Nano sensor for high-temporal-spatial-resolution imaging of brain adenosine and preparation method of nano sensor

Abstract

The preparation method comprises the following steps: firstly, preparing ytterbium and thulium doped sodium yttrium tetrafluoride nanoparticles, then preparing a PD probe, and incubating the ytterbium and thulium doped sodium yttrium tetrafluoride nanoparticles and the PD probe in a poly-L-lysine aqueous solution to form a light-operated unit; mixing DPPC, DPPE and CHOL, adding an aptamer buffer solution containing a ferrocene label, adding a buffer solution containing a light-operated unit, and incubating to obtain the nano sensor. According to the structure and principle design, accurate dynamic monitoring of adenosine is achieved under the condition that tissue is not damaged, and an effective tool is provided for research of depression and related inflammations.

Description

Technical Field

[0001] The present invention belongs to the field of biochemical detection technology, and particularly relates to a nanosensor for high-temporal-spatial resolution imaging of brain adenosine and a preparation method thereof. Background Art

[0002] In the pathological process of depression, adenosine, as a key neuromodulator, undergoes significant changes in its level. This change is closely related to the pro-inflammatory response in the brain. Adenosine triggers a chronic inflammatory response by activating specific receptors. This pro-inflammatory effect not only aggravates the symptoms of depression, but may also promote the development of complications such as cardiovascular disease and metabolic disorders. Therefore, monitoring adenosine levels and its dynamic changes are crucial for a deep understanding of the pathological mechanisms of depression and related inflammatory responses. Detection of adenosine is of great significance for the management of depression and its complications.

[0003] The existing methods for adenosine detection mainly include electrochemical sensor method, fluorescent probe method, chromatography-mass spectrometry, chemiluminescence method and Raman spectroscopy, which are briefly introduced below.

[0004] Electrochemical sensors detect the redox current of adenosine through electrodes, which is a relatively direct detection method. This method usually has high sensitivity and rapid response, and can be used to monitor instantaneous adenosine concentration. However, the spatial resolution of electrochemical sensors is limited by the size of the electrodes, making it difficult to achieve detailed imaging of the distribution of adenosine in the brain. In addition, the insertion of electrodes into tissues may cause local inflammation or damage, affecting the accuracy of experimental results. For long-term, dynamic monitoring, this type of method is relatively limited, especially in complex neural networks, where it is difficult to reflect changes in the microscopic distribution of adenosine.

[0005] The fluorescent probe method is a relatively new method for detecting adenosine. It generates fluorescent signals by binding to adenosine through specific molecular probes, and has the potential for spatiotemporal resolution imaging. However, the existing fluorescent probe technology still has many shortcomings in practical applications. First, most fluorescent probes lack sufficient spatiotemporal resolution and it is difficult to accurately capture the rapid dynamic changes of adenosine in living brain tissue. Secondly, the probe has low specificity and sensitivity and is easily interfered by other adenine nucleosides (such as ATP, AMP, etc.), resulting in high background noise and reducing the accuracy of the signal. In addition, many fluorescent probes have difficulty penetrating the blood-brain barrier, further limiting their application in brain adenosine detection. Therefore, existing fluorescent probes cannot fully meet the needs of high spatiotemporal resolution imaging of brain adenosine.

[0006] High performance liquid chromatography (HPLC) coupled with mass spectrometry is a standard method for quantitative detection of adenosine. By separating adenosine molecules and performing mass spectrometry analysis, this technology can provide highly accurate quantitative information with extremely high sensitivity and specificity. However, this method can usually only be used for the detection of in vitro samples and cannot achieve real-time imaging in vivo. In addition, the sample processing process is complicated, the equipment is expensive, and it takes a long time, which limits its application in high-throughput dynamic monitoring.

[0007] The chemiluminescence method is based on the light signal generated by adenosine under specific reaction conditions. This method usually has a high detection sensitivity, but its spatial control ability of the luminescence reaction is poor, making it difficult to achieve spatially resolved imaging. In addition, the chemiluminescence signal is easily affected by external environmental conditions (such as temperature, pH value, etc.), resulting in unstable results.

