Application of OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia
By utilizing the OSGEP gene as a biomarker, kits and drugs for the screening, diagnosis, and treatment of AML have been developed, solving the problems of low diagnostic accuracy and poor prognosis in AML and achieving more effective disease monitoring and treatment outcomes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2026-03-13
Smart Images

Figure CN119307617B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia. Background Technology
[0002] Acute myeloid leukemia (AML) is a heterogeneous hematologic malignancy that seriously threatens human health, and its incidence rate ranks first among adult leukemias in my country. Its pathogenesis is complex, often accompanied by abnormal changes in cell differentiation, proliferation, and apoptosis. AML progresses rapidly, with a natural course of only a few months, and patient prognosis varies greatly, with a high mortality rate; the five-year survival rate with traditional chemotherapy is only 20-35%. With the increasing aging of my country's population, the incidence of AML has been rising in recent years.
[0003] The diagnosis, classification, and prognostic evaluation of AML have traditionally relied on morphological and cytogenetic testing. However, for AML with normal karyotypes, the diagnostic accuracy is low, and there is a lack of readily available universal biomarkers. Currently, treatment options for AML patients mainly include combination chemotherapy, the use of hypomethylating agents, and hematopoietic stem cell transplantation. The "7+3" chemotherapy regimen, which involves 7 days of cytarabine combined with 3 days of anthracyclines such as daunorubicin, remains the standard treatment for the vast majority of patients. However, due to high relapse rates and drug resistance, the long-term survival and cure rates for AML patients are low. Therefore, further elucidating the mechanisms of AML development and progression, and identifying more biomarkers or targets for early diagnosis, treatment, and prognosis of AML, is of great significance.
[0004] The OSGEP gene encodes tRNA N 6 O-adenosylthreonylcarbamoyltransferase protein O-sialyl glycoprotein endopeptidase (OSGEP) is a highly conserved catalytic subunit of the KEOPS complex. Recent studies have shown that OSGEP is involved in cell proliferation and mitochondrial metabolism; knocking down the OSGEP gene may inhibit cell proliferation, affect protein translation, and induce cell death. The OSGEP gene is one of the pathogenic genes for Galloway-Mowat syndrome (GAMOS), leading to microcephaly, developmental delays in growth and intelligence, and nephrotic syndrome. Summary of the Invention
[0005] The purpose of this invention is to provide an application of the OSGEP gene in the preparation of products for screening, diagnosis, prognostic assessment and prevention of acute myeloid leukemia.
[0006] The following technical solutions are used to achieve the above objectives.
[0007] The first aspect of this invention provides the application of the OSGEP gene or a reagent for detecting the expression level of the OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia.
[0008] In some embodiments, the nucleotide sequence of the OSGEP gene is shown in SEQ ID NO:1.
[0009] A second aspect of the present invention provides the application of a primer set for amplifying the OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia, the primer set comprising a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer with a sequence as shown in SEQ ID NO:7.
[0010] A third aspect of the present invention provides a kit for detecting acute myeloid leukemia, the kit comprising a reagent for detecting the expression level of the OSGEP gene.
[0011] In some embodiments, the reagent for detecting OSGEP gene expression includes a primer set for amplifying the OSGEP gene, the primer set including a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer with a sequence as shown in SEQ ID NO:7.
[0012] The fourth aspect of the present invention provides the application of the kit for detecting acute myeloid leukemia as described above in the preparation of products for screening, diagnosing, monitoring the course of acute myeloid leukemia, or assessing the prognosis of patients with acute myeloid leukemia.
[0013] The fifth aspect of this invention provides the use of the OSGEP gene and / or its encoded protein in the preparation of a medicament for the prevention and / or treatment of acute myeloid leukemia.
[0014] The sixth aspect of this invention provides the use of the OSGEP gene in the preparation of a product for screening drugs for acute myeloid leukemia. Specifically, the product may be a cell line.
[0015] The seventh aspect of this invention provides the application of a cell line with inhibited OSGEP gene expression in screening drugs for acute myeloid leukemia.
[0016] In some embodiments, the cell line is HL-60 cells.
