Considering the conservation of the siRNA pathway in plants, the present application believes that the functions of the artificially fused DCL2-RBD2 protein in the plant siRNA pathway are very likely to be the same, and therefore the above-mentioned plant cells can affect the expression level of the above-mentioned plant 22-nt siRNA.

[0089] The sixth aspect of the present application is to provide a method for constructing a transgenic plant with increased expression of 22-nt siRNA, the method comprising:

[0090] (1) providing a nucleic acid delivery medium material carrying a DC12-RBD2 gene expression vector;

[0091] (2) contacting the plant cells, tissues or organs with the nucleic acid delivery medium in step (1), so that the nucleic acid contained in the expression vector is transferred into the plant cells and the DCL2-RBD2 expression function corresponding to the nucleic acid delivery medium is exerted;

[0092] (3) using the plant cells or tissues / organs contacted with the nucleic acid delivery medium in step (2) to generate new plant materials, and screening the new plant materials expressing DCL2-RBD2;

[0093] (4) The newly grown plant materials are further cultured into plants to obtain transgenic plants with increased expression of 22-nt siRNA.

[0094] Specifically, the DCL2-RBD2 transgenic expression technology includes constructing an overexpression vector containing DCL2's own promoter, a strong promoter and the DCL2-RBD2 gene, or constructing a CRISPR-mediated induction-activated overexpression vector for DCL2-RBD2 expression. Gene editing technology, and adversity-activated promoter-driven DCL2-RBD2 expression vector. The nucleic acid delivery medium can be Agrobacterium or a nanomaterial with nucleic acid delivery function. Vector refers to a self-replicating DNA molecule that transfers a DNA fragment (target gene) to a recipient cell in genetic engineering recombinant DNA technology. The three most commonly used vectors are bacterial plasmids, bacteriophages, and animal and plant viruses. The vector used in this application is specifically a bacterial plasmid. The new plant material can specifically be a new plant, a new seedling, or a regenerated seedling.

[0095] Furthermore, after obtaining DCL2-RBD2 transgenic new plant materials, new plant materials with positive DCL2 gene expression are screened, and transgenic plants with constitutively or inducibly increased DCL2 expression are obtained through further cultivation.

[0096] In some embodiments, the transgenic plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and liverwort.

[0097] The DCL2 in Arabidopsis discovered in the present application is a protease responsible for producing 22-nt siRNA. By enhancing its function through artificial modification, the abundance of plant 22-nt siRNA can be increased. Based on this, the present application also found that plant DCL2 and DCL4 proteins are very conserved, suggesting that DCL2 of other plants modified by similar methods may also have the same function as the homologous protein in Arabidopsis. Therefore, the present application can construct expression vectors containing DCL2-RBD2 of different plants, and then prepare different transgenic plants with enhanced DCL2 function, and obtain different transgenic plants with significantly increased 22-nt siRNA abundance.

[0098] The seventh aspect of the present application provides the use of the above transgenic plants in regulating plant growth and development and plant stress response.

[0099] In some embodiments, the plant growth and development activities include at least one of seed germination, tissue and / or organ growth, flowering, fruit ripening, organ senescence, leaf shedding, bud shedding, bud shedding, pod shedding, and fruit shedding;

[0100] Plant stress responses include biological stress responses of plants to at least one of insects, bacteria, fungi, and viruses and / or non-biological stress responses to at least one of planting density, heat, low temperature, drought, waterlogging, and salinity-alkali stress.

[0101] The eighth aspect of the present application provides the use of an agent for increasing the expression level of the plant DCL2-RBD2 gene and / or an agent for inhibiting or activating the activity of the plant DCL2-RBD2 protein in the preparation of a method for regulating the 22-nt siRNA content in a plant, regulating the sensitivity of a plant to stress response, or preparing a plant with increased stress resistance.

[0102] In one embodiment, the agent that inhibits or activates the activity of the plant DCL2-RBD2 protein comprises a chemical inhibitor or a chemical agonist; and / or

[0103] The preparation for increasing the expression level of the plant DCL2-RBD2 gene comprises at least one of a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist for activating the expression of the DCL2-RBD2 gene.

[0104] In some embodiments, the formulation for increasing the expression level of the plant DCL2-RBD2 gene includes at least one of a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist that activates DCL2 gene expression.

[0105] The ninth aspect of the present application is to provide a method for preparing a plant with increased expression of 22-nt siRNA, including normal expression, overexpression and / or stress-induced expression of DCL2-RBD2.

[0106] In one embodiment, DCL2-RBD2 is normally expressed in plants, specifically: using the DCL2 gene's own promoter to drive expression; and / or

[0107] Overexpression of DCL2-RBD2 in plants specifically includes:

[0108] The expression level of the plant is increased using at least one of a gene delivery vehicle material containing a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist. The DCL2-RBD2 gene overexpression vector includes a vector containing a strong promoter for overexpressing the DCL2-RBD2 gene and the DCL2-RBD2 gene and / or a vector containing CRISPR-mediated induction of DCL2-RBD2 expression.