[0008] Raman spectroscopy can identify the structural features of molecules such as adenosine by detecting molecular vibration information. Although this method can be used to detect adenosine under certain conditions, its low sensitivity and complex equipment make it difficult to apply to in vivo imaging. The intensity of Raman signals is usually weak and requires a long acquisition time, which limits its application in dynamic monitoring. Summary of the invention

[0009] The purpose of the present invention is to solve the problem of insufficient spatiotemporal resolution of brain adenosine imaging in the prior art, and to provide a nanosensor for high spatiotemporal resolution imaging of brain adenosine and a preparation method thereof, in order to apply it to neurological diseases such as depression.

[0010] To this end, the present invention adopts such a technical solution: a method for preparing a nanosensor for high spatiotemporal resolution imaging of brain adenosine, comprising the following steps: 1) Preparation of ytterbium- and thulium-doped sodium yttrium tetrafluoride (NaYF4:Yb,Tm) nanoparticles: Y2O3, Yb2O3 and Tm2O3 were dissolved in hydrochloric acid to form a uniform rare earth chloride solution. After the water in the solution evaporates, solid rare earth chlorides YCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O are obtained; rare earth chlorides YCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O are added to the mixed solution of oleic acid (OA) and octadecene (ODE) and heated to 160 ℃ and kept at this temperature for 2 h; then the mixture is quickly cooled to 25 ℃, and a methanol solution of ammonium fluoride (NH4F) and sodium hydroxide (NaOH) is added, and the mixture is stirred at 50 ℃ for 30 min, and then placed under vacuum conditions, heated to 120 ℃ and kept for 30 min to remove oxygen and low-boiling point solvents in the reaction system; finally, the solution is heated to 300 ℃ and kept under nitrogen atmosphere for 90 min; after the reaction is completed, the system is cooled to 25 ℃, and the obtained nanoparticles are separated by centrifugation; 2) Preparation of PD probe: The Cy5-labeled adenosine aptamer sequence (Cy5-CAGTCACCTGGGGGAGTATTGCGGAGGAAGGT) and the PC-comp sequence labeled with both the PC group and BHQ2 (GCAATACTCCPCCCCAGGTGACTG-BHQ2) were dissolved in a buffer solution, wherein the buffer solution was 20 mM HEPES, containing 150 mM NaCl, 5 mM MgCl2, and pH 7.4, so that the DNA concentration was 10 μM; the two solutions were mixed in a 1:1 molar ratio, and the mixed solution was heated at 95 °C for 5 min, and then slowly cooled to 4 °C to prepare the PD probe, which was moved to a light-proof tube and stored away from light; 3) Preparation of light-controlled unit: The nanoparticles prepared in step 1) were mixed with 10 mg of poly-L-lysine in an aqueous solution, stirred at 25°C for 24 h, and the nanoparticles modified with poly-lysine were collected by centrifugation and washed with deionized water; then, the PD probe prepared in step 2) was incubated with the nanoparticles modified with poly-lysine in a buffer at a molar ratio of 35:1 for 2 hours to form a light-controlled unit; 4) Synthesis of nanosensor: First, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and cholesterol (CHOL) were dissolved in chloroform to prepare solutions with concentrations of 13.08 mM, 3.28 mM, and 10.90 mM, respectively, and mixed at a molar ratio of 48% DPPC, 12% DPPE, and 40% CHOL; the mixed solution was placed in a rotary evaporator at 45 °C and evaporated for 30 min to completely remove the organic solvent; then, a buffer containing a ferrocene-labeled aptamer (TCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGA-[Fe]) was added to the obtained liposomes; the mixture was incubated at 37 °C for 6 h, and then a buffer containing the light-controlled unit obtained in step 3) was added, gently stirred, and kept at 37 °C for 3 hours. h; the solution was then stirred and subjected to at least five rapid freezing and thawing cycles and incubated overnight at 37 °C; and finally, the nanosensor capable of imaging adenosine with high spatiotemporal resolution was extruded through a filter membrane.