[0017] In some embodiments, the OSGEP gene expression-inhibiting cell line is a cell line that can stably express short hairpin RNA that inhibits OSGEP gene expression; preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8 or SEQ ID NO:10, more preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8.
[0018] In this invention, the inventors discovered and verified for the first time that the OSGEP gene is highly expressed in patients with acute myeloid leukemia (AML), and that AML patients with high expression have a decreased overall survival rate. Furthermore, by constructing an OSGEP gene-specific knockdown leukemia cell line, they found that OSGEP gene knockdown inhibits leukemia cell proliferation, arrests the cell cycle, and induces apoptosis. Based on these findings, the OSGEP gene can serve as a biomarker for screening, diagnosis, dynamic monitoring of disease progression, and prognostic assessment of AML. It can also be applied to the screening, preparation, and testing of novel anti-AML drugs, creating conditions for the development of new drugs to treat AML. Attached Figure Description
[0019] Figure 1 This is a graph showing the differences in OSGEP expression between AML patients and normal individuals (NC) in the TNMplot database.
[0020] Figure 2 This is the result of a correlation analysis between OSGEP gene expression and overall survival in AML patients in the Kaplan-Meier plotter database.
[0021] Figure 3 This refers to the expression of OSGEP in healthy individuals (Normal) and AML patients in clinical samples.
[0022] Figure 4 This is a ROC analysis graph based on the expression results of OSGEP in clinical samples.
[0023] Figure 5 The knockdown efficiency results for OSGEP; among which Figure 5 A represents the expression level of the OSGEP gene in various interfering HL-60 cell lines detected by qRT-PCR; Figure 5 B represents the efficiency of OSGEP protein knockdown in shOSGEP-1 and shOSGEP-3 using Western blotting. Figure 5 C represents the detection of t6A modification levels in shOSGEP-1 and shOSGEP-3 cell lines.
[0024] Figure 6 To observe the changes in cell proliferation capacity after OSGEP gene knockdown using the CCK-8 assay; among which... Figure 6 A represents the changes in the cell proliferation capacity of shOSGEP-1 cells. Figure 6 B represents the changes in the cell proliferation capacity of shOSGEP-3.
[0025] Figure 7To detect the effect of OSGEP gene knockdown on apoptosis in HL-60 cells using flow cytometry; among which Figure 7 A represents the effect of shOSGEP-1 on apoptosis in HL-60 cells. Figure 7 B represents the effect of shOSGEP-3 on apoptosis in HL-60 cells.
[0026] Figure 8 To detect the effect of OSGEP gene knockdown on the HL-60 cell cycle using flow cytometry; among which Figure 8 A represents the effect of shOSGEP-1 on the HL-60 cell cycle. Figure 8 B represents the effect of shOSGEP-3 on the HL-60 cell cycle.
[0027] Figure 9 To determine the relative survival rate and maximum half-inhibitory concentration (IC50) of shOSGEP-1 and shNC cells after incubation with different concentrations of cytarabine for 48 hours. 50 ). Detailed Implementation
[0028] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0029] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0030] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0031] In this invention, the high expression of the OSGEP gene in patients with acute myeloid leukemia (AML) was discovered for the first time, and this finding was verified by analysis of the INMplot database. Furthermore, analysis of the Kaplan-Meier plotter database confirmed that the overall survival rate of AML patients with high OSGEP expression was reduced. Additionally, an OSGEP gene knockdown leukemia cell line, HL-60, was constructed by infecting the HL-60 leukemia cell line with shRNA lentivirus. This demonstrated that OSGEP gene knockdown inhibits HL-60 cell proliferation, arrests the cell cycle, and induces apoptosis. Therefore, based on this discovery, the OSGEP gene can serve as a biomarker for screening, diagnosis, dynamic monitoring of disease progression, and prognostic assessment of AML. It can also be applied to the screening and testing of novel anti-AML drugs, creating conditions for the development of new drugs to treat AML.
[0032] The present invention will be described below with reference to specific embodiments.