[0109] Stress-induced expression of DCL2-RBD2 in plants specifically includes:

[0110] A gene delivery vehicle material containing a DCL2-RBD2 gene adversity-induced expression vector is used, wherein the DCL2-RBD2 gene adversity-induced expression vector is a vector containing a promoter for adversity-induced expression of the DCL2-RBD2 gene.

[0111] In one embodiment, the controlled 22-nt siRNA sensitivity is selected from the group consisting of seed germination, tissue and organ growth, flowering, fruit ripening, organ senescence, leaf abscission, bud abscission, bud abscission, pod abscission, fruit abscission, biological stress response to at least one of insects, bacteria, fungi, and viruses, and non-biological stress response to at least one of planting density, heat, low temperature, drought, waterlogging, and saline-alkali stress.

[0112] In one embodiment, the plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella fasciata, Physcomitrella patens, and liverwort.

[0113] The embodiments of the present application will be described in detail below in conjunction with examples, but the present application is not limited to these examples. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0114] Example 1 DCL2, DCL4 protein domain and sequence analysis

[0115] The TAIR database, GenBank number and coding sequence information of the two genes of Arabidopsis thaliana DCL2 (the sequence is shown in SEQ ID NO.1) and DCL4 (the sequence is shown in SEQ ID NO.2) are as follows:

[0116] >DCL2(AT3G03300, NM_001202869, SEQ ID NO.1)

[0117] gcgaaagcttctgtcatagtctcacagtcacaacaaaacagtcaatcccccaaagaattatggtagcagtcaataatcccataaataatcttcttca

[0118] acagtttttttctcttaaatttttgtttcgaaaaccgctcactacttcttaatcgaaatgactgactgagagctttagcttttgatcgttcgtcttcgtgattc

[0119] ctttcttcttcttctccgctactgtctgtacctgaaactactgtcctcgatcgctgctttgtctttcgagattaaaaaagttaggtttttttttcgtaaatcta

[0120] ctgtatatgttttagatgaccatggatgctgatgcgatggaaactgagaccactgatcaagtctctgcttctcctctacattttgccagaagttatcag

[0121] gtagaggcacttgagaaagctatcaagcagaacactattgtcttcttggagactggttctggcaagacccttattgctattatgcttcttcgtagctat

[0122] gcctaccttttccgcaagccttcaccatgcttctgtgtcttcttggttcctcaagtggttcttgtcactcagcaagcagaagccctgaagatgcatact

[0123] gatctaaaagttggtatgtattggggagacatgggggtggacttttgggattcttcaacatggaaacaagagttgataaatatgaggttctggtga

[0124] tgacccctgccattttgctcgacgcgttgaggcatagttttctgagcttgagcatgatcaaggttctaatagttgatgagtgtcatcatgcaggggga

[0125] aagcaccctttatgcttgtatcatgagggagttctatcataaggagttaaattctggaacttccaatgttccacggatatttgggatgactgcttcacttg

[0126] tgaaaacaaagggtgaaaatctggatagctactggaaaaaaattcatgaactcgaaactctaatgaattcaaaggtctatacctgtgagaatgagt

[0127] ctgtgctggctgggtttgtccccttttctacaccaagcttcaagtattaccagcacataaaaataccaagtcccaaacgagcaagcttggtagagaa

[0128] gctagaaagactaacgataaagcatcgcttatcccttggaaccttggatctcaactcctctactgttgattctgtagagaagagactgttgaggata

[0129] agttcaactctaacatattgtttggatgatctcggaattttgctggcccagaaggctgctcagtcattgtcagccagtcagaatgactctttcttgtgg

[0130] ggcgaactaaatatgtttagcgtggccttggtaaaaaaattctgctctgatgcttcacaggagtttttggctgagatacctcaaggtcttaattggagt

[0131] gttgcaaacataaatggaaatgcggaggcaggtctcctaactttaaaaactgtctgcctcattgagactcttcttggttatagctccttggagaacat

[0132] acggtgcatcatttttgtggatagggtgataacagccatcgttctggaatcccttttggctgagattcttccaaactgtaataactggaaaaccaagt

[0133] acgttgcaggaaataactctggtctgcaaaatcaaactcggaagaagcaaaatgaaattgtggaagacttccggagaggcttggttaacatcatt

[0134] gtagcaacatctattctagaggagggtctagatgttcaaagttgcaacctggttatcagatttgaccctgcatccaacatttgcagtttcatacagtct

[0135] cgtgggcgtgctagaatgcaaaattcagattatttgatgatggtggaaagcggagatctgttaacacaatctcgattaatgaaatatctttctggtgg

[0136] gaaaagaatgcgcgaagagtctttggatcattctcttgttccctgtccacctcttccagatgattcagatgaaccactcttccgtgtcgaaagtactg

[0137] gagcaactgtaactcttagctcaagcgtcagcttaatatatcattactgctcaaggcttccttcagatgagtacttcaaaccagcccctagatttgatg