[0011] Another technical solution of the present invention is a nanosensor for high spatiotemporal resolution imaging of brain adenosine prepared by the above method.

[0012] The basic concept is to use the vesicle composed of microglia-targeting aptamers and liposomes as the targeting unit, so that the sensor can penetrate the blood-brain barrier and accurately locate microglia in the brain to achieve spatial control of adenosine imaging; at the same time, by combining the photocleavable DNA sensing element with upconversion nanoparticles to form a light-controlled unit, time-controlled adenosine imaging can be achieved. Therefore, the nanosensor mainly consists of two parts: one is the targeting unit, which forms a vesicle (EV-Apt) by combining the aptamer specifically targeting microglia with the liposome membrane, in which the strong hydrophobicity of the ferrocene-labeled aptamer and the interaction between the liposome are used to stably modify it on the liposome membrane. This structure enables the sensor to penetrate the blood-brain barrier and accurately target microglia; the other part is the light-controlled unit, which is assembled by upconversion nanoparticles (UCNPs) and DNA sensing probes (PD) containing PC groups through electrostatic interactions. Specifically, first, polylysine (PLL) is coupled to UCNPs to make the surface of UCNPs positively charged, and then the negatively charged PD probe is modified on the surface of UCNPs by electrostatic binding to form a light-controlled unit loaded with UCNPs. The PD probe is composed of an adenosine aptamer hybridized with a complementary chain (PC-comp) containing a photocleavable (PC) group, ensuring that the probe is in a fluorescence quenching state before illumination, and the adenosine recognition ability of the aptamer is activated by PC-comp breakage after ultraviolet light irradiation. The sensor first enters the brain through the targeting unit and accurately locates microglia, and then activates the upconversion nanoparticles through near-infrared light irradiation, emitting ultraviolet light to turn on the imaging activity of the probe, thereby achieving high temporal and spatial resolution imaging of adenosine in the brain. This structure and principle design of the present invention enables accurate dynamic monitoring of adenosine without damaging tissues, providing an effective tool for the study of depression and related inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is a schematic diagram of the composition of the nanosensor of the present invention.

[0014] Figure 2 Schematic diagram of the synthesis steps of the nanosensor of the present invention.

[0015] Figure 3 TEM characterization and particle size statistics of upconversion nanoparticles.

[0016] Figure 4 It is the Zeta potential, particle size distribution and TEM characterization diagram of each unit in the present invention.

[0017] Figure 5 The selectivity of the nanosensor of the present invention to adenosine and its analogs is shown.

[0018] Figure 6The temporal control of adenosine detection by the nanosensor of the present invention is shown.

[0019] Figure 7 The response of the nanosensor of the present invention to the adenosine concentration gradient is shown.

[0020] Figure 8 The imaging of adenosine changes in cells by the nanosensor of the present invention is shown.

[0021] Fig. 9 The nanosensor of the present invention is shown to image adenosine in the brain of mice in different states. DETAILED DESCRIPTION Example 1

