Method for detecting rape pollen mutation by using sequencing technology

Abstract

The invention discloses a method for detecting rape pollen mutation by using a sequencing technology, and belongs to the technical field of rape molecular biology. The method comprises the following steps: (1) taking mutant oilseed rape as a pollen donor, planting wild oilseed rape around the mutant oilseed rape in a field, and freely pollinating the wild oilseed rape; (2) collecting wild type rape seeds in different directions and at different distances in a rape mature period, germinating samples at each sample point, mixing, and extracting DNA (Deoxyribonucleic Acid); (3) carrying out fixed-point sequencing by utilizing the mutant rape mutant gene fixed-point sequencing primer; and (4) analyzing the ratio of the mutant gene by using analysis software, and calculating the pollen drift frequency. The rape pollen drift distance and frequency are detected by utilizing a fixed-point sequencing technology and a rape mutant technology, DNA can be directly extracted for fixed-point sequencing after mixed samples are taken at different distances, and the frequency of hybridization caused by exogenous pollen drift is determined according to the frequency of the mutant detected by sequencing.

Description

Technical Field

[0001] The invention belongs to the technical field of rapeseed molecular biology, and in particular relates to a method for detecting rapeseed pollen mutations by utilizing sequencing technology. Background Art

[0002] Traditional methods for detecting the frequency and distance of rapeseed pollen drift mainly include the following: (1) Pollen trap method: pollen traps (such as yellow sticky boards or specially designed pollen traps) are set up around the rapeseed field. By counting and classifying the captured pollen, the drift frequency and impact distance of pollen can be evaluated. (2) Genetic marker analysis method: pollen with markers (such as different chromosome markers or transgenic markers) can be used in the experiment, and then a receiving field can be set up near the experimental field to observe and analyze the appearance of the marked pollen in the receiving field. Genetic marker analysis is performed on the progeny after pollination by molecular biological methods to calculate the frequency and distance of pollen diffusion to determine whether it is affected by external pollen. (3) Field survey: During the flowering period of rapeseed, areas at different distances are selected for field sampling, and pollen concentrations at different distances are counted and analyzed to understand the pattern of pollen drift. These traditional methods can help researchers understand the spread range of pollen in rapeseed plants during pollination and its potential impact on the ecosystem and agricultural production. The above methods are labor-intensive and have high detection costs. Summary of the invention

[0003] The present invention provides a method for detecting rapeseed pollen mutations using sequencing technology, the method comprising the following steps:

[0004] (1) Using the mutant rapeseed as the pollen donor, the mutant rapeseed was planted in the field with wild-type rapeseed planted around it to allow free pollination;

[0005] (2) Wild-type rapeseed seeds were collected at different directions and distances during the rapeseed maturity period. The samples at each sampling point were germinated and mixed before DNA extraction;

[0006] (3) Use site-specific sequencing primers of mutant rapeseed mutant genes to carry out site-specific sequencing;

[0007] (4) Use analytical software to analyze the proportion of mutant genes and calculate the frequency of pollen drift.

[0008] Preferably, the mutant rapeseed in step (1) is a mutant rapeseed with altered fatty acids.

[0009] More preferably, the fatty acid altered mutant rapeseed in step (1) is a rapeseed fatty acid altered single gene mutant LPAT2.

[0010] More preferably, the planting area of ​​the mutant rapeseed in step (1) is (4-6) meters × (4-6) meters.

[0011] More preferably, the planting area of ​​wild-type rapeseed in step (1) is (50-70) meters × (50-70) meters.

[0012] More preferably, the sequence of the site-directed sequencing primer in step (3) is as shown in SEQ ID NO.2-3.

[0013] More preferably, the wild type rapeseed in step (1) is Zhongshuang No. 11.

[0014] The present invention also provides application of the above method in detecting pollen drift frequency.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention uses fixed-point sequencing technology and rapeseed mutant technology to detect the drift distance and frequency of rapeseed pollen. Mixed samples can be directly taken at different distances and DNA can be extracted for fixed-point sequencing. The frequency of hybridization caused by exogenous pollen drift can be determined based on the mutant frequency detected by sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The genotype diagrams of the recipient rapeseed, mutant rapeseed, hybrid of the recipient rapeseed and mutant rapeseed, and BnaA09g36950D in Example 1 are shown.

