Rape flowering time negative regulation transcription factor BnMYB615 and application thereof

Abstract

The invention belongs to the technical field of plant molecular biology, and particularly relates to an oilseed rape flowering negative regulation transcription factor BnMYB615, a cloning method, a BnMYB615 gene overexpression vector, a BnMYB615 gene knockout vector, a host cell, a flowering phase delay transgenic plant and application of a flowering phase advance gene editing plant. A nucleotide sequence of the rape transcription factor BnMYB615 is shown as SEQ ID NO.1, an amino acid sequence of the rape transcription factor BnMYB615 is shown as SEQ ID NO.2, an overexpression vector sequence of the rape transcription factor BnMYB615 is shown as SEQ ID NO.3, and a gene knockout vector sequence of the rape transcription factor BnMYB615 is shown as SEQ ID NO.4. The overexpressed BnMYB615 can obviously delay the flowering time of plants, and can prolong the growth season and the photosynthetic time of the plants and obtain higher yield when being applied to crops taking nutritive organs as harvest objects; after the BnMYB615 gene is knocked out, the flowering time of the plant is advanced, and when the BnMYB615 gene is applied to crops taking seeds or fruits as harvest objects, the growth period of the crops can be shortened, the multiple cropping index can be improved, meanwhile, the influence of adverse climate can be avoided, and the product quality can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology and specifically relates to a rapeseed transcription factor BnMYB615 and its application in regulating flowering time of plants. Background Art

[0002] Rapeseed is an important oil crop in my country. Rapeseed oil accounts for 50% of domestic edible vegetable oil and is an important source of oil for residents' daily life. my country is one of the three major rapeseed producing areas in the world. According to data released by the National Bureau of Statistics, China's rapeseed production in 2020 was 14.02 million tons, accounting for about 19% of the global total production. my country is also a major consumer of rapeseed. Domestic rapeseed production can no longer meet consumer demand, and a large gap can only be filled by imports from abroad.

[0003] In the Yangtze River Basin, southern Shaanxi, southern Henan, and southern Anhui, rice-oil rotation is an important agricultural farming method. In the actual production process, rapeseed stubble will directly affect the sowing or transplanting of the next crop. At present, due to factors such as climate characteristics, planting benefits, and variety iteration, there are problems such as inappropriate connection between rapeseed stubble and rice planting in my country's winter rapeseed planting areas, resulting in a large amount of cultivated land being abandoned in winter. Cultivating early-maturing rapeseed varieties with early flowering and early maturity can provide sufficient space and time for seedling raising and transplanting of subsequent crops in areas with two crops a year, and provide a good solution to the conflict between double-season rice and winter rapeseed in areas with three crops a year, which is of great significance to agricultural production in rice-oil rotation areas.

[0004] The regulation of flowering time in plants is regulated by a complex genetic network, including the photoperiod pathway, vernalization pathway, gibberellin pathway, autonomous flowering pathway and age pathway. For crops that are harvested for seeds or fruits, early flowering can shorten their growth period, allowing the crops to complete a round of production in a shorter period of time and increase the multiple cropping index. In addition, some crops can avoid the impact of adverse climate after shortening their growth period. For example, early maturity of winter rapeseed can avoid rainy weather and improve product quality. For crops that are harvested for nutritional organs, such as alfalfa and spinach, delaying flowering can extend their growing season and photosynthesis time, thereby obtaining higher yields.

[0005] MYB family transcription factors are an important class of genes in plants with a large number of members and complex and diverse functions. In terms of flowering regulation, MYB family transcription factors can affect the flowering process by regulating other flowering-related genes. In the photoperiod pathway, MYB transcription factors can sense the length of day and night and transmit changes in light signals to downstream flowering regulation-related genes. In the vernalization pathway, low temperature treatment can enable MYB transcription factors to work synergistically with other vernalization-related genes to release the plant's flowering inhibition state, laying the foundation for subsequent flowering induction at suitable temperatures.