[0033] Example 1: Database search and analysis of OSGEP expression in AML patients
[0034] During their long-term research on acute myeloid leukemia (AML), the inventors accidentally discovered that the OSGEP gene is highly expressed in AML patients. The DNA sequence of the OSGEP gene is (SEQ ID NO:1).
[0035]
[0036] To verify this finding, the inventors further compared the differences in OSGEP gene expression between AML patients and healthy individuals, analyzed gene expression data from AML patients and healthy samples in the INMplot (differential gene expression analysis in Tumor, Normal, and Metastatic tissues) database, and analyzed the correlation between OSGEP gene expression and overall survival of AML patients in the Kaplan-Meier plotter database.
[0037] like Figure 1 The results show the difference in OSGEP expression between AML patients and normal controls (NC) in the TNMplot database, with OSGEP being highly expressed in AML patients. Figure 2 This is the result of a correlation analysis between OSGEP gene expression and overall survival in AML patients from the Kaplan-Meier plotter database. In the figure, Time (months) represents overall survival (months), Probability represents cumulative survival, low represents samples with low OSGEP expression, high represents samples with high OSGEP expression, Number at risk represents the sample size, and p = 0.011 indicates a significant difference, meaning that the overall survival of AML patients with high OSGEP expression is significantly lower than that of AML patients with low OSGEP expression.
[0038] Example 2: Detection of OSGEP expression in clinical samples
[0039] 1. Experimental Methods
[0040] 1.1 Clinical Sample Collection and Processing
[0041] Peripheral blood samples were collected from 12 patients diagnosed with acute myeloid leukemia and 12 healthy individuals at Yuhuangding Hospital of Yantai University. 1 ml of whole blood was taken from each sample, and 3 ml of erythrocyte lysis buffer (EL) was added. The samples were incubated on ice for 10–15 min. After erythrocyte lysis was complete, the samples were centrifuged at 800 g for 10 min at 4°C, and the supernatant was discarded. 2 ml of erythrocyte lysis buffer (EL) was added to the pellet, and the samples were centrifuged at 800 × g for 10 min at 4°C, and the supernatant was discarded. 500 μl of QIAGEN RLT Plus Buffer was added, and the mixture was thoroughly mixed before storage at -80°C.
[0042] 1.2 RNA extraction
[0043] RNA was extracted according to the instructions of the QIAsymphony RNA Kit (QIAGEN), and the RNA concentration and purity were determined.
[0044] 1.3 cDNA reverse transcription
[0045] cDNA reverse transcription was performed using the HiScript III 1st Strand cDNA Synthesis Kit (Novizan). The specific procedures are as follows:
[0046] 1.3.1 Genomic DNA Removal
[0047] Prepare the following mixture in RNase-free centrifuge tubes:
[0048] <![CDATA[RNase-free ddH2O]]> to 10μL 5×gDNA wiper Mix 2μL Total RNA 10pg-1μg or Poly A+RNA 10pg-100ng
[0049] Mix gently by pipetting, incubate at 42°C for 2 minutes.
[0050] 1.3.2 Preparation of the first-strand cDNA synthesis reaction solution
[0051] Prepare the following mixture in RNase-free centrifuge tubes:
[0052]
[0053]
[0054] 1.3.3 Perform the first-strand cDNA synthesis reaction under the following conditions.
[0055] 37℃ 15min 85℃ 5s
[0056] After the reaction was complete, the product was added to 100 μL with RNase-free ddH2O, mixed well, dispensed, and stored.
[0057] 1.4 qRT-PCR
[0058] Gene expression levels were detected using the ChamQ Universal SYBR qPCR Master Mix (Novizan) quantitative PCR kit. The specific procedures are as follows:
[0059] Configure the qRT-PCR reaction system according to the table below:
[0060] 2×ChamQ Universal SYBR qPCR Master Mix 10μL Primer-F (10μM) 0.4μL Primer-R (10μM) 0.4μL Template 2μL <![CDATA[RNase-free ddH2O]]> to 20μL
[0061] The primer sequences used in the qRT-PCR were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and SRP14 and B2M were used together as internal control genes. The sequences are as follows:
[0062]
[0063] Reaction conditions:
[0064] First, pre-denaturation at 95℃ for 60s; then, denaturation at 95℃ for 10s, followed by annealing and extension at 60℃ for 40s, followed by fluorescence collection, for a total of 40 cycles.
