PCR (Polymerase Chain Reaction) kit for detecting whether soybean seed coats are black or not and application of PCR kit

Abstract

The invention discloses a PCR kit for detecting whether soybean seed coats are black or not and application of the PCR kit, and belongs to the technical field of molecular marker technology development and application. According to the invention, the SNAP molecular marker is independently developed by using the genome data of the Jingnong6 and the re-sequencing data of 322 parts of red bean materials for the first time, whether the seed coat of the red bean is black or not can be detected only by using two pairs of primers, the invention also provides a PCR kit and a detection method for detecting whether the seed coat of the red bean is black or not, and the kit has the advantages of high sensitivity, high sensitivity, high sensitivity and the like. The method has the advantages of simplicity in operation, economy, rapidness, simplicity in operation and the like, and can be used for molecular marker-assisted breeding of soybean seed coat colors and molecular marker analysis and detection so as to accurately identify whether soybean seed coats are black or not, and seed coat color materials meeting breeding targets can be rapidly selected, so that the breeding efficiency is improved, and the breeding progress is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker technology development and application, and particularly relates to a PCR kit for detecting whether adzuki bean seed coat is black and an application thereof. Background Art

[0002] Adzuki bean (Vigna angularis) is an important leguminous crop. It was domesticated in China about 12,000 years ago and is widely cultivated in more than 30 countries, mainly in China, Japan and Korea. Adzuki bean is used as a traditional Chinese medicinal plant and health food. Seed coat color is an important domestication trait, commercial quality trait and nutritional quality trait. The difference in flavonoid compound composition is the change in adzuki bean seed coat color, which gives adzuki beans different colors. Flavonoid metabolites have extremely strong nutritional and medicinal value, and their antioxidant and antimutagenic activities are closely related to human health.

[0003] Adzuki beans are also called red beans because the seed coats of most local varieties and improved varieties are red, while the seed coats of almost all wild adzuki beans (Vigna angularis var. Nipponensis) are gray with black spots. Different local varieties of adzuki beans have a wide variety of seed coat colors, such as red, black, white, orange, light brown, gray with black spots, red with black spots, green, etc.

[0004] The seed coat of adzuki bean is developed from the integuments, and its genotype is the same as that of the plant. In the traditional adzuki bean variety selection process, the identification of the seed coat color must be done after the adzuki beans are fully mature, using naked eye observation and a colorimeter. Compared with other important traits that can be identified in the field, such as plant height, ground diameter, effective branch start node, and number of main stem branches, it has a serious lag, which greatly delays the efficiency of adzuki bean breeding.

[0005] Molecular markers are genetic markers based on nucleic acid polymorphism. They are not affected by tissue type, development period, environmental conditions, etc., and have the advantages of extremely large number and high polymorphism, making them ideal genetic markers. Molecular markers have been widely used in germplasm resource research, hybrid identification, genetic map construction, target gene positioning, genetic diversity, kinship research, and marker-assisted selection breeding. Among them, single nucleotide polymorphism markers (SNPs) are single base conversions and transversions uniformly distributed in the genome obtained based on high-throughput sequencing technology; they have the advantages of high polymorphism, good stability, multiple alleles, co-dominance, abundant number, good genome coverage, and simple operation. They have been widely used in research work such as kinship identification, genetic diversity analysis, and variety breeding of plants such as Chinese soybeans (Glycine max), kidney beans (Prunus persica), chickpeas (Cicer arietinum), and mung beans (Vigna radiata). SNAP (Single-nucleotide amplified polymorphisms) molecular markers are a means of converting SNPs into molecular markers that can be identified by PCR. Summary of the invention

[0006] In view of the problem that there is no rapid detection system based on PCR technology for the color of adzuki bean seed coat in the current prior art, the purpose of the present invention is to provide a PCR kit for detecting whether the adzuki bean seed coat is black and its application. The present invention independently develops SNAP molecular markers using the genome data of the adzuki bean variety Jingnong 6 and the resequencing data of 322 adzuki bean materials. Only two pairs of primers are used to detect whether the adzuki bean seed coat is black, providing an important basis for adzuki bean seed coat color detection and molecular marker-assisted breeding.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a SNAP detection primer for determining whether the seed coat of adzuki bean is black, comprising three SNAP molecular marker primers, wherein the SNAP molecular marker primers are as follows:

[0009] C3-1375579FA(SDC1-FA): TGCCACACGTGTACTCAATGTTG;

[0010] C3-1375579FB (SDC1-FB): TGCCACACGTGTACTCAATGTTC;

[0011] C3-1375579R(SDC1-R):AGCACTAGCAGCTAGACTCAGTTCTCTT.