[0018] Figure 2 The results of the sample detection of the PCR product recovery in Example 1. Note: The gel image numbers correspond to the numbers in the above table, M2: D2000 Marker, and the amount of each sample is 8ul / well.

[0019] Figure 3 This is a schematic diagram of the planting of recipient rapeseed and mutant rapeseed in Example 2.

[0020] Figure 4 The results of the 48 DNA samples tested in Example 2. Note: M2: D2000 Marker, 8ul / well for each sample. DETAILED DESCRIPTION

[0021] The creation process of the rapeseed fatty acid-altering single gene mutant LPAT2 involved in the following examples can be found in the following paper, pages 52-59: Zhang Kai. Functional study on the regulation of oil synthesis in Brassica napus seeds by lysophosphatidic acid acyltransferases 2 and 5 [J]. [2024-11-05].

[0022] Example 1

[0023] Step 1: Primer design. The rapeseed mutant BnLPAT2 gene has 5 copies, namely: BnaA09g36950D, BnaC08g28660D, BnaA07g17400D, BnaA04g02290D, BnaCnng07280D. Among them, BnaA07g17400D, BnaA04g02290D, BnaCnng07280D have not mutated, while BnaA09g36950D and BnaC08g28660D have homozygous insertions or deletions. The insertion of 1bp base leads to the early stop codon, so the deduced CDS sequence will become shorter, and the early stop codon will trigger the NMD mechanism to degrade these abnormal mRNAs. BnaA09g36950D has a higher mutation incidence and homozygous rate, so we selected BnaA09g36950D for site-specific sequencing.

[0024] The full-length SEQ ID NO.1 of BnaA09g36950D is as follows:

[0025] ATGGCGATGGCAGCAGCTGTGATTGTGCCTCTGGGCATTCTCTTCTTCATTTCTGGTCTCGTTGTCAATCTCC

[0026] TTCAGGTGGGTTTCCTAAAATTCGAAACCTTTTTTGAAAGATTCCGTTGATGTTCCTGCGTTTGTAGATC

[0027] TCCTCTTAGGGCACTGAGCATAAGAGTTATTATTGTTTAGTTTTGGTGGTTTTTTGAAGTGTAAAGTTTCTTC

[0028] TTTTATGTTGATTTTTCAATTAGACTTAGAAAATGTTTGTCTCCGTCCGTCTGAGTTTTTCTAGGTTTTGGTGTG

[0029] AATGAGCCTTGTCTCTGAGCTTCGTTTGATGTTTTTACAACTTTTTTTGTTTGTTATTTCAGGCGATTTGTTAT

[0030] GTTCTTATTCGACCTCTGTCTAAGAACACATACAGAAAAATCAACCGGGTGGTTGCTGAAACCTTGTGGCT

[0031] TGAGCTTGTCTGGATTGTTGACTGGTGGGCTGGTGTAAAGGTATCATCTTTCCCCTTTAAGTAAAATGACT

[0032] AGGAAGCAGACCTGTGCCTGCGTATTAGTAGCTTATACAAAGTCAAGGAACAGATTATGTTTATGACCATC

[0033] TTTTTCATCTTGTTACTGTGCTCATGACCGTCCTCTGAGACTTCATTTTCCGTTTTGTCCTAGATCCAAGTATT

[0034] TGCGGATAATGAGACCTTCAATAGAATGGGTAAGTTCCTGCTTATTGAGAAACATAATATAAAAGTCATGTAT

[0035] ATGAAAGTTTCTATAGCTTCAGTGTCTGTTTCTATACTTTTTTTTTCAGGCAAAGAACATGCTCTTGTCGTTT

[0036] GTAATCACCGAAGTGATATTGATTGGCTTGTGGGATGGATTCTCGCTCAGGTAACATAACTTAATCTCACATT

[0037] TTCATTCATCATTTTTTTCTAAACAACTGGCTTCGCTTGAATGCATAACTGGGGACCATGTGTTTGTTTTCTAG

[0038] TTTCTGGTGAATATAGACTCTCTTAGGTAGAAGGTTACAGTCCTCAATGATCCATTGTTGAGATTAGAGAGA

[0039] ATATAGCATCATAATCTGCTTAGTGCTTACATCTTATATTTTATTGTTTCACATCTTCTTTCCTTGCAGAGGTCA

[0040] GGTTGCCTGGGAAGCGCATTGGCTGTTATGAAGAAGTCTTCCAAATTTCTTCCAGTATGTGAATCTTATTAG

[0041] TTTATTGATGTGCTTGCTAGATTTTAAAGAAAGTAGCAATCTTCAATTTTATTTCTGAATCACTGCTATAAGTT

[0042] AGAAACTTGATAACTGGATTTGGGTTGAGAAAAAAGATCATTGCTCTAGGTTCATATACTTCTCCTTTTCATT

[0043] CTATGACCTGTTGCACACATACAGGTCATAGGCTGGTCAATGTGGTTCTCGGAGTATCTGTTTCTGGAAAGA

[0044] AATTGGGCAAAGGATGAAAGCACTCTAAAGGTATGGGTTATATTCTTCTTGTGCAGCTCATTTAGAATCTTC

[0045] ATTCCAGACCATGAGTTATATGTGTATTATCTAAATTTTACAGTCAGGTCTTCAACGCTTGAACGACTTCCC

[0046] TAGACCTTTCTGGTTAGCACTTTTTGTGGAGGGGGACTCGATTTACAGAGGCTAAACTTAAAGCAGCACAAG

[0047] AGTACGCAGCCTCCTCTGAGCTGCCTGTCCCTCGAAATGTGTTGATTCCTCGCACCAAAGTAAGTTGTACTA

[0048] TTTTTATTCTCACTGTGACCTTTGAAGAGCAGGATGACTACTATGAATCATCCAAATCTCAAAGCGTGGTCT

[0049] GGATATTTGTAGCCTTTATTCGTGGATCTATTTTATACTCTGCGCTTTCAACAGATGAACCTGGTGGTTGGTAT

[0050] TGACTTGGCTTTTATATTTATTGTCAGGGTTTTGTGTCAGCTGTTAGTAATATGCGTTCATTTGTCCCAGCCAT

[0051] TTATGATATGACCGTGGCTATTCCAAAAACATCTCCACCCCCAACGATGCTAAGACTATTCAAAGGACAACC

[0052] TTCTGTGGTAAGCATGTGAAACATATGAATAGGTCATCATCATTAAGCAACATATAGCAATTACAACTTGCAC

[0053] TCTTCTCACATTTCATAGTATTCACAGCACTATCCATTTTATTTTCACTGCAACCCTTATCTTGTGGAATGTTA

[0054] CCTTTGCTACTGTAATGTGTTAGAAATCATAGGGCTCATCGCATTTCAAAACTGTTTGTAACTCCCCCTGACC

[0055] ATTCCAACCCATTGATGGTGGTTTCAGGTGCATGTTCACATCAAGTGTCACTCGATGAAAGACTTACCTGAA

[0056] TCAGATGACGCAATTGCACAGTGGTGCAGAGATCAGTTTGTTGCTAAGGTAAAGATTATGGATATAGTGACA

[0057] AGATTCAACATAGAGAGAAGCTAAGTTAAAAGTCATATTGACTCACTCTCTATTCTCGGCTCTGTGGTACAG

[0058] GATGCACTATTAGACAAACACATAGCTGCAGACACTTTCCCTGGTCAGCAAGAACAGAACATTGGCCGTCC

[0059] CATAAAGTCTCTTGCAGTGAGTCTCTCAAAACACTCTCTCCGGTCCATCTATAATACTCAAAATCTCACAAG

[0060] TCCCTTCATCTTTTTATCCAGGTGGTTCTATCATGGTCATGTCTACTGATTCTCGGAGCAATGAAGTTCTTACA

[0061] CTGGTCAAACCTCTTTTCTTCATGGAAAGGCATTGCGTTTTCGGCGCTTGGTCTAGGAATCATCACTCTCTG

[0062] TATGCAGATCCTGATCCGCTCCTCTCAGTCTGAGCGTTCTACCCCAGCCAAAGTCGTTCCAGCCAAGCCAAAAGACAATCATAACGACTCAGGATCATCCTCCCAAACAGAAGTGGAGAAGCAGAAGTAA.