[0065] 1.5 Statistical Analysis
[0066] All data were obtained from three independent experiments. Unpaired Student's t-tests were used to compare the means of two samples, and one-way ANOVA was used for pairwise comparisons among multiple groups. The significance level was set at α = 0.05, and P < 0.05 was considered statistically significant.
[0067] 2. Experimental Results
[0068] Figure 3 This study compared OSGEP expression in healthy individuals (Normal) and AML patients in clinical samples. The results showed that OSGEP expression was significantly higher in the AML group compared to healthy individuals. Further ROC curve analysis was performed... Figure 4 The ROC curve shows an AUC of 0.9442, a sensitivity of 90.91%, and a specificity of 95.45%.
[0069] Example 3: Construction of stable OSGEP gene interference strains and identification of knockdown efficiency
[0070] 1. Experimental Methods
[0071] 1.1 Construction of OSGEP gene interference stable cell lines
[0072] 1.1.1 Lentiviral Packaging, Sequencing Identification, and Titer Determination: The shRNA lentiviral vector (shOSGEP) targeting the OSGEP gene was synthesized by Sangon Biotech. The target sequence is as follows, with shNC serving as a negative control:
[0073] shRNA-1(SEQ ID NO:8):GGATTAACCTCCCCAGGATATC
[0074] shRNA-2(SEQ ID NO:9):CCATCGATATTGCAGTGGGTA
[0075] shRNA-3(SEQ ID NO:10):CAGAGGTATCGGACAGATGAA
[0076] shRNA-4(SEQ ID NO:11):CTGTATTGACAATGGAGCGAT
[0077] shRNA-NC (SEQ ID NO:12):ACAACAGCCACAACGTCTATC
[0078] 1.1.2 Lentiviral infection of cells and screening of stable cell lines: The leukemia cell line HL-60 was used as the experimental subject. First, cells were collected and seeded into 24-well plates, with a cell density of 1×10⁻⁶ cells per well. 5 Add 25–40 μL of lentivirus solution with a titer of 1 × 10⁸ TU / ml and 20 μL of HitransGP to each well. Prepare 500 μL of cell suspension per well using cell culture medium, mix thoroughly, and incubate at 37°C in a 5% CO₂ incubator for 48–72 hours. Observe cell status and fluorescence intensity, and replace culture dishes and culture medium as needed. Finally, when the infection efficiency reaches about 80%, add 2 μg / mL puromycin for screening. After 7–14 days, stable cell lines can be obtained and further cultured for subsequent experiments.
[0079] 1.2 Detection of OSGEP gene knockdown efficiency
[0080] 1.2.1 qRT-PCR: After extracting total RNA from the cells obtained in step 1.1 using an RNA extraction kit, the knockdown efficiency of OSGEP was detected by qRT-PCR. The experimental method was the same as in Example 2.
[0081] 1.2.2 Protein blotting:
[0082] (1) Protein extraction: Collect the cells obtained in step 1.1 and wash off the culture medium with PBS. Add cell lysis buffer and lyse on ice for 30 min. After lysis, centrifuge at 13000 rpm for 30 min at 4℃. Take part of the supernatant into a pre-cooled EP tube and detect the protein concentration by BCA method. Store the remaining supernatant sample at -20℃.
[0083] (2) SDS-PAGE gel electrophoresis: Prepare a 12% separating gel and slowly pour it into the gel. After the separating gel has completely solidified, pour the prepared 5% stacking gel onto the top layer (the formulations for the separating gel and stacking gel are as follows), insert the comb, and remove the comb after solidification. Place the gel in the electrophoresis tank and add 1×SDS electrophoresis buffer. Add protein samples to the sample wells and add protein markers to both sides of the sample wells. Separate the proteins by electrophoresis.