[0012] In a second aspect, the present invention provides a PCR kit for detecting whether the adzuki bean seed coat is black, wherein the PCR kit comprises the above-mentioned SNAP detection primers for detecting whether the adzuki bean seed coat is black.

[0013] Based on the above technical solution, further, the PCR kit also includes Taq DNA polymerase, dNTPs, MgCl2, reaction buffer, PCR reaction enhancer and optimizer, stabilizer, and deionized water.

[0014] In a third aspect, the present invention provides a method for detecting whether the seed coat of adzuki beans is black, comprising the following steps:

[0015] (1) Extracting genomic DNA of the tested adzuki bean materials;

[0016] (2) using the above-mentioned SNAP detection primer pair to perform PCR amplification on the genomic DNA obtained in step (1);

[0017] (3) detecting the PCR amplification product obtained in step (2) using agarose gel electrophoresis;

[0018] (4) If the amplification product of the primer pair C3-1375579FA (SDC1-FA) and C3-1375579R (SDC1-R) has a band at the 184 bp position, and the amplification product of the primer pair C3-1375579FB (SDC1-FB) and C3-1375579R (SDC1-R) has no band at the 184 bp position, then the seed coat of the test adzuki bean material is black; if the amplification product of the primer pair C3-1375579FA (SDC1-FA) and C3-1375579R (SDC1-R) has no band at the 184 bp position, and the amplification product of the primer pair C3-1375579FB (SDC1-FB) and C3-1375579R (SDC1-R) has a band at the 184 bp position, then the seed coat of the test adzuki bean material is non-black.

[0019] Based on the above technical scheme, further, the varieties of adzuki bean materials described in step (1) include CWA108-1, AG118, Jingnonghei 29, Jingnong 2, Jingnong 5, Jingnong 6, Jingnong 8, Jingnong 22, Jingnong 23, Hebei 801, GM633, AG109, CWA154, CWA174, AG163, BD002, CCA066, GM290, CCA001 and AG49.

[0020] Based on the above technical solution, further, the reaction system of PCR amplification described in step (2) is 10 μL, including 0.4 μL of forward primer and reverse primer, 5 μL of 2×Flash PCR MasterMix (Kangwei Century Biotechnology Co., Ltd.), 50-200 ng of template, and the balance is deionized water.

[0021] Based on the above technical solution, further, the concentration of the forward primer and the reverse primer is 5-20 μmol / L.

[0022] Based on the above technical solution, further, the procedure of PCR amplification described in step (2) is: pre-denaturation at 94-96°C for 4-6 min; denaturation at 94-96°C for 20-40 s, annealing at 52-56°C for 20-40 s, extension at 71-73°C for 20-40 s, 30-40 cycles, extension at 71-73°C for 9-11 min, and cooling to 1-4°C.

[0023] Based on the above technical solution, further, the concentration of the agarose gel in step (3) is 0.5-2%.

[0024] In a fourth aspect, the present invention provides any one of the following uses of the SNAP detection primers and PCR kit for determining whether the adzuki bean seed coat is black:

[0025] ① Application in detecting whether the seed coat of adzuki beans is black;