[0022] Preparation of ytterbium and thulium doped sodium yttrium tetrafluoride (NaYF4:Yb,Tm) upconversion nanoparticles: Appropriate amounts of Y2O3, Yb2O3 and Tm2O3 were weighed and added to a hydrochloric acid solution, heated slowly and stirred to ensure complete dissolution to form a uniform rare earth chloride solution. After the water in the solution evaporated, solid rare earth chlorides YCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O were obtained. Next, 0.795 mmol YCl3·6H2O, 0.200 mmol YbCl3·6H2O and 0.005 mmol TmCl3·6H2O were added to a mixed solution consisting of 3 mL oleic acid (OA) and 17 mL octadecene (ODE). Under nitrogen (N2) protection, the mixed solution was heated to 160 °C and maintained at this temperature for 2 h to ensure complete combination of rare earth chlorides with oleic acid. Then, the reaction system was quickly cooled to 25 °C, and 10 mL of methanol solution containing 0.0925 g of ammonium fluoride (NH4F) and 0.1 g of sodium hydroxide (NaOH) was added to the system. The mixture was stirred at 50 °C for 30 min, and then the system was placed under vacuum conditions, heated to 120 °C, and maintained for 30 min to remove oxygen and low-boiling point solvents in the reaction system. Finally, the solution was heated to 300 °C and maintained under a nitrogen atmosphere for 90 min. After the reaction was completed, the system was cooled to 25 °C, and the obtained nanoparticles were separated by centrifugation. In order to remove reaction by-products and excess reactants, the product was washed three times with a mixed solution of cyclohexane and ethanol in a ratio of 1:1, and finally pure NaYF4:Yb,Tm was obtained. TEM characterization and particle size statistics of the obtained upconversion nanoparticles are shown in Figure 3 . Example 2

[0023] Preparation of PD probe: The Cy5-labeled adenosine aptamer sequence (Cy5-CAGTCACCTGGGGGAGTATTGCGGAGGAAGGT) and the PC-comp sequence labeled with both PC group and BHQ2 (GCAATACTCCPCCCCAGGTGACTG-BHQ2) were dissolved in 304 μL and 469 μL of a buffer containing 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 150 mM NaCl, 5 mM MgCl2, pH 7.4, respectively, so that the final solubility of DNA was 10 μM. 304 μL of each was taken and mixed in a 1:1 molar ratio. The mixed solution was heated at 95 °C for 5 min and then slowly cooled to 4 °C. The prepared PD probe was moved to a light-proof tube and stored at 4 °C in the dark. Example 3

[0024] Preparation of light-controlled unit: Directly prepared NaYF4:Yb,Tm upconversion nanoparticles are often capped with oleic acid. The prepared materials were dispersed in an equal amount of 0.05 M hydrochloric acid, sonicated for 10 min, and then vigorously stirred overnight at 25 °C to remove the oleic acid on the surface. The upconversion nanoparticles with oleic acid removed were collected by centrifugation, washed three times with acidic ethanol (0.01 M HCl), and then rinsed three times with deionized water. Then, the upconversion nanoparticles with oleic acid removed (1 mL, 10 mg) were mixed with 10 mg of poly-L-lysine (hereinafter referred to as poly-lysine) in aqueous solution and stirred at 25 °C for 24 h. The upconversion nanoparticles modified with poly-lysine were collected by centrifugation and washed three times with deionized water to remove free poly-lysine. After that, the PD probe was incubated with the upconversion nanoparticles modified with poly-lysine in a buffer at a molar ratio of 35:1 for 2 hours to form a light-controlled unit. Finally, the light-controlled unit was washed three times with a buffer containing HEPES. Example 4

[0025] Synthesis of nanosensors: First, 28.8 mg of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 6.8 mg of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPE), and 12.65 mg of cholesterol (CHOL) were weighed and dissolved in 3 mL of chloroform to prepare solutions with concentrations of 13.08 mM, 3.28 mM, and 10.90 mM, respectively, and mixed at a molar ratio of 48% DPPC, 12% DPPE, and 40% CHOL (300 μL of each was placed in a round-bottom flask). The mixed solution was placed in a rotary evaporator at 45°C and evaporated for 30 min to completely remove the organic solvent. Subsequently, a buffer containing 3 nmol of ferrocene-labeled aptamer (TCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGA-[Fe]) was added to the resulting liposomes. The mixture was incubated at 37 °C for 6 h, then the buffer containing the light-controlled unit was added, gently stirred and kept at 37 °C for 3 h. Next, the solution was stirred and subjected to at least five rapid freezing and thawing cycles and incubated at 37 °C overnight. Finally, the nanosensor capable of imaging adenosine with high temporal and spatial resolution was extruded through the filter membrane using a Mini Extruder. The hydrodynamic particle size and Zeta potential of the sensor were measured by dynamic light scattering, and the morphology was analyzed by transmission electron microscopy.