[0138] taaacaaggatcaggggagttgcaccctttaccttcctaagagttgcccagtaaaagaagttaaagctgaagcaaataataaagtgttaaaacaa

[0139] gctgtctgtcttaaagcttgcattcaactgcacaaagttggagctctaagtgatcatcttgtgcctgacatggttgtggcggaaactgtctcacaaaa

[0140] actcgagaaaatccaatataacacagagcagccatgttacttccccccagagctagtctcccagttttcagcacagccggagacaacataccact

[0141] tctacttaaagaatgaagccaaactctccaagaaattttcatttaaacgatgttttactaggcaccagagttgtgcttgaagatgacattgggaaca

[0142] caagcttccggttggaagatcataggggtacaatagctgtgacattgagttatgtgggagcttttcaccttacacaagaagaggtccttttctgtaga

[0143] agatttcagataactctattccgagttcttttagatcacagtgtggaaaatttgatggaggcattgaatggattgcatctcagagatggggtggcactt

[0144] gattatctactagttccatccactcattcacatgaaacatctcttattgattgggaagtgatcagatccgtgaatctaacttctcatgaggttttggaaaa

[0145] acacgaaaattgttctaccaacggtgcttctcgcattctacacacaaaagacggcttgttttgtacttgtgtcgtacaaaatgcattggtttacacacc

[0146] acataatggatacgtctactgcacaaaaggtgttctcaacaatctaaacggaaattcattattgaccaagagaaattctggcgatcagacttacattg

[0147] agtactacgaggaaaggcatgggattcaattaaattttgtggatgaacctcttctaaatggaagacacattttcacgttgcatagttatcttcacatgg

[0148] ccaagaagaagaaggagaaagagcatgacagggaatttgttgaactacctcctgagctttgtcatgtcattttgtccccaaatatcagttgatatgat

[0149] ctattcatatacttttatcccatctgttatgcaacgcattgaatctttgcttatagcatacaacctgaagaaaagcatcccaaaagtcaatattccaacc

[0150] attaaggttttggaagctattacgacaaagaagtgcgaagatcagttccacttggaatcactagaaactcttggtgactcttttctgaaatatgctgttt

[0151] gtcagcaactattccaacactgtcatactcaccatgagggtcttcttagcacgaagaaagatggaatgatttcaaatgtcatgctctgccaatttgga

[0152] tgtcagcagaaacttcagggatttatccgcgatgagtgttttgaacccaaaggttggatggttccaggtcaatcatctgcagcttattcacttgtaaa

[0153] cgatactctacccgagtctagaaacatatacgttgctagtaggaggaatctgaaacgcaagagtgtggccgatgttgtagaatcattaattggagc

[0154] atatctcagcgagggaggtgaacttgcagctttgatgttcatgaattgggttggaataaaggtcgactttacaactacgaagatccagagagattc

[0155] cccatacaagcagagaagcttgtgaatgtaggttatatggagtcgctgttgaattacagttttgaggataagtctcttctagttgaagcattgactca

[0156] tggttcatacatgatgcctgaaattccaagatgctatcagcggttggagttcctcggtgactctgtattggattatctcataaccaagcatctatacga

[0157] caaatatccttgtctgtcccctggactattaaccgacatgcgatcagcttctgttaacaatgaatgttatgccctagtggcggtgaaagcaaacctgc

[0158] acaaacacatcctgtacgcctctcatcatctccataagcacatctctagaactgtcagtgagtttgaacagtcttcttttgcaatccactttcggatggg

[0159] aatccgatatatcttttccaaaggttcttggagatgtgatagaatctctagcaggcgcgatatttgttgactcaggttacaacaaggaagtagtgtttg

[0160] caagtattaaaccacttttgggttgtatgataactccagagactgtcaagttgcatcctgtgagagagttgacagaattatgtcagaagtggcagttc

[0161] gagttgagtaaagctaaagatttcgattctttcacggttgaggtgaaagctaaggagatgagttttgctcacacagcaaaggcctctgataagaaa

[0162] atggccaagaaattggcttacaaagaagtcttgaacttacttaagaacagcctggactactaaatttctttttcttgtcaactttattgcattcattcatga

[0163] taataattgtcttagataacttacattactcttgattaaatttgaaaatttatttattttttgtttctttcttctccattgtgaattatttaataac

[0164] >DCL4(AT5G203200,NM_001343652,SEQ ID NO.2)

[0165] gttttgttcttgggactgaattttcctgcaggttcttgttatgactccacaaatacttctgcataacttacagcactgtttcatcaagatggagtgtatctc

[0166] ccttctaatatttgatgagtgtcaccatgctcaacaacaaagcaaccatccttatgcagaaatcatgaaggttttctataaatcggaaagtttacaacg

[0167] gcctcgaatatttggaatgactgcatctccagttgttggcaaagggtcttttcaatcagagaatttatcgaaaagcattaatagccttgaaaatttgct

[0168] caatgccaaggtttattcagtggaaagcaatgtccagctggatggttttgtttcatctcctttagtcaaagtatattattatcggtcagctttaagtgatg