[0063] The mutated BnaA09g36950D has an A base inserted at 1355 bp, see Figure 1 Specific primers were designed for the insertion region of base A at the mutation site of the BnaA09g36950D gene, with a target fragment of 200 bp to 280 bp. The designed primer sequences are shown in the following table.

[0064] Table 1 Site-directed sequencing primer sequences

[0065]

[0066]

[0067] Step 2: DNA extraction. The fatty acid-altered single gene mutant rapeseed seeds and Zhongshuang 11 rapeseed seeds were germinated on a culture dish with filter paper until cotyledons grew. The cotyledons were frozen and ground with liquid nitrogen, and genomic DNA was extracted and placed in a -20°C refrigerator for later use.

[0068] Step 3: PCR amplification.

[0069] The PCR reaction system includes 1uL DNA template, 10.0ul 2× high-fidelity enzyme mix, 1ul each of 10uM primers (F / R), and ddH 2 0 to 20ul.

[0070] PCR reaction program: 95°C for 3 min; 95°C for 10 s, 55°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 5 min. Amplified products were detected on 1.0% agarose gel.

[0071] Step 4: First-generation sequencing of PCR products.

[0072] Results After sequence comparison, all three pairs of primers could accurately distinguish mutant rapeseed from conventional rapeseed, but the actual amplification product length of 2CR-3-F / R was less than 200 bp, which could not meet the requirements of second-generation sequencing. Therefore, two pairs of primers, 2CR-1-F / R and 2CR-2-F / R, were selected for the next step of primer screening.

[0073] Step 5: Verification of primer accuracy. Take 5 cotyledons of the mutant rapeseed, 95 of Zhongshuang No. 11, and code them as LA; take another 3 cotyledons of the mutant rapeseed, 97 of Zhongshuang No. 11, and code them as LB. After freezing and grinding with liquid nitrogen, extract genomic DNA, which needs to be treated with RNase.

[0074] Step 6: Perform PCR amplification according to step 3, using LA and LB as templates, and amplify with two pairs of primers 2CR-1-F / R and 2CR-2-F / R respectively. The amplified products are numbered LA-1, LA-2, LB-1, and LB-2, and recovered and purified after detection on 1.0% agarose gel.

[0075] Step 7: PCR product recovery sample test. The test results of PCR product recovery sample are shown in Table 2. Figure 2 The integrity of the four samples LA-1, LA-2, LB-1, and LB-2 was good, with a concentration of ≥30ng / ul and a total amount of ≥2ug, which met the requirements for library construction.

[0076] Table 2 PCR product recovery sample test results

[0077]

[0078] Step 8: Bioinformatics Analysis

[0079] The data from the machine is raw data, and quality control is performed on the raw data to determine whether the sequencing data is suitable for subsequent analysis. After quality control, clean data is obtained through filtering, and the clean data is aligned to the reference sequence, duplication reads are removed, and then SNP / indel is detected and filtered using GATK Haplotype Caller.

[0080] Table 3 Data production statistics

[0081]

[0082] Sample: sample name;

[0083] Reads: number of reads, paired reads were counted twice;

[0084] Bases: number of bases;

[0085] Length: average read length;

[0086] Q20: the ratio of bases with quality values ​​greater than 20;

[0087] Q30: the ratio of bases with quality values ​​greater than 30;

[0088] GC: GC content.

[0089] Use bwamem to align the clean data to the reference genome (the genome of Brassica napus L., double 11), and then use GATKMark Duplicates to filter duplication reads. The alignment and Mark Duplicates results are summarized in the following table:

[0090] Table 4 Genome alignment results

[0091]

[0092] Sample: sample name;

[0093] Total reads: number of reads;

[0094] Mappedreads: the number of reads in the alignment;

[0095] Duplicate reads: The number of duplicate reads. Duplicate reads are paired reads that are aligned to the same location in the genome. These reads are artificially introduced, such as fragment amplification caused by library construction and duplication of sequencer optical signals.

[0096] Map read: reads alignment rate;

[0097] Remove duplicate map rate: The alignment rate after removing duplicate reads.

[0098] Table 5 Statistics of sequencing depth and coverage results

[0099]

[0100] Sample: sample name;

[0101] Covrage: 1x coverage ratio;

[0102] Covrage5x: 5x coverage ratio;

[0103] Covrage10x: 10x coverage ratio;

[0104] Depth: average sequencing depth;

[0105] CovrageBase: Number of bases to cover 1x.