[0026] Zeta potential, particle size distribution and TEM characterization of the above units are shown in Figure 4 . Example 5

[0027] The selectivity of the sensor for detecting adenosine in solution: In a 200 μL microcentrifuge tube, 50 μL of 100 μM adenosine (ADO), adenosine monophosphate (AMP), adenosine diphosphate (ADP) and adenosine triphosphate (ATP) solutions were added, and then 50 μL of adenosine sensor (final concentration was 500 nM) was added. The centrifuge tube was placed in a shaker and incubated at room temperature for 1 h. The fluorescence intensity of the solution was measured with a fluorimeter with an excitation wavelength of 640 nm to determine the responsiveness of the sensor to adenosine and adenosine analogs. The results are shown in Figure 5 . Example 6

[0028] Time controllability of the sensor for detecting adenosine in solution: In a 200 μL microcentrifuge tube, add 50 μL ADO and then 50 μL adenosine sensor (final concentration 500 nM). Irradiate the centrifuge tube with a 980 nm near-infrared laser for 20 min (1.2 W cm -2The centrifuge tube was placed on a shaker and incubated at room temperature for 1 h. The fluorescence intensity of the solution was measured using a fluorimeter with an excitation wavelength of 640 nm to determine the time controllability of the sensor for adenosine and adenosine detection. Figure 6 . Example 7

[0029] Linear response of the sensor: The sensor (50 μL) was added to a 96-well plate, and adenosine (final concentrations of 0, 200, 400, 600, 800, and 1000 μM) was added. The solution was irradiated with a 980 nm laser for 20 min (1.2 W cm -2 The 96-well plate was then placed in a microplate mixer and incubated at room temperature for 1 h. The fluorescence signal of the adenosine sensor was detected using the IVIS Spectrum live animal imaging system in fluorescence mode. The fluorescence intensity in the image was quantified using Lumina XR Living Image software. Fluorescence imaging parameters: Fluorescence mode: excitation 640 nm; emission: Cy5; exposure time: automatic; field of view: C. Results are shown in Figure 7 . Example 8

[0030] Nanosensor detects intracellular adenosine: To explore the response of the sensor to adenosine in cells, we first induced an increase in adenosine levels in microglial BV-2 cells by hypoxia and the adenosine deaminase inhibitor pentostatin. 5 Cells were seeded at a density of 100 cells / well in a laser confocal culture dish and cultured in a 37 °C incubator for 24 h. Afterwards, cells were cultured in serum-free medium for 4 h under hypoxic (1% O2) and normoxic (21% O2) conditions. For pentostatin treatment, cells were cultured in serum-free medium containing 5 µM pentostatin for 4 h. After the old medium was removed, it was replaced with serum-free medium containing the nanosensor (500 nM), and the cells were irradiated with a 980 nm laser for 20 min (1.2 W cm -2 After 1 min of irradiation and 5 min of rest, the cells were incubated at 37 °C in the dark for 1 hour. After the incubation, 100 μL of 500 nM sensor solution was added and the cells were irradiated with 980 nm laser for 20 min (1.2 W cm -2 The cells were then incubated at 37 °C in the dark for 1 hour. After incubation, the cells were washed three times with DPBS to remove the residual sensor solution, and then 1 mL of DPBS was added to the laser confocal dish and imaged using a laser confocal microscope. Figure 8 . Example 9

[0031] Detection of adenosine in the mouse brain: C57BL / 6J mice were randomly divided into three groups: control group, depression model group, and depression model plus fluoxetine treatment group. The depression model was induced by chronic unpredictable stress. Mice in the fluoxetine treatment group were intraperitoneally injected with fluoxetine (10 mg / kg / day, dissolved in 0.9% saline) every day for 14 consecutive days. After the depression model was established, adenosine sensors (50 μL, 500 nM) were injected through the tail vein. After injection, the mouse brain was irradiated with a 980 nm near-infrared laser (1.2 W / cm², irradiation for 1.5 min, stop for 5 min, cycle irradiation, total duration 20 min). Adenosine levels were monitored by the IVIS Lumina XR imaging system, and the imaging parameters were excitation wavelength 640 nm, emission wavelength Cy5, exposure time automatic, and field of view set to C. The fluorescence intensity was quantitatively analyzed using Lumina XR Living Image software to evaluate the ability of adenosine sensors to detect adenosine in the brains of normal, depression model, and fluoxetine-treated mice. Results are shown in Fig. 9 .