[0169] catctcaatcgaccatcagatatgaaaacatgctggaggacatcaaacagcggtgcttggcatcacttaagctgctgattgatactcatcaaacac

[0170] aaaccctcctaagtatgaaaaggcttctcaaaagatctcatgataatctcatatatactctgctgaatcttggcctctggggagcaatacaggctgct

[0171] aaaatccaattgaatagtgaccataatgtacaaagacgagcctgtgggaaagaatcctaagtcaaagatatgtgatacatatctttctatggctgctg

[0172] aggccctctcttctggtgttgctaaagatgagaatgcatctgacctcctcagcttagcggcgttgaaggaaccattattctctagaaagctagttcaa

[0173] ttgattaagatcctttcggtattcaggctagagccacacatgaaatgtataaatttgtcaatcggattgtgactgcaagaacattgtcatgcatactaa

[0174] ataacttggaactgctacggtcttggaagtctgatttccttgttggacttagttctggactgaagagcatgtcaagaaggagtatggaaacaatactt

[0175] aaacggttccaatctaaagagctcaatttactggttgccactaaagttggtgaagaaggccttgatattcagacatgctgtcttgtgatccgttatgat

[0176] ttaccagagactgttaccagcttcatacagtccagaggtcgtgctcgaatgcctcagtctctgaatatgcgtttctagtggacagcggaaacgagaaa

[0177] gagatggatcttattgaaaattttaaagtaaatgaagatcgaatgaatctagaaattacttacagaagctcagaggaaacttgtcctagacttgatga

[0178] ggagttatacaaagttcatgagacaggagcttgtatcagtggtggaagcagcatctcccttctctataaatattgttctaggcttccacatgatgaatt

[0179] ttttcagcccaagccagagtttcaattcaagcctgttgacgaatttggtggaactatctgtcgcataactttacctgctaatgctcctataagtgaaatc

[0180] gaaagttcactactaccttcgacagaagctgctaaaaaggatgcttgtctaaaggctgtgcatgagttgcacaacttgggtgtacttaacgattttct

[0181] gttgccagattccaaggatgaaattgaggacgaattgtcagatgatgaatttgattttgataacatcaaaggtgaaggctgttcacgaggtgacctg

[0182] tatgagatgcgtgtaccagtcttgtttaaacaaaagtgggatccatctacaagttgtgtcaatcttcattcttactatataatgtttgtgcctcatcccgct

[0183] gataggatctacaaaaagtttggtttcttcatgaagtcacctcttcccgttgaggctgagactatggatatcgatcttcaccttgctcatcaaagatct

[0184] gtaagtgtaaagatttttccatcaggggtcacagaattcgacaacgatgagataagactagctgagcttttccaggagattgccctgaaggttctttt

[0185] tgaacggggggagctgatcccggactttgttcccttggaactgcaagactcttctagaacaagcaaatccaccttctaccttcttcttccactctgtc

[0186] tgcatgatggagaaagtgttatatctgtagattgggtgactatcagaaactgcttgtcatcaccaatctttaagactccatctgttttagtggaagatat

[0187] atttcctccttcgggctctcatttaaagctagcaaatggctgctggaatattgatgatgtgaagaacagcttggtttttacaacctacagtaaacaattt

[0188] tactttgttgctgatatctgccatggaagaaatggtttcagtcctgttaaggaatctagcaccaaaagccatgtggagagcatatataagttgtatgg

[0189] cgtggaactcaagcatcctgcacagccactcttgcgtgtgaaaccactttgtcatgttcggaacttgcttcacaaccgaatgcagacgaatttgga

[0190] accacaagaacttgacgaatacttcatagagattcctcccgaactttctcacttaaagataaaaggattatctaaagacatcggaagctcgttatcct

[0191] tgttaccatcaatcatgcatcgtatggagaatttactcgtggctattgaactgaaacatgtgctgtctgcttcgatccctgagatagctgaagtttctg

[0192] gtcacagggtactcgaggcgctcacaacagagaaatgtcatgagcgcctttctcttgaaaggcttgaggtgcttggtgatgcattcctcaagtttg

[0193] ctgttagccgacacctttttctacaccatgatagtcttgatgaaggagagttgactcggagacgctctaacgttgttaacaattccaacttgtgcagg

[0194] cttgcaataaaaaaaaatctgcaggtctacatccgtgatcaagcattggatcctactcagttctttgcatttggccatccatgcagagtaacctgtga

[0195] cgaggtagccagtaaagaggttcattccttgaatagggatcttgggatcttggagtcaaatactggtgaaatcagatgtagcaaaggccatcattg

[0196] gttgtacaagaaaacaattgctgatgtggttgaggctcttgtgggagctttcttagttgacagtggcttcaaaggtgctgtgaaatttctgaagtggat

[0197] tggtgtaaatgttgattttgaatccttgcaagtacaagatgcttgtattgcaagcaggcgctacttgcccctcactactcgcaataatttggagaccct