[0026] ②Application in molecular marker-assisted breeding of adzuki beans.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] Seed coat color is an important commercial quality trait of adzuki beans. However, in the breeding process, it can often only be identified after harvest. The efficiency of phenotypic identification is much lower than that of other plant traits, and there is no rapid and efficient detection method. The present invention independently develops SNAP molecular marker primers related to adzuki bean seed coat color from the genome data of the adzuki bean variety Jingnong 6 and the resequencing data of 322 adzuki bean materials. Only two pairs of primers are used to detect whether the adzuki bean seed coat is black. Whether the seed coat of 24 common adzuki bean varieties is black is identified, and the detection results are exactly the same as the adzuki bean seed coat color. The present invention has the advantages of high sensitivity, economy, speed, and simple operation. It can be used for molecular marker-assisted breeding of adzuki bean seed coat color, and molecular marker analysis and detection can be performed to accurately identify whether the adzuki bean seed coat is black. The seed coat color material that meets the breeding goal can be quickly selected to improve the breeding efficiency and accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The electrophoresis results of the PCR amplification products of primer pair C3-1375579FA and C3-1375579R in all 20 adzuki bean materials, where M is DL2000 DNALadder (TIANGEN, Beijing), and the lengths of the standard DNA bands from top to bottom are 2000, 1000, 750, 500, 250 and 100 bp, respectively, with a concentration of 50 ng·μL -1 , samples 1 to 20 are shown in Table 1.

[0030] Figure 2 The electrophoresis results of PCR amplification products of C3-1375579FB and C3-1375579R in all 20 adzuki bean materials, where M is DL2000 DNA Ladder (TIANGEN, Beijing), and the lengths of standard DNA bands from top to bottom are 2000, 1000, 750, 500, 250 and 100 bp, respectively, with a concentration of 50 ng·μL -1 , samples 1 to 20 are shown in Table 1. DETAILED DESCRIPTION

[0031] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0032] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained through commercial channels.

[0033] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only. Experimental methods not specifically noted may be performed in accordance with conventional methods or in accordance with the instructions of the manufacturer of the product used. The materials, reagents, etc. used in the following examples, unless otherwise specified, may be obtained through commercial channels. SNAP-labeled primers were commissioned to be synthesized by Shanghai Biotech.

[0034] Example 1 Establishment of SNAP molecular marker system for identification of black seed coat color of adzuki beans

[0035] Based on the genome data of adzuki bean variety Jingnong 6 and the resequencing data of 322 adzuki bean materials, three SNAP primers were designed (see Table 2). DNA of 20 common adzuki bean varieties (Table 1) were extracted. These three primers were used to perform PCR amplification and agarose gel electrophoresis on the 20 varieties, and parameters such as annealing temperature and number of cycles were adjusted to determine the optimal PCR conditions for distinguishing whether the adzuki bean seed coat is black or not.

[0036] Table 1 Information on 20 adzuki bean varieties

[0037]

[0038] Table 2 Information of designed adzuki bean SNAP marker primers

[0039]

[0040] The specific process is as follows:

[0041] 1. Rapid DNA extraction

[0042] The genomic DNA of 20 tested adzuki bean materials was extracted by CTAB method, and the DNA concentration and whether there was RNA contamination, protein or phenol contamination (OD of pure sample DNA) were detected by agarose gel electrophoresis and NanoDrop. 260 / OD 280 The ratio should be between 1.7-1.9) and diluted to 50ng·μL -1 , and stored in a -20℃ refrigerator for later use.

[0043] 2. Confirmation of PCR conditions

[0044] By analyzing the electrophoresis results of the amplified products of the primers, the optimal PCR conditions required for the primers in Example 1 (Table 2) were determined.

[0045] 3. PCR amplification

[0046] The PCR reaction system was 10 μL, including 0.4 μL of each forward and reverse primer (10 μmol / L), 2× Flash PCR Master Mix (Kangwei Century Biotechnology Co., Ltd.), 100 ng of template, and the balance was made up with deionized water; the amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 30 s, 33 cycles, extension at 72°C for 10 min, and cooling to 4°C.

[0047] 4. Amplification product detection

[0048] The PCR amplification products were detected by 1% agarose gel electrophoresis at 120V for 30min and observed in a UV gel imaging system.

[0049] Example 2 Identification of the adzuki bean SNAP molecular marker system

[0050] Using the SNAP molecular marker system for identifying the black seed coat color of adzuki bean established in Example 1, DNA of 20 adzuki bean materials for testing was extracted, PCR amplified and detected by agarose gel electrophoresis, and the electrophoresis results were analyzed and compared. Among the 3 adzuki bean materials with black seed coat color for testing: SDC1-B primer amplified a band at the 184 bp position, while SDC1-R primer had no band; among the 17 adzuki bean materials with non-black seed coat color for testing, SDC1-B primer amplified no band at the 184 bp position, while SDC1-R primer amplified a band (Table 3, Figure 1 , Figure 2 ).