[0084] reagents 12% separating gel (mL) 5% stacking gel (mL) <![CDATA[ddH2O]]> 4.900 3.400 30% Acrylamide 6.000 0.830 1.5M Tris-HCl (pH=8.8) 3.800 / 1.0M Tris-HCl (pH=6.8) / 0.63 10% SDS 0.150 0.050 10% AP 0.150 0.050 TEMED 0.006 0.005
[0085] (3) Transfer: Take the PVDF membrane and immerse it in methanol for 30 seconds, wash it with distilled water for 2 minutes, then immerse the PVDF membrane and filter paper in pre-cooled wet transfer solution. Take the gel and immerse it in pre-cooled wet transfer solution. Finally, place the sponge, filter paper, PVDF membrane and gel in sequence from the positive electrode to the negative electrode. Transfer the membrane by constant current electrophoresis at 220 mA.
[0086] (4) Blocking: After the transfer is completed, the PVDF membrane is placed in 5% protein blocking solution and blocked at room temperature for 2 hours.
[0087] (5) Antibody incubation: After washing the membrane with TBST to remove the residual blocking solution, blot the membrane dry with qualitative filter paper, place the membrane on a wax plate, add the primary antibody working solution to evenly cover the PVDF membrane, and incubate overnight at 4°C; after recovering the primary antibody working solution, wash the PVDF membrane three times in TBST, 10 min each time; add horseradish peroxidase-labeled secondary antibody to the PVDF membrane, incubate at room temperature for 1.5 h, and wash three times with TBST, 10 min each time.
[0088] (6) Color development and imaging: In a dark room, the PVDF film is placed on a wax plate, and then the prepared chemiluminescent reagent (equal volumes of solution A and solution B are mixed) is added to cover the PVDF film and the image is displayed in the imaging system.
[0089] 1.2.3 t6A Modification Detection
[0090] (1) tRNA extraction: After collecting the cells obtained in step 1.1, add 1 mL TRIzol and 200 μL CHCl3, mix well and let stand for 2 min; centrifuge at 12000g for 10 min, take the supernatant and add 1 / 3 volume of EtOH, mix well and add to the silica gel column, let stand for 1 min; centrifuge at 3500g for 2 min, collect the lower layer filtrate; add 2 / 3 volume of EtOH, mix well and add to the silica gel column, let stand for 1 min; centrifuge at 3500g for 2 min, discard the filtrate; add 200 μL RNA Prep Buffer (Zymo kit), centrifuge for 2 min and discard the lower layer, wash twice; add 700 μL RNA Wash Buffer (Zymo kit), centrifuge for 2 min and discard the lower layer, wash twice; centrifuge at 12000g for 2 min, add 50 μL nuclease-free water, let stand for 2 min and centrifuge, collect the eluent. The extracted tRNA concentration was detected and subjected to 6% Urea-PAGE gel electrophoresis. After confirming the sample was qualified, it was stored at -80℃.
[0091] (2) t6A modification detection
[0092] 1) Sample hydrolysis: Place an appropriate amount of total tRNA sample into a 1.5 mL centrifuge tube, and add 1 / 7 of the total sample volume. Buffer, pre-incubate at 37°C for 10 min; prepare the mixed enzyme solution according to the volumes specified in the table below:
[0093] Stock solution of reagent Volume (μL) 10 U / μL RNase I 50 0.025U / μL phosphodiesterase I 100 0.025U / μL phosphodiesterase II 100 <![CDATA[RNase-free H2O]]> 250 Total volume 500
[0094] Add 10 μL of the mixed enzyme solution to the total tRNA, vortex to mix, and incubate at 37°C for 2.5-3 h. Add 2 μL of rSAP (1 U / μL) and continue incubation for 1 h. Terminate the reaction after incubation at 70°C for 10 min, centrifuge at 10000 rpm for 10 min, and transfer the supernatant to a sample vial for testing.