[0198] tgaaaaccagcttgactataagttcctccacaaaggtctacttgtacaagcctttatccatccatcttacaacaggcatggaggaggctgctaccag

[0199] agattggagtttcttggggatgctgttctggactacttgatgacatcctattttttcacagtcttcccgaaactgaaacctggtcaactgaccgatctaa

[0200] gatctctctcagtaaataatgaggcgctagcaaatgttgctgtcagtttttcgctaaagagatttctattttgcgagtccatttatcttcatgaagttatag

[0201] aggattataccaatttcctggcatcttccccattggcaagtggacaatctgaaggtccaagatgcccaaaggttcttggtgacttggtagaatcctgt

[0202] ttgggggctcttttcctcgattgtgggttcaacttgaatcatgtctggactatgatgctatcatttctagatccggtcaaaaacttgtctaaccttcagatt

[0203] agtcctataaaagaactgattgaactttgccagtcttacaagtgggatcgggaaatatcagcgacgaaaaaggatggtgcttttactgttgaactaa

[0204] aagtgaccaagaatggttgttgccttacagtttctgcaactggtcggaacaaaagagagggcacaaaaaaggctgcacagctgatgattacaaa

[0205] cctgaaggctcatgagaacataacaacctcccatccgttggaggatgttctgaagaatggcatccgaaatgaagctaaattaattggctacaatga

[0206] agatcctatagatgttgtggatcttgttgggctggacgttgaaaacctaaatatcctagaaacttttggcgggaatagtgaaagaagcagctcatac

[0207] gtcatcagacgaggtctcccccaagcaccatctaaaacagaagacaggcttcctcaaaaggccatcataaaagcaggtggaccaagcagcaa

[0208] aaccgcaaaatccctcttgcacgaaacatgtgttgctaactgttggaagccaccacacttcgaatgttgtgaagaggaaggaccaggccacctg

[0209] aaatcattcgtctacaaggtaatcctggaagttgaagatgcgcccaatatgacattggaatgttatggtgaggctagagcaacgaagaaaggtgc

[0210] agcagagcacgctgcccaagctgctatatggtgcctcaagcattctggattcctttgctgatgatctcgagcggctatatatcggttagaaatagat

[0211] gttatcataggcatatataacttttaccagagctacatattagcatatatgatcgacacctacaatttctcgaaagagaaaaaaggatgtctgaaaact

[0212] aaccttaaaccatagattttggagcggagagctttcggcaaaagttctcttcgattgctcttctgaatttctgaatataagtatatgtttacttgtacttga

[0213] tgaacccatagcatgataggctccaaaaatatagtttactcatctctcatgcatcaaatatgttcctgtgtgatcttaattaaacaatatatgaactaag

[0214] cgtta

[0215] like Figure 1 Therefore, this example first analyzed the domain structures of two proteins, DCL2 and DCL4, in Arabidopsis thaliana, and found that both proteins contained typical functional domains of DICER proteins. However, the carbon terminus of DCL2 contained only one dsRBD, while DCL4 contained two.

[0216] Example 2 Construction of DCL2-RBD2 artificial fusion gene and preparation of transgenic plants

[0217] like Figure 2 As shown in A, the amino acid after 1581 of the carbon terminus of the DCL4 protein is added to the carbon terminus of DCL2 to form the fusion recombinant gene DCl2-RBD2.

[0218] In this example, the promoter of DCL2 itself was used to drive the expression of the DCL2-RBD2 gene, and the 2763 bp Arabidopsis genomic sequence before its translation start codon ATG was used as the promoter.

[0219] In constructing the transgenic vector of DCL2-RBD2, the genomic sequence of DCL2 was used, and the gene sequence encoding amino acid 1581 of DCL4 (such as SEQ ID NO.3 and SEQ ID NO.4) was connected to its carbon end. The genomic sequence containing the promoter of DCL2 and the dsRBD2 of DCL4 were connected into the pCAMBIA1300 vector linearized with HindIII and BamHI by Gibson connection ( Figure 2 B in, the sequence is as SEQ ID NO.5 and SEQ ID NO.6) and fused with GFP tag, HindIII and BamHI sites, and the amplification primers are:

[0220] F1 CGACGGCCAGTGCCAAGCTTGCAAGATGTTGTGAAGAGAAGTGGG(SEQ ID NO.3)

[0221] R1 ACTATTCCCGTAGTCCAGGCTGTTCTAAGTAAGTTCAAG(SEQ ID NO.4)

[0222] F2 CTGGACTACGGGAATAGTGAAAGAAGCAGCT(SEQ ID NO.5)

[0223] R2 CCCTTGCTCACCATGGATCCGCAAAGGAATCCAGAATGCTTGAGG(SEQ ID NO.6)

[0224] Then, gDCL2-RBD2-GFP (the sequence is as shown in SEQ ID NO.7) was transferred into the Arabidopsis dcl2 mutant by the Agrobacterium-mediated floral dip method, and after obtaining T1 generation seeds, the successfully transgenic seedlings T1 were obtained by Hyg antibiotic screening. After harvesting T2 and T3 generation seeds, the DCL2-RBD2 protein in the seedlings was detected respectively, and the transgenic strains with normal expression were retained until the homozygous strain gDCL2-RBD2-GFP was obtained.