[0051] Table 3 Information on 20 adzuki bean varieties

[0052]

[0053]

[0054] Example 3 Application of the adzuki bean SNAP molecular marker system

[0055] In the detection of other adzuki bean materials with unknown seed coat colors, the method in Example 1 is used to extract the genomic DNA of the adzuki bean material to be tested, and PCR amplification is performed to obtain the amplification status of the corresponding sites. If the test result is completely consistent with the amplification result of the above-mentioned black seed coat color adzuki bean material, the adzuki bean to be tested is black seed coat color; if the test result is completely consistent with the amplification result of the above-mentioned non-black seed coat color adzuki bean material, the adzuki bean to be tested is non-black seed coat color.

[0056] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A SNAP detection primer for determining whether the seed coat of adzuki bean is black, characterized in that: It includes three SNAP molecular marker primers, and the SNAP molecular marker primers are as follows: C3-1375579FA: TGCCACACGTGTACTCAATGTTG; C3-1375579FB: TGCCACACGTGTACTCAATGTTC; C3-1375579R:AGCACTAGCAGCTAGACTCAGTTCTCTT.

2. A PCR kit for detecting whether the seed coat of adzuki bean is black, characterized in that: The PCR kit comprises the SNAP detection primer for detecting whether the adzuki bean seed coat is black as described in claim 1.

3. The PCR kit according to claim 2, characterized in that The PCR kit also includes Taq DNA polymerase, dNTPs, MgCl2, reaction buffer, PCR reaction enhancer and optimizer, stabilizer and deionized water.

4. A method for detecting whether the seed coat of adzuki beans is black, characterized in that: The following steps are involved: (1) Extracting genomic DNA of the tested adzuki bean materials; (2) performing PCR amplification on the genomic DNA obtained in step (1) using the SNAP detection primer pair described in claim 1; (3) detecting the PCR amplification product obtained in step (2) using agarose gel electrophoresis; (4) If the amplification product of the primer pair C3-1375579FA and C3-1375579R has a band at the 184 bp position, and the amplification product of the primer pair C3-1375579FB and C3-1375579R has no band at the 184 bp position, then the seed coat of the test adzuki bean material is black; if the amplification product of the primer pair C3-1375579FA and C3-1375579R has no band at the 184 bp position, and the amplification product of the primer pair C3-1375579FB and C3-1375579R has a band at the 184 bp position, then the seed coat of the test adzuki bean material is non-black.

5. The method according to claim 4, characterized in that The varieties of adzuki bean materials tested in step (1) include CWA108-1, AG118, Jingnonghei 29, Jingnong 2, Jingnong 5, Jingnong 6, Jingnong 8, Jingnong 22, Jingnong 23, Hebei 801, GM633, AG109, CWA154, CWA174, AG163, BD002, CCA066, GM290, CCA001 and AG49.

6. The method according to claim 4, characterized in that The reaction system for PCR amplification described in step (2) is 10 μL, including 0.4 μL of forward primer and reverse primer, 5 μL of 2×Flash PCR MasterMix, 50-200 ng of template, and the balance is deionized water.

7. The method according to claim 6, characterized in that The concentration of the forward primer and reverse primer is 5-20 μmol / L.

8. The method according to claim 4, characterized in that The PCR amplification procedure described in step (2) is: pre-denaturation at 94-96°C for 4-6 min; denaturation at 94-96°C for 20-40 s, annealing at 52-56°C for 20-40 s, extension at 71-73°C for 20-40 s, 30-40 cycles, extension at 71-73°C for 9-11 min, and cooling to 1-4°C.

9. The method according to claim 4, characterized in that The concentration of the agarose gel in step (3) is 0.5-2%.

10. Use of any one of the following ①-② of the SNAP detection primer for determining whether the adzuki bean seed coat is black according to claim 1 and the PCR kit according to claim 2 or 3: ① Application in detecting whether the seed coat of adzuki beans is black; ②Application in molecular marker-assisted breeding of adzuki beans.

Images