[0006] Genetic engineering is an important means of regulating the flowering time and maturity of crops. Gene editing is a molecular technology that causes specific changes in the genome by deleting, inserting or replacing a certain fragment or specific base of the genome. At present, gene editing technology represented by CRISPR-Cas9 has made great progress. The gene editing technology used in the present invention refers to the article "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants" published by Academician Liu Yaoguang's team in the journal Molecular Plant in 2015. Summary of the invention

[0007] One of the purposes of the present invention is to provide a plant flowering period negative regulatory transcription factor gene BnMYB615 , characterized by overexpression BnMYB615 It can delay the flowering time of plants and knock out BnMYB615 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0008] The second object of the present invention is to provide a clone BnMYB615 The gene method is characterized in that the cDNA of Brassica napus is used as a template and PCR amplification is performed according to amplification primers BnMYB615-F and BnMYB615-R.

[0009] The nucleotide sequence of BnMYB615-F is shown in SEQ ID NO. 3, which is 5'-TGGAGAGGACACGCTCGAATGGATACAAATACATCCGG-3'.

[0010] The nucleotide sequence of BnMYB615-R is shown in SEQ ID NO. 4, which is 5'-TCAGATCTACCATCTCGATGTTGAAGCTTCTCCTTCCA-3'.

[0011] The third object of the present invention is to provide a method containing the above-mentioned flowering period negative regulatory transcription factor gene BnMYB615 The overexpression vector pEarleyGate103-BnMYB615-mGFP, the nucleotide sequence of the overexpression vector is shown in SEQ ID NO.5.

[0012] The fourth object of the present invention is to provide a vector preservation host bacteria containing the overexpression vector pEarleyGate103-BnMYB615-mGFP, and the host strain used is Escherichia coli DH5α.

[0013] The fifth object of the present invention is to provide a host bacteria for plant infection containing the overexpression vector pEarleyGate103-BnMYB615-mGFP, wherein the host strain used is Agrobacterium GV3101.

[0014] The sixth object of the present invention is to provide a method for targeting rapeseed BnMYB615 The invention relates to a gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615 which can produce gene-edited mutant offspring by targeting three sites on a gene, and is characterized in that the nucleotide sequence of the overexpression vector is shown in SEQ ID NO.6; the gene knockout vector has three expression cassettes; the promoter of the first expression cassette is Atu3b, the promoter of the second expression cassette is Atu6-29, and the promoter of the third expression cassette is Atu3b; the nucleotide sequence of the sgRNA of the first expression cassette is shown in SEQ ID NO.7, which is 5'-CGTATACTATTACAAAGCAG-3', the nucleotide sequence of the sgRNA of the second expression cassette is shown in SEQ ID NO.8, which is 5'-ATAGGTTTCTTGAAGCCTTG-3', and the nucleotide sequence of the sgRNA of the third expression cassette is shown in SEQ ID NO.9, which is 5'-TCTTGAGAGACCATACCTGG-3'.

[0015] The seventh object of the present invention is to provide a vector-preserving host bacteria containing the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615, and the host strain used is Escherichia coli DH5α.

[0016] The eighth object of the present invention is to provide a host bacteria for plant infection containing the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615, wherein the host strain used is Agrobacterium GV3101.

[0017] The ninth object of the present invention is to provide a method for overexpressing a negative regulation transcription factor gene of flowering period. BnMYB615 , used to delay the flowering time of plants.

[0018] The tenth object of the present invention is to provide a method for knocking out the negative regulation transcription factor gene of flowering period. BnMYB615 , which is used to advance the flowering time of Brassica napus.

[0019] Compared with the prior art, the transcription factor provided by the present invention BnMYB615 , overexpression and gene knockout vectors, host bacteria and applications can achieve the following beneficial effects:

[0020] Rapeseed transcription factor BnMYB615 It has a negative regulatory effect on flowering. In crops whose vegetative organs are harvested, it can be overexpressed BnMYB615 , delaying flowering time and extending growth time, thereby obtaining higher yields; in crops harvested for seeds or fruits, BnMYB615 Gene knockout can make crops bloom earlier, shorten the growth period, adjust the crop rotation, and increase the multiple cropping index, thereby achieving higher economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a map of the constructed overexpression vector pEarleyGate103-BnMYB615-mGFP.

[0022] Figure 2 The overexpression gene was obtained by infecting wild materials of Columbia-type Arabidopsis thaliana with host bacteria GV3101 carrying the overexpression vector pEarleyGate103-BnMYB615-mGFP. BnMYB615 Arabidopsis thaliana strains, WT is the wild type material, BnMYB615 -OE1, BnMYB615 -OE3 and BnMYB615 -OE4 are three transgenic lines.