Claims

1. A method for preparing a nanosensor for high spatiotemporal resolution imaging of brain adenosine, comprising the following steps: 1) Preparation of ytterbium- and thulium-doped sodium yttrium tetrafluoride, NaYF4:Yb,Tm nanoparticles: Y2O3, Yb2O3 and Tm2O3 were dissolved in hydrochloric acid to form a uniform rare earth chloride solution. After the water in the solution evaporates, solid rare earth chlorides YCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O are obtained; rare earth chlorides YCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O are added to the mixed solution of oleic acid OA and octadecene ODE and heated to 160 ℃ and maintained at this temperature for 2 h; then it is quickly cooled to 25 ℃, and methanol solutions of ammonium fluoride NH4F and sodium hydroxide NaOH are added, the mixture is stirred at 50 ℃ for 30 min, and then placed under vacuum conditions, heated to 120 ℃, and maintained for 30 min to remove oxygen and low-boiling point solvents in the reaction system; finally, the solution is heated to 300 ℃ and maintained under a nitrogen atmosphere for 90 min; after the reaction is completed, the system is cooled to 25 ℃, and the obtained nanoparticles are separated by centrifugation; 2) Preparation of PD probe: Cy5-labeled adenosine aptamer sequence Cy5-CAGTCACCTGGGGGAGTATTGCGGAGGAAGGT and PC-comp sequence GCAATACTCCPCCCCAGGTGACTG-BHQ2 labeled with PC group and BHQ2 were dissolved in a buffer solution, wherein the buffer solution was 20 mM HEPES, containing 150 mM NaCl, 5 mM MgCl2, pH 7.4, so that the concentration of DNA was 10 μM; the two solutions were mixed in a 1:1 molar ratio, the mixed solution was heated at 95 °C for 5 min, and then slowly cooled to 4 °C to prepare the PD probe, which was moved to a light-proof tube and stored away from light; 3) Preparation of light-controlled unit: The nanoparticles prepared in step 1) were mixed with 10 mg of poly-L-lysine in an aqueous solution, stirred at 25°C for 24 h, and the nanoparticles modified with poly-lysine were collected by centrifugation and washed with deionized water; then, the PD probe prepared in step 2) was incubated with the nanoparticles modified with poly-lysine in a buffer at a molar ratio of 35:1 for 2 hours to form a light-controlled unit; 4) Synthesis of nanosensor: First, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine DPPC, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine DPPC, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanol DPPE, and cholesterol CHOL were dissolved in chloroform to prepare solutions with concentrations of 13.08 mM, 3.28 mM, and 10.90 mM, respectively, and mixed at a molar ratio of 48% DPPC, 12% DPPE, and 40% CHOL; the mixed solution was placed in a rotary evaporator at 45 °C and evaporated for 30 min to completely remove the organic solvent; then, a buffer containing the ferrocene-labeled aptamer TCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGA-[Fe] was added to the obtained liposomes; the mixture was incubated at 37 °C for 6 h, and then the buffer containing the light-controlled unit obtained in step 3) was added, gently stirred and kept at 37 °C for 3 hours. h; the solution was then stirred and subjected to at least five rapid freezing and thawing cycles and incubated at 37 °C overnight; finally, nanosensors of uniform size were obtained by extrusion through a filter membrane.

2. A nanosensor for high spatiotemporal resolution imaging of brain adenosine prepared by the preparation method according to claim 1.

Images