[0225] Specifically, the gDCL2-RBD2-GFP sequence is as follows, where the italic font represents the DCL2 promoter, the bold font represents the GFP tag sequence, and the underline represents the DCL2 gene and RBD2 sequence:

[0226] >gDCL2-RBD2-GFP (SEQ ID NO.7)

[0227]

[0228]

[0229]

[0230]

[0231]

[0232] Example 3 Phenotypic analysis of increased expression of 22-nt siRNA

[0233] In the dcl4 mutant, the activity of DCL2 is increased, and some plants produce 22-ntsiRNA derived from the SMXL4 / 5 gene to cause anthocyanin accumulation. In this example, DCL2-RBD2 transgenic plants were planted in soil, and the phenotype of the plants was observed after 3 weeks. Figure 3As shown in A, the rosette leaves of DCL2-RBD2 plants turned purple, suggesting that the plant had accumulated 22-nt siRNA. Further, the sRNA of the plant was sequenced and analyzed, and the results showed that the expression of 22-nt siRNA in DCl2-RBD2 was significantly increased, and these siRNAs were derived from different genes, including NIA1 / 2, SMXL4 / 5 and other gene loci ( Figure 3 B and C in ).

[0234] Example 4 Transcriptome Analysis of DCL2-RBD2

[0235] In order to further verify the function of the 22-nt siRNA accumulated in DCL2-RBD2, this example sequenced and analyzed the transcriptome of the DCL2-RBD2 pair, and further analyzed the activation and inhibition of different signal pathways in the transgenic plants. Figure 4 The up-regulated genes in the transgenic plants shown in A and B are significantly enriched in various stress signals, such as hypoxia, bacteria, ABA, high salt, injury, drought, low temperature, etc. In contrast, the down-regulated genes are mostly enriched in plant organ development, lipid metabolism, pollen development, cell differentiation and other pathways. Further analysis of ABA / drought and disease defense-related genes showed that a large number of genes in these pathways were significantly activated ( Figure 4 C).

[0236] Example 5 Phenotypic analysis of DCL2-RBD2 plants under stress conditions

[0237] like Figure 4 As shown, in DCL2-RBD2 plants, the expression of genes related to stress response signals was significantly upregulated, and the upregulation of ABA / drought and disease defense related genes related to this example was very significant. Therefore, this example analyzed the effect of DCL2-RBD2 on diseases, such as Botrytis cinerea, and the phenotype of plants under drought conditions. In this example, leaves of the sixth rosette leaf of 3-week-old Arabidopsis were selected for in vitro Botrytis cinerea testing, and 5 μL of 1x10 5 spores / mL of Botrytis cinerea spores, and the infected area of ​​the leaves was observed after three days of cultivation. Figure 5 As shown in A and B in Figure 1, the DCL2-RBD2 plant showed significant resistance to Botrytis cinerea. This example also conducted a drought test on the plants. After 12 days of water deprivation and then rehydration, DCL2-RBD2 showed resistance to drought after 5 days ( Figure 5 C and D in ).

[0238] Example 6 Conservative analysis of plant DCL2 and DCL4 protein sequences

[0239] There are about 390,000 existing plants on Earth, of which more than 400 have sequenced their genomes. According to the evolutionary relationship between species, 18 plants from different genera and species were selected from plants with detailed genome sequence information as representative plants of the entire plant kingdom, including Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, blue star water lily, camphor, Selaginella chinensis, Physcomitrella pedunculata, liverwort, Irish moss, Blanchard charophyte, Chlamydomonas reinhardtii, and dinoflagellates. In this example, the DCL1, DCL2, DCL3, and DCL4 protein sequences in Arabidopsis thaliana were first used as bait to retrieve and fish for DCLs homologous proteins in 18 plants on the species evolution tree in the EnsemblPlants database (https: / / plants.ensembl.org / index.html). After removing duplicate sequences and truncated sequences, a total of 76 DCLs proteins were retrieved in 14 plants in this example, including:

[0240] 4 in Arabidopsis thaliana, DCL1 (AT1G01040), DCL2 (AT3G03300), DCL3 (AT3G43920), and DCL4 (AT5G20320);

[0241] 8 Chinese cabbages, GSBRNA2T00085395001, GSBRNA2T00150500001, GSBRNA2T00076103001, GSBRNA2T00097268001, GSBRNA2T00097267001, GSBRNA2T00015447001, GSBRNA2T00046505001, GSBRNA2T00154241001, GSBRNA2T00059315001;

[0242] 5 corns, Zm00001eb001570, Zm00001eb219690, Zm00001eb143950, Zm00001eb045380, Zm00001eb426330;