[0023] Figure 3 The rosette leaves of different materials are counted during flowering. WT is the wild type material. BnMYB615 -OE1, BnMYB615 -OE3 and BnMYB615 -OE4 are three transgenic lines. Compared with the wild type, the flowering time of the three overexpression lines was significantly delayed, and "**" indicates that the difference reached an extremely significant level.

[0024] Figure 4 This is the map of the constructed gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615.

[0025] Figure 5 The gene mutation strain was obtained by using the host bacteria GV3101 with the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615 to infect the wild material westar of Brassica napus. WT is the wild-type material westar. bnmyb615- 39 , bnmyb615-50 There are two mutant strains.

[0026] Figure 6The flowering time statistics of different materials of Brassica napus. WT is the wild type material westar. bnmyb615-39 , bnmyb615-50 Compared with the wild type, the two gene knockout lines have an earlier flowering time. bnmyb615-39 The strains reached a significant level of difference, and "*" indicates that the difference reached a significant level. DETAILED DESCRIPTION

[0027] In order to better demonstrate the content and implementation details of the present invention, the present invention is further described below in conjunction with specific examples and drawings. In the following examples, the experimental material used for total RNA extraction was Brassica napus ZS11, BnMYB615 The Arabidopsis wild-type (WT) material used for gene overexpression was the col-0 ecotype, the receptor material used for BnMYB615 gene knockout was Brassica napus westar, the overexpression plasmid vector backbone used was pEarly-Gate103, and the gene knockout plasmid vector backbone used was pYLCRISPR-Cas9P35s-H. The above plant materials and plasmid vector backbones can be obtained through commercial channels or shared by non-profit organizations, agricultural science academies, and related research groups of colleges and universities.

[0028] Example 1 Negative regulatory transcription factors for flowering time in Brassica napus BnMYB615 Cloning of sequences.

[0029] The total RNA of Brassica napus was extracted using the plant total RNA rapid extraction kit (RNAprep Pure Plant Kit, Purui Biotechnology Co., Ltd.). The specific method is as follows:

[0030] Take 0.5 g of rapeseed seedling leaves and place them in a mortar precooled at -40℃, add liquid nitrogen and grind until crushed, take 0.1 g of the ground sample and transfer it to an RNase-free centrifuge tube, add 1 ml of lysis solution RL, turn it upside down and mix it for 20 s, and incubate it at 25℃ for 5 min to fully lyse it; add 200 μl of chloroform, cover the tube tightly and shake it vigorously for 15 s, and incubate it at 25℃ for 3 min; centrifuge it at 4℃, 12000rpm for 20min; transfer 0.5 ml of supernatant to an RNase-free centrifuge tube, add an equal volume of isopropanol and mix it gently, transfer all the solution to the RNA adsorption column, centrifuge it at 12000 rpm at 25℃ for 45 s, and discard the waste liquid; take 500 μl of deproteinized solution RE and add it to the RNA adsorption column, centrifuge it at 12000 rpm at 25℃ for 45 s, discard the waste liquid, and repeat this step once; put the RNA adsorption column back into the collection tube, centrifuge it at 12000 rpm at 25℃ The RNA adsorption column was taken out and placed at room temperature for 2 min, then placed in a new 1.5 ml RNase-free centrifuge tube, 100 μl RNase free water was added, and the tube was placed at room temperature for 2 min. The tube was centrifuged at 12000 rpm for 1 min. The solution collected in the centrifuge tube was the total RNA of Brassica napus. The total RNA concentration was determined using a micro-spectrophotometer.

[0031] The Brassica napus cDNA was prepared using a reverse transcription kit (SweScript All-in-One RT SuperMix, Swewell Biotechnology Co., Ltd.), and the specific method was as follows:

[0032] Take an RNase-free PCR tube, add 4 μl of 5×TransScript All-in-One SuperMix forqPCR, 1 μl of gDNA Remover, and 1 μg of total RNA of Brassica napus in sequence, make up to 20 μl with RNase free water, and complete the reaction in a PCR instrument according to the program of 25℃ 5 min, 42℃ 20 min, and 85℃ 5 s to obtain Brassica napus cDNA.