[0095] 2) Mass spectrometry detection
[0096] Chromatographic conditions:
[0097]
[0098]
[0099] Elution gradient:
[0100] Time (min) Mobile phase A% Mobile phase B% Flow rate 1 0.00min 98.00% 2.00% 0.200 mL / min 2 6.00min 68.00% 32.00% 0.200 mL / min 3 8.00min 20.00% 80.00% 0.200 mL / min 4 9.00min 98.00% 2.00% 0.200 mL / min 5 12.00min 98.00% 2.00% 0.200 mL / min
[0101] Mass spectrometry conditions:
[0102] Source gas parameters Drying gas temperature 250℃ Drying gas flow rate 14L / min Atomizing gas pressure 50psi Sheath gas temperature 300℃ Sheath gas flow rate 11L / min
[0103] 3) MRM method:
[0104] Compound Name Mother ion daughter ions Duration of stay Fragmentation voltage Collision energy polarity t6A 413.1 281.1 10 380 18 Positive t6A_2 413.1 162.1 10 380 18 Positive A 268.1 136.1 10 380 5 Positive G 284.1 152.1 10 380 10 Positive
[0105] 4) Results analysis: Student's t-test was used to compare each compound between the patient group and the healthy group.
[0106] 1.4 Statistical Analysis
[0107] All data were obtained from three independent experiments. Unpaired Student's t-tests were used to compare the means of two samples, and one-way ANOVA was used for pairwise comparisons among multiple groups. The significance level was set at α = 0.05, and P < 0.05 was considered statistically significant.
[0108] 2. Experimental Results
[0109] The knockdown efficiency of OSGEP was detected using qRT-PCR and Western blotting, such as... Figure 5 As shown, Figure 5 To assess the knockdown efficiency, qRT-PCR was used to detect the expression level of the OSGEP gene in the HL-60 cell line. The results showed that shOSGEP-1 and shOSGEP-3 had higher knockdown efficiency, so they were selected for subsequent experiments. Figure 5 B was used to verify the knockdown efficiency of OSGEP protein levels in shOSGEP-1 and shOSGEP-3 using Western blotting. The results showed that OSGEP protein expression was reduced in shOSGEP-1 and shOSGEP-3. Figure 5 C represents the t6A modification level. Compared with shNC, the t6A modification level in shOSGEP-1 and shOSGEP-3 cells was significantly reduced.
[0110] Example 4: Detecting the effect of OSGEP gene knockdown on HL-60 cell proliferation
[0111] 1. Experimental Methods
[0112] The cell line obtained in step 1.1 of Example 3 was seeded into a 96-well plate at a rate of 3000 cells per well, with 3 replicates per group. When the corresponding culture time was reached, 10 μL of CCK-8 reagent was added to each well, mixed well, and cultured at 37°C for another 4 h. The absorbance (OD) value was measured at a wavelength of 450 nm.
[0113] 2. Experimental Results
[0114] Figure 6 To observe the changes in cell proliferation capacity after OSGEP gene knockdown using the CCK-8 assay, the results showed that compared with shNC, shOSGEP-1 ( Figure 6 A) and shOSGEP-3 ( Figure 6 Cell proliferation in B) was inhibited.
[0115] Example 5: Detecting the effect of OSGEP gene knockdown on HL-60 cell apoptosis
[0116] 1. Experimental Methods
[0117] Collect the cell suspensions obtained from each group in step 1.1 of Example 3, centrifuge at 1000g for 5 min, discard the supernatant, gently resuspend the cells in PBS, take 50,000-100,000 resuspended cells, centrifuge at 1000g for 5 min, discard the supernatant, add 195 μl Annexin V-FITC binding solution to gently resuspend the cells, add 5 μl Annexin V-FITC and mix well; add 10 μl propidium iodide staining solution and mix well; incubate at room temperature in the dark for 15 min, and immediately use flow cytometry to detect the reaction after completion.
[0118] 2. Experimental Results
[0119] The results are as follows Figure 7 As shown, compared with shNC, shOSGEP-1 ( Figure 7 A) and shOSGEP-3 ( Figure 7The apoptosis rate of B) was significantly increased.
[0120] Example 6: Detecting the effect of OSGEP gene knockdown on the HL-60 cell cycle
[0121] 1. Experimental Methods
[0122] 1.1 Cell Sample Preparation: Collect the cell suspension obtained from each group in step 1.1 of Example 3, centrifuge at approximately 1000g for 5 minutes to precipitate the cells. Carefully aspirate the supernatant. Add approximately 1ml of pre-chilled PBS (on ice), resuspend the cells, and transfer to a 1.5ml centrifuge tube. Centrifuge again to precipitate the cells, and carefully aspirate the supernatant.