[0243] 14 wheat, TraesCS1A02G160900, TraesCS1D02G158000, TraesCS2A02G364700, TraesCS2B02G383300, TraesCS2D02G362700, TraesCS3A02G415400, TraesCS3B02G450600, TraesCS3D02G411200, TraesCS4B02G347300, TraesCS4D02G342300, TraesCS5A02G073600, TraesCS5A02G516000, TraesCS5B02G079900, TraesCS5D02G086900;

[0244] 5 for rice: Os01g0909200, Os03g0121800, Os03g0583900, Os04g0509300, Os10g0485600;

[0245] Millet 5, SETIT_033853mg, SETIT_033906mg, SETIT_000027mg, SETIT_039134mg, SETIT_009168mg;

[0246] soybean 7, GLYMA_03G262100, GLYMA_04G057400, GLYMA_09G025300, GLYMA_09G025400, GLYMA_13G156500, GLYMA_17G104100, GLYMA_19G261200;

[0247] 6 tomatoes, Solyc10g005130.3, Solyc06g048960.3, Solyc11g008540.2, Solyc11g008520.2, Solyc08g067210.3, Solyc07g005030.3;

[0248] Brachypodium distachyon 5, BRADI_1g15440v3, BRADI_1g21030v3, BRADI_1g77087v3, BRADI_3g29287v3, BRADI_5g15337v3;

[0249] 4 blue star water lilies, NC10G0232840, NC3G0205240, NC3G0221110, NC3G0224940;

[0250] 4 without oil camphor, AMTR_s00018p00015000, AMTR_s00016p00258500, AMTR_s00033p00127000, AMTR_s00026p00051870;

[0251] 2 Selaginella chinensis, SELMODRAFT_86110 and SELMODRAFT_108314;

[0252] 4 Physcomitrella patens, Pp3c2_15900, Pp3c1_24960, Pp3c1_24950, Pp3c26_370;

[0253] There are 3 land moneys, MARPO_0003s0184, MARPO_0003s0222, and MARPO_0113s0032.

[0254] Next, this example performed similarity and domain analysis on the sequences of 64 plant DCLs proteins. Figure 6 As shown, these proteins all have typical structural domains of DCLs proteins. Among them, DCL2 is closer to DCL4 in evolution, and these DCL2 proteins have only one dsRBD at their carbon end. Considering the conservation of siRNA pathways in plants, the present application believes that the DCL2 of the above plants can increase the content of plant 22-ntsiRNA after fusing with the dsRBD2 of DCL4 of its corresponding species, thereby improving the adaptability of the plant species to multiple adversities.

[0255] Example 7 Potential application of DCL2-RBD2 fusion recombinant gene in production practice

[0256] The present application found that after DCL2 in Arabidopsis thaliana was fused to a sequence containing dsRBD2 at the carbon end of DCL4, the expression of 22-nt siRNA in plants could be significantly increased, thereby promoting the adaptability of plants to multiple adversities. The present application also found that plant DCL2 and DCL4 proteins are very conservative, suggesting that the DCL2-RBD2 fusion recombinant gene expressed in other plants may also have the same function as the homologous protein in Arabidopsis thaliana.

[0257] To this end, this example proposes the following two applications of the DCL2-RBD2 gene in agricultural production practice:

[0258] 1) Through a stable transgenic method or a transient transfection method, plants with stable or stress-induced expression of DCL2-RBD2 are obtained, thereby improving the plant's adaptability to stress.

[0259] 2) By spraying an inhibitor or agonist of DCL2-RBD2 protein activity, the protein activity of DCL2-RBD2 in the transgenic plant is regulated to reduce or enhance the intensity of the plant's stress response.

[0260] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0261] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. An artificially fused nucleic acid, characterized in that: The artificial fusion nucleic acid comprises a sequence of the DCL2 gene, a sequence of the DCL4 gene and a second dsRBD sequence RBD2 at its carbon end. Compared with the wild-type DCL2 gene, the artificial fusion nucleic acid comprises DCL2-RBD2 and a plant expression factor for expressing the DCL2-RBD2 gene. The DCL2 and DCL4 genes are derived from plants.

2. The nucleic acid according to claim 1, characterized in that The plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens, liverwort and the like.

3. The nucleic acid according to claim 1, characterized in that The expression factor includes at least one of a gene promoter, a strong promoter, a stress-induced promoter and a transcription activator; Preferably, the promoter is derived from the DCL2 genomic sequence; Preferably, the strong promoter is selected from at least one of CaMV35S, NOS, UBQ10, and Actin1; Preferably, the stress-induced promoter is selected from at least one of Lea, RD29A, ABA2, DREB2A, COR15, and PRs; Preferably, the transcription activator is selected from at least one of dCas9-VP64, dCas9-VP16, dCas9-VPR, dCas9-SunTag, and dCas9-SAM.

4. An isolated protein, characterized in that It comprises a DCL2-RBD2 recombinant fusion protein with enhanced function, wherein the DCL2-RBD2 recombinant fusion protein is encoded by the nucleic acid according to any one of claims 1 and 2.