[0033] Take a new PCR tube and add 20 μl of PCR mix containing high-fidelity enzyme (KOD One PCRMaster Mix, Toyobo Biotechnology Co., Ltd.), 2 μl of the above reverse transcription product, 2 μl of 1 M upstream primer BnMYB615-F, 2 μl of 1 M upstream primer BnMYB615-R, and 14 μl of distilled water. In the PCR instrument, the reaction was completed according to the program of 94℃3min, 94℃30s, 58℃30s, 72℃40s (steps 2-4 were repeated 36 times), and 72℃5min. After the reaction, the amplified nucleotide sequence was 1908 bp long, with 18 bp at each end being the vector homology region and 1872 bp in the middle being BnMYB615 cDNA sequence, the specific information is shown in SEQ ID NO.1.

[0034] Example 2 Overexpression BnMYB615 Obtaining genes from Arabidopsis thaliana.

[0035] The final PCR product (1908 bp) of Example 1 was recovered by agarose gel electrophoresis, and the concentration of the recovered product was measured using a micro-spectrophotometer.

[0036] The overexpression plasmid vector backbone pEarly-Gate103 was digested with restriction endonuclease XhoI (QuickCut Xho I, Bio-Rad Biotechnology Co., Ltd.), the long fragment (12191 bp) was recovered by agarose gel electrophoresis, and the concentration of the recovered product was determined by a micro-spectrophotometer.

[0037] The one-step cloning kit (Seamless Assembly cloning kit, Sino-US Taihe Biotechnology Co., Ltd.) was used to construct BnMYB615 Gene overexpression vector, the specific method is:

[0038] Take a new PCR tube, and according to the concentration of the recovered product, add 10 μl 2× Assembly MasterMix, 100 ng overexpression plasmid vector backbone recovered product and 80 ng PCR recovered product in sequence, and fill to 20 μl with distilled water. Cover the lid, vortex the reagent to mix, incubate at 50°C for 15 min, take 5 μl of the reaction product, add it to the competent E. coli DH5α, mix gently, ice bath for 30 min, heat shock at 42°C for 45 s, and ice bath for 2 min. Add 500 μL of antibiotic-free LB liquid culture medium and resuscitate at 200 rpm in a 37°C shaker for 45 min. Aspirate the revived bacteria in the clean bench, spread on LB solid culture medium containing 50 μg / ml kanamycin, invert and culture overnight at 37°C, and select single colonies for sequencing analysis. The single colony with correct sequencing is the one containing BnMYB615 Escherichia coli host bacteria for gene overexpression vectors.

[0039] Created with BnMYB615 The Agrobacterium host bacteria of the gene overexpression vector, the specific method is:

[0040] Use Escherichia coli host bacteria containing the BnMYB615 gene overexpression vector to extract the plasmid, take a tube of Agrobacterium GV3101 competent medium, thaw it and place it on ice, add 1 μl of plasmid DNA to the competent medium, gently blow and mix, ice bath for 5 min, then put it in liquid nitrogen for quick freezing for 2 min, heat shock at 37°C for 5 min, and ice bath for 5 min. Add 500 μl of antibiotic-free LB liquid culture medium and revive it on a shaker at 28°C for 3 h. Pipette out the revived bacteria in the clean bench, spread it on YEP solid culture medium containing 50 μg / ml Kana, 50 μg / ml Rif and 20 μg / ml Gent, and invert it at 28°C for 48 h. PCR detection of the target vector is the one containing BnMYB615 Agrobacterium host bacteria for gene overexpression vectors.

[0041] The saved BnMYB615 Agrobacterium with gene overexpression vector was inoculated on YEP solid medium containing 50 μg / ml Kana, 50 μg / ml Rif and 20 μg / ml Gent. After 2 days, single colonies were picked and inoculated into 2 mL YEP liquid medium containing 50 μg / mL Kana, 50 μg / mL Rif and 20 μg / mL Gent. The culture was inoculated into 100 mL liquid medium with the same resistance at a ratio of 1:50 and cultured at 28°C and 220 rpm for about 8 h until OD 600 The value is 0.8-1.0.

[0042] The bacterial solution was centrifuged at room temperature at 4500 rpm for 5 min, and the supernatant was discarded. The bacterial pellet was resuspended in 1 / 2 MS liquid medium containing 5% Suger and 0.05% SilwetL-77, and the OD of the resuspended solution was adjusted. 600 The value is 0.8.