[0123] 1.2 Cell fixation: Add 1 ml of 70% ethanol pre-cooled in an ice bath, gently pipette to mix, and fix at 4°C for 30 minutes or longer. Centrifuge at approximately 1000g for 5 minutes to precipitate the cells.
[0124] 1.3 Preparation of propidium iodide staining solution: Add 0.5 ml staining buffer, 25 μl propidium iodide staining solution (20X), and 10 μl RNase A (50X) to each sample.
[0125] 1.4 Staining: Add 0.5 ml of propidium iodide staining solution to each tube of cell sample, slowly and thoroughly resuspend the cell pellet, and incubate at 37°C in the dark for 30 minutes.
[0126] 1.5 No washing is required. After passing the sample through a 200-mesh cell filter membrane, it is transferred to a flow cytometer.
[0127] 1.6 Flow cytometry detection and analysis: Red fluorescence was detected by flow cytometer at an excitation wavelength of 488 nm, and the cellular DNA content was analyzed using KALUZA analysis software.
[0128] 2. Experimental Results
[0129] To investigate the effect of OSGEP gene knockdown on the HL-60 cell cycle, flow cytometry was used to detect the cell cycle distribution of HL-60 cells. The results are as follows: Figure 8 As shown, compared to shNC, in shOSGEP-1 cells ( Figure 8 A) The proportion of cells in G1 phase increases, while the proportions of cells in S and G2 phases decrease, in shOSGEP-3 cells ( Figure 8 B) The proportion of cells in G1 phase increases while the proportion of cells in S phase decreases, indicating that the cell cycle is arrested in G1 phase.
[0130] Example 7: Inhibitory effect of cytarabine on the activity of HL-60 cells
[0131] 1. Experimental Methods
[0132] Collect shOSGEP-1 and shNC cells obtained in step 1.1 of Example 3, dilute them to 50,000 cells / ml, add complete culture medium (IMDM medium + 20% FBS + 1% penicillin / streptomycin solution + 0.25ug / ml puromycin), add 100μL of cells / well to each of 96-well plates, and incubate at 37℃ in a 5% CO2 cell culture incubator. Add different concentrations of cytarabine (0, 0.4, 0.8, 1.2, 1.6, 2.0, 2.4, 2.8, 3.2, 3.6μM), and after culturing for 48h, measure the relative cell viability and calculate the maximum half-inhibitory dose (IC50). 50 ).
[0133] 2. Experimental Results
[0134] like Figure 9 To determine the relative survival rate and maximum half-inhibitory concentration (IC50) of shOSGEP-1 and shNC cells after incubation with different concentrations of cytarabine for 48 hours. 50 The results showed that, under the same drug concentration treatment conditions, OSGEP knockdown cells exhibited stronger cell viability and a higher maximum half-inhibitory value compared to shNC cells, indicating drug tolerance. Cytarabine is a commonly used drug for treating acute myeloid leukemia (AML). The fact that knockdown cell lines showed greater tolerance to cytarabine suggests that the OSGEP gene may be related to the mechanism of action of cytarabine.
[0135] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0136] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. Application of a cell strain with inhibited OSGEP gene expression in screening of drugs for acute myeloid leukemia; the cell strain with inhibited OSGEP gene expression has increased tolerance to cytarabine drugs; The cell strain is HL-60 cells.
2. Use according to claim 1, wherein The cell strain with inhibited OSGEP gene expression is a short hairpin RNA capable of stably expressing inhibition of OSGEP gene expression in cells.
3. Use according to claim 2, wherein the compound is ###0002### The DNA sequence corresponding to the short hairpin RNA is shown in SEQ ID NO: 8 or SEQ ID NO:
10.
4. The use according to claim 3, wherein the compound is ###0002### The DNA sequence corresponding to the short hairpin RNA is shown in SEQ ID NO: 8.