5. A nucleic acid construct, characterized in that Contains the nucleic acid according to any one of claims 1 to 3.

6. The nucleic acid construct according to claim 5, characterized in that The nucleic acid construct is a cloning vector or an expression vector.

7. A host cell, characterized in that Satisfies at least one of the following characteristics (1) to (3): (1) containing the nucleic acid according to any one of claims 1 to 3 which is exogenous to the host cell; (2) expressing the protein of claim 4; (3) A method comprising the nucleic acid construct according to claim 5 or 6.

8. The host cell according to claim 7, characterized in that The host cell is Agrobacterium.

9. A plant cell, tissue or organ, characterized in that Satisfies at least one of the following characteristics (1) to (5): (1) A genome comprising the nucleic acid according to any one of claims 1 to 3; (2) expressing the protein described in claim 4; (3) containing the nucleic acid construct according to claim 5 or 6; (4) comprising the host cell according to claim 7 or 8; (5) The DCL2-RBD2 gene is normally expressed or overexpressed.

10. A method for constructing a transgenic plant that significantly accumulates endogenous 22-nt siRNA content, characterized in that: The method comprises: (1) Providing a nucleic acid delivery medium material carrying a normal expression, overexpression, and adversity-induced expression vector of the DCL2-RBD2 gene; (2) contacting the plant cells, tissues or organs with the nucleic acid delivery medium in step (1), so that the nucleic acid contained in the expression vector is transferred into the plant cells and the DCL2-RBD2 expression function corresponding to the nucleic acid delivery medium is exerted; (3) using the plant cells or tissues / organs contacted with the nucleic acid delivery medium in step (2) to generate new plant materials, and screening the new plant materials with normal expression, overexpression and stress-induced expression of DCL2-RBD2; (5) The newly grown plant materials are further cultivated into plants to obtain transgenic plants with changes in their ability to adapt to stress.

11. Use of the transgenic plant prepared according to the method of claim 10 in regulating plant growth and development and plant stress response.

12. Use of an agent for increasing the expression level of plant DCL2-RBD2 gene and / or an agent for inhibiting or activating plant DCL2-RBD2 protein activity in the preparation of a preparation for regulating the endogenous 22-nt siRNA content and / or stress adaptability of a plant.

13. The use according to claim 12, characterized in that The preparation for inhibiting or activating the activity of plant DCL2-RBD2 protein includes a chemical inhibitor or agonist that changes the activity of DCL2-RBD2 protein; and / or the preparation for increasing the expression level of plant DCL2-RBD2 gene includes at least one of a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist that activates DCL2-RBD2 gene expression.

14. A method for preparing plants with significant accumulation of endogenous 22-nt siRNA, comprising normal expression, stress-induced expression and overexpression of DCL2-RBD2 to prepare plants with increased 22-nt siRNA content.

15. The method according to claim 14, characterized in that Normally express DCL2-RBD2 in plants, specifically: use the DCL2 gene's own promoter to drive expression; and / or Overexpression of DCL2-RBD2 in plants, including: At least one of a gene delivery vehicle material containing a DCL2-RBD2 gene overexpression vector, a DCL2-RBD2 mRNA nano-delivery complex, and a chemical agonist is used to increase the expression level in the plant, wherein the DCL2-RBD2 gene overexpression vector includes a vector containing a strong promoter for overexpressing the DCL2-RBD2 gene and the DCL2-RBD2 gene and / or a vector containing a CRISPR system-mediated induction of DCL2-RBD2 expression; Stress-induced expression of DCL2-RBD2 in plants includes: A gene delivery vehicle material containing a DCL2-RBD2 gene adversity-induced expression vector is used, wherein the DCL2-RBD2 gene adversity-induced expression vector is a vector containing a promoter for adversity-induced DCL2-RBD2 gene expression.

16. The use according to claim 12 or 13, or the method according to any one of claims 14 to 15, characterized in that: The controlled endogenous 22-nt siRNA is selected from the following groups: seed germination, tissue and organ growth, flowering, fruit ripening, organ senescence, leaf abscission, bud abscission, shoot abscission, pod abscission, fruit abscission, biological stress response to at least one of insects, bacteria, fungi, and viruses, and non-biological stress response to at least one of planting density, heat, low temperature, drought, waterlogging, and saline-alkali stress.

17. The plant cell, tissue or organ according to claim 9, the use according to claim 12 or 13, or the method according to any one of claims 10, 14 to 16, characterized in that: The plant is selected from at least one of Arabidopsis thaliana, cabbage, corn, wheat, rice, millet, soybean, tomato, Brachypodium distachyon, water lily, Cinnamomum camphora, Selaginella chinensis, Physcomitrella patens, liverwort and the like.

18. The plant cell, tissue or organ according to claim 9, the use according to claim 12 or 13, or the method according to any one of claims 10, 14 to 16, characterized in that: The plant is Arabidopsis thaliana, and the expressed nucleic acid is DCL2-RBD2, which comprises a DCL2 gene and a sequence of a second dsRBD2 at the carbon end derived from DCL4.

Images