[0043] Wild-type Arabidopsis thaliana in full flowering stage were selected, and the pollinated fruit pods were cut off. The Arabidopsis inflorescence was immersed in the resuspension solution for 45 s, cultured in the dark for 24 h, and then cultured normally.

[0044] According to the above method, carry out the second infection one week later. There is no need to cut off the pollinated pods for the second infection.

[0045] After 30 days, Arabidopsis seeds were harvested. Using the red fluorescent protein gene marker carried by the seeds, seeds with red fluorescence were screened under a stereo fluorescence microscope, which were T1 generation seeds.

[0046] After sowing, the T1 generation seeds are managed normally and the T2 generation seeds are harvested from individual plants. Different individual plants of the T1 generation are different transgenic strains.

[0047] The T2 generation seeds were sown and managed normally. The red fluorescence separation ratio of the seeds was checked by body fluorescence before harvesting. Those without separation were regarded as homozygous.

[0048] Example 3 Overexpression BnMYB615 Genetic investigation of Arabidopsis thaliana cultivation and flowering time.

[0049] The wild type and three overexpression BnMYB615 The seeds of Arabidopsis thaliana strains with the same gene were disinfected with 0.1% mercuric chloride solution for 5 min, washed with sterile water for 8-10 times, and then sown on 1 / 2MS solid culture medium and cultured for 10 d at 25°C with a photoperiod of 14 h light and 10 h darkness. The Arabidopsis seedlings with good growth conditions were moved to nutrient soil for growth and cultured at 25°C with a photoperiod of 14 h light and 10 h darkness until the inflorescence grew to the first flower opening, and the number of rosette leaves was counted.

[0050] Figure 2 and Figure 3 The present invention overexpresses BnMYB615 The phenotype of flowering time difference between three strains of Arabidopsis thaliana and wild type materials and the statistical difference analysis of the number of rosette leaves at flowering time. BnMYB615 The flowering time of the genetic Arabidopsis thaliana is significantly later than that of the WT. The number of rosette leaves when the wild type opens the first flower is about 15. BnMYB615 The number of rosette leaves in the overexpression line when the first flower opened was about 45, which was significantly higher than that in the wild type. BnMYB615 It can significantly delay the flowering time of plants.

[0051] Example 4 BnMYB615 Obtaining gene knockout Brassica napus.

[0052] Using the Atu3d vector as a template, MYB615-sg1-F and gR-R as primers were used to amplify the first expression cassette terminator region, MYB615-sg1-U3R and UF as primers were used to amplify the first expression cassette promoter region, and 1 μl of the two amplification products were used as a template, and Pps-GGL and Pgs-GG2 were used as primers to amplify the first complete expression cassette; using the Atu6-29 vector as a template, MYB615-sg2-F and gR-R as primers were used to amplify the second expression cassette terminator region, and MYB615-sg2-U6R and UF were used to amplify the first expression cassette promoter region. The second expression cassette promoter region was amplified using primers, and 1 μl of the mixture of the two amplification products was used as a template, and Pps-GG2 and Pgs-GG3 were used as primers to amplify the complete second expression cassette; Atu3d vector was used as a template, MYB615-sg3-F and gR-R were used as primers to amplify the terminator region of the third expression cassette, MYB615-sg3-U3R and UF were used as primers to amplify the promoter region of the third expression cassette, and 1 μl of the mixture of the two amplification products was used as a template, and Pps-GG3 and Pgs-GGR were used as primers to amplify the complete third expression cassette.

[0053] The above Atu3d and Atu6-29 vectors were shared by the team of Academician Liu Yaoguang. The sequences of primers UF, gR-R, Pps-GGL, Pgs-GG2, Pps-GG2, Pgs-GG3, Pps-GG3 and Pgs-GGR were referenced from the article published by the team of Academician Liu Yaoguang in the journal Molecular Plant in 2015.

[0054] The nucleotide sequence of the above MYB615-sg1-F is shown in SEQ ID NO.10, which is: CGTATACTATTACAAAGCAGGTTTTAGAGCTAGAAAT.

[0055] The nucleotide sequence of the above-mentioned MYB615-sg1-U3R is shown in SEQ ID NO.11, which is: CTGCTTTGTAATAGTATACGTGACCAATGTTGCTCC.

[0056] The nucleotide sequence of the above-mentioned MYB615-sg2-F is shown in SEQ ID NO.12, which is: ATAGGTTTCTTGAAGCCTTGGTTTTAGAGCTAGAAAT.