[0106] The detection results of mutation sites are shown in the following table. The mutation ratio of LA-1 is 5.15, the mutation ratio of LB-1 is 3.61, the mutation ratio of LA-2 is 7.21, and the mutation ratio of LB-2 is 4.55. The detection results of LA-1 and LB-1 are closer to the proportion of 5% and 3% of the single gene mutant LPAT18 of rapeseed fatty acid change in the sample. Therefore, the first pair of primers 2CR-1-F / R were selected as primers for detecting the mutation ratio of F1 offspring.

[0107] Table 6 Statistics of mutation frequency of mutation sites

[0108]

[0109] Example 2

[0110] Step 1: Planting of gene drift experimental materials. The materials used in the experiment include rapeseed fatty acid altered single gene mutant LPAT2 (if it is other mutants, this method can be used as long as the mutant sequence of the gene is known) and the recipient rapeseed Zhongshuang No. 11. Plant 5 meters × 5 meters of fatty acid altered single gene mutant rapeseed in the center, and plant 60 meters × 60 meters of recipient rapeseed around it ( Figure 3 ). According to the local general rapeseed planting standards, normal water and fertilizer management was carried out. The flowering period of the two rapeseed varieties was basically the same, and they were naturally pollinated under natural conditions.

[0111] Step 2: Sampling. During the rapeseed maturity period, 5 recipient rapeseed plants were randomly selected from eight different directions (east, south, west, north, northeast, southeast, northwest, southwest) and different distances (1 m, 3 m, 5 m, 10 m, 20 m, 30 m) from the recipient rapeseed to harvest seeds.

[0112] Step 3: Take 500-1000 seeds from different sites to germinate, mix the young rapeseed sprouts from each site, freeze and grind them with liquid nitrogen, and store them in a refrigerator at -20°C for later use. DNA extraction was performed according to the method in Example 1, and PCR amplification was performed using primers 2CR-1-F / R. The product was recovered and purified. The DNA sample test results were as follows: Figure 4 The qualified PCR amplification was subjected to the construction of the second generation sequencing library and bioinformatics analysis to obtain the detection results of the mutation site, that is, the drift frequency of the gene mutation rapeseed LPAT2 (because the F1 generation is all heterozygous, the drift frequency of rapeseed LPAT2 is twice the gene mutation ratio).

[0113] Table 7 Mutation frequency of mutation sites Drift frequency of rapeseed LPAT2

[0114]

[0115]

[0116] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for detecting rapeseed pollen mutations using sequencing technology, characterized in that: The method comprises the following steps: (1) Using the mutant rapeseed as the pollen donor, the mutant rapeseed was planted in the field with wild-type rapeseed planted around it to allow free pollination; (2) Wild-type rapeseed seeds were collected at different directions and distances during the rapeseed maturity period. The samples at each sampling point were germinated and mixed before DNA extraction; (3) Use site-specific sequencing primers of mutant rapeseed mutant genes to carry out site-specific sequencing; (4) Use analytical software to analyze the proportion of mutant genes and calculate the frequency of pollen drift.

2. The method according to claim 1, characterized in that The mutant rapeseed in step (1) is a mutant rapeseed with altered fatty acids.

3. The method according to claim 2, characterized in that The fatty acid-altered rapeseed mutant in step (1) is a rapeseed fatty acid-altered single gene mutant LPAT2.

4. The method according to claim 3, characterized in that The planting area of ​​the mutant rapeseed in step (1) is (4-6) meters × (4-6) meters.

5. The method according to claim 4, characterized in that In the step (1), the planting area of ​​wild-type rapeseed is (50-70) meters × (50-70) meters.

6. The method according to claim 5, characterized in that The sequence of the site-directed sequencing primer in step (3) is shown as SEQ ID NO.2-3.

7. The method according to any one of claims 1 to 6, characterized in that: The wild type rapeseed in step (1) is Zhongshuang No.

11.

8. Use of the method according to any one of claims 1 to 6 in detecting pollen drift frequency.

9. Use of the method according to claim 7 in detecting pollen drift frequency.

Images