[0057] The nucleotide sequence of the above-mentioned MYB615-sg2-U6R is shown in SEQ ID NO.13, which is: CAAGGCTTCAAGAAACCTATCAATCTCTTAGTCGACT.

[0058] The nucleotide sequence of the above-mentioned MYB615-sg3-F is shown in SEQ ID NO.14, which is: TCTTGAGAGACCATACCTGGGTTTTAGAGCTAGAAAT.

[0059] The nucleotide sequence of the above-mentioned MYB615-sg3-U3R is shown in SEQ ID NO.15, which is: CCAGGTATGGTCTCTCAAGATGACCAATGTTGCTCC.

[0060] The three expression cassette PCR products were recovered and their concentrations were measured using a micro-spectrophotometer.

[0061] Take a PCR tube, add 10×CutSmart Buffer (NEB) 1.5 μl, 10 mM ATP 1.5 μl, pYLCRISPR-Cas9P35s-H plasmid 60 ng, three expression cassette PCR recovery products 15 ng each, Bsa I-HF exonuclease (NEB) 10 U, T4 DNA ligase (NEB) 40 U, ​​and fill up to 15 μl with distilled water. Complete the reaction according to the program of 37℃ 10 min, 10℃ 5 min, 20℃ 5 min (repeat steps 1-3 3 times), 37℃ 3 min, 10℃ 5 min, 20℃ 5 min (repeat steps 4-6 3 times), 37℃ 5 min.

[0062] Take 5 μl of the reaction product and add it to the competent E. coli DH5α, mix gently, place on ice for 30 min, heat shock at 42°C for 45 s, and place on ice for 2 min. Add 500 μL of antibiotic-free LB liquid medium and resuscitate at 200 rpm in a 37°C shaker for 45 min. Pipette out the revived bacteria in the clean bench, spread on LB solid medium containing 50 μg / ml kanamycin, invert and culture at 37°C overnight, and select a single colony for sequencing analysis. The single colony with correct sequencing is the one containing BnMYB615 E. coli host strain for gene knockout vector.

[0063] Use containing BnMYB615Extract plasmid from Escherichia coli host bacteria of gene knockout vector, take a tube of Agrobacterium GV3101 competent medium, thaw and place on ice, add 1 μl plasmid DNA to the competent medium, gently blow and mix, ice bath for 5 min, then put in liquid nitrogen for quick freezing for 2 min, heat shock at 37°C for 5 min, and ice bath for 5 min. Add 500 μl of antibiotic-free LB liquid culture medium and revive on a shaker at 28°C for 3 h. Pipette out the revived bacteria in the clean bench, spread on YEP solid culture medium containing 50 μg / ml Kana, 50 μg / ml Rif and 20 μg / ml Gent, and invert at 28°C for 48 h. PCR detection of bacteria with the target vector is the one containing BnMYB615 Agrobacterium host strain for gene knockout vectors.

[0064] T0 generation materials were obtained using Agrobacterium-mediated genetic transformation of Brassica napus hypocotyls.

[0065] The CTAB method was used to extract genomic DNA of T0 transgenic lines and wild-type lines, and primers BnMYB615-sg12-F and BnMYB615-sg12-R were used to amplify the first and second target sites of the target gene in the wild-type and each transgenic line, and primers BnMYB615-sg3-F and BnMYB615-sg3-R were used to amplify the third target site of the target gene in the wild-type and each transgenic line. By comparing the sequences of different transgenic lines with the wild-type sequence, it was determined whether gene editing occurred at the target site and the type of editing.

[0066] The nucleotide sequence of the primer BnMYB615-sg12-F is shown in SEQ ID NO.16, which is: GGAGTGAGTACGGTGTGCATGGATACAAATACATCC, the nucleotide sequence of the primer BnMYB615-sg12-R is shown in SEQ ID NO.17, which is: GAGTTGGATGCTGGATGGTCTATACGTTGCCAGGCC, the nucleotide sequence of the primer BnMYB615-sg3-F is shown in SEQ ID NO.18, which is: GGAGTGAGTACGGTGTGCAGTGCCGATAATGGAACA, and the nucleotide sequence of the primer BnMYB615-sg3-R is shown in SEQ ID NO.19, which is: GAGTTGGATGCTGGATGGGCTGCGGCATGAGCTGCA.

[0067] Example 5 BnMYB615 Cultivation and flowering time investigation of gene knockout Brassica napus.

[0068] Select wild type and two BnMYB615The seeds of the gene-knockout Brassica napus westar strain were sown in a culture medium and cultured at 25°C under a photoperiod of 14 h light and 10 h darkness. The flowering time was from the start of sowing to the opening of the first flower of the plant. The flowering time of 6 plants in each strain was counted to calculate the average flowering time of each strain.

[0069] Figure 5 and Figure 6 The present invention BnMYB615 The phenotype diagram of flowering time difference between two gene knockout rapeseed lines and wild type materials and the statistical difference analysis diagram of flowering time. It can be seen from the results in the figure that BnMYB615 The flowering time of gene knockout rapeseed is significantly earlier than that of wild type. The average flowering time of wild type is 58 days, two BnMYB615 The flowering time of the knockout strains was 53 days and 55 days respectively. bnmyb615-39 The flowering time of the strain was significantly different from that of the wild type.

Claims

1. A rapeseed transcription factor BnMYB615 , characterized in that, The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

2. The transcription factor according to claim 1 BnMYB615 The cloning method is characterized in that Using the cDNA of Brassica napus ZS11 seedlings as a template, PCR amplification was performed using primers BnMYB615-F and BnMYB615-R; the nucleotide sequence of BnMYB615-F is shown in SEQ ID NO.3, which is 5'-TGGAGAGGACACGCTCGAATGGATACAAATACATCCGG-3', the first 18 bp of which is a vector homologous region used for vector homologous recombination construction, and the last 20 bp is an amplification key region, which can be combined with the start codon of the target gene for amplification initiation; the nucleotide sequence of BnMYB615-R is shown in SEQ ID NO.4, which is 5'-TCAGATCTACCATCTCGATGTTGAAGCTTCTCCTTCCA-3', the first 18 bp of which is a vector homologous region used for vector homologous recombination construction, and the last 20 bp is an amplification key region, which can be combined before the stop codon of the target gene for amplification initiation.

3. A method comprising the rapeseed transcription factor according to claim 1 BnMYB615 The overexpression vector is characterized in that The overexpression vector is pEarleyGate103-BnMYB615-mGFP, and its nucleotide sequence is shown in SEQ ID NO.

5.

4. A method comprising the rapeseed transcription factor according to claim 3 BnMYB615 E. coli host strain for overexpression of vector.

5. A method comprising the rapeseed transcription factor according to claim 3 BnMYB615 Agrobacterium host strain for overexpression of vector.

6. The rapeseed transcription factor according to claims 3, 4 and 5 BnMYB615 Application of overexpression vectors and host bacteria in delaying the flowering period of plants.

7. The rapeseed transcription factor according to claim 1 BnMYB615 The three gene knockout target sites designed by nucleotide sequences, the nucleotide sequence of target site 1 is shown in SEQ ID NO.7, which is 5'-CGTATACTATTACAAAGCAG-3', the nucleotide sequence of target site 2 is shown in SEQ ID NO.8, which is 5'-ATAGGTTTCTTGAAGCCTTG-3', and the nucleotide sequence of target site 3 is shown in SEQ ID NO.9, which is 5'-TCTTGAGAGACCATACCTGG-3'.

8. A rapeseed transcription factor constructed according to claim 7 BnMYB615 A gene knockout vector, characterized in that The vector is pYLCRISPR-Cas9P35s-H-BnMYB615, and its nucleotide sequence is shown in SEQ ID NO.

6.

9. A method comprising the rapeseed transcription factor according to claim 8 BnMYB615 E. coli host strain for gene knockout vector.

10. A method comprising the rapeseed transcription factor according to claim 8 BnMYB615 Agrobacterium host strain for gene knockout vectors.

11. The rapeseed transcription factor according to claim 1 BnMYB615 Nucleotide sequence and upstream 2000bp promoter sequence to reduce BnMYB615 For the purpose of gene expression, vectors and host cells are constructed using gene knockout, gene knockdown and RNA interference technologies.

12. The rapeseed transcription factor according to claim 8, 9, 10 and claim 11 BnMYB615 Application of gene knockout, gene knockdown and RNA interference vectors and host bacteria in advancing the flowering period of plants.

Images