KASP primer pair for identifying salt tolerance of wheat at seedling stage and identification method and application of KASP primer pair

Abstract

The invention discloses a KASP primer pair for identifying the salt tolerance of wheat in a seedling stage as well as an identification method and application of the KASP primer pair. The primer pair comprises an upstream primer 1 and an upstream primer 2, wherein the nucleotide sequences of the upstream primer 1 and the upstream primer 2 are respectively shown as SEQ ID No. 1 and SEQ ID No. 2; and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.3. Carrying out a KASP reaction by using the KASP primer pair and taking the extracted wheat genome DNA as a template, carrying out fluorescence signal reading on a product, and if the signal reading result is HEX allele, determining that the wheat is BB genotype; if the result is FAM allele, the wheat is of a bb genotype, and the salt tolerance of the wheat of the bb genotype is higher than that of the wheat of the BB genotype. The detection kit prepared from the KASP primer group is applied to the detection of the salt tolerance of the wheat in the seedling stage, salt-tolerant wheat varieties can be quickly screened, and the breeding efficiency is greatly improved; the identification method provided by the invention is simple in steps, reliable and practical, has an important application value in wheat breeding, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a KASP primer pair for identifying salt tolerance of wheat at seedling stage, and an identification method and application thereof. Background Art

[0002] In recent years, global food security is facing huge challenges, including the reduction of arable land, extreme climate change and environmental pollution. Among them, soil salinization has become an important factor restricting the productivity of arable land, and the degree and area of ​​salinization are increasing and expanding, seriously affecting the sustainable development of agriculture. According to statistics, the land affected by salinization worldwide has reached 1 billion hectares and is growing at a rate of 10 million hectares per year. Soil salinization is closely related to agricultural production. Studies have shown that the yield reduction of major crops caused by salinity stress exceeds 50%. In my country, saline-alkali land is also a widely distributed fragile ecological type. The area of ​​salinized soil in my country is about 36.933 million hectares. Soil salinization has become an important limiting factor restricting my country's high and stable grain yields.

[0003] Wheat is one of the three major staple crops in my country and a vital food crop in the world. It is the main energy source for nearly 30% of the world's population. However, due to the increasing area of ​​saline-alkali land and secondary salinized land, the planting area and average yield of wheat have been seriously affected. In the case of limited arable land, breeding salt-tolerant wheat varieties based on saline-alkali land is of practical significance for ensuring national food security and fully developing and utilizing saline-alkali land resources through the strategies of "seeds suitable for the land" and "seeds and land go hand in hand". However, the traditional breeding model has a long breeding cycle, a complicated salt resistance identification process, and a large workload. Therefore, establishing a rapid, accurate and high-throughput identification or auxiliary identification method for wheat salt tolerance can quickly screen salt-tolerant wheat varieties and improve breeding efficiency. Summary of the invention

[0004] In order to overcome the defects and shortcomings of the prior art, one of the objectives of the present invention is to provide a KASP primer pair for identifying salt tolerance of wheat seedlings.

[0005] Another object of the present invention is to provide an identification method for identifying salt tolerance of wheat at the seedling stage.

[0006] Another object of the present invention is to provide a kit for identifying salt tolerance in the seedling stage and its application.

[0007] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a KASP primer pair for identifying salt tolerance in the seedling stage, which comprises an upstream primer and a downstream primer: the upstream primer comprises an upstream primer 1 and an upstream primer 2: The upstream primer 1 is a nucleotide sequence as shown in SEQ ID No.1, or a DNA molecule in which 1-3 nucleotides are substituted and / or deleted and / or added to the nucleotide sequence as shown in SEQ ID No.1 and has the same function as the nucleotide sequence as shown in SEQ ID No.1; the upstream primer 2 is a nucleotide sequence as shown in SEQ ID No.2, or a DNA molecule in which 1-3 nucleotides are substituted and / or deleted and / or added to the nucleotide sequence as shown in SEQ ID No.2 and has the same function as the nucleotide sequence as shown in SEQ ID No.2; The downstream primer includes: a nucleotide sequence as shown in SEQ ID No.3, or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence as shown in SEQ ID No.3 are replaced and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID No.3.

[0008] Furthermore, the nucleotide sequence of the product amplified by the primer pair is shown in SEQ ID No.4.

[0009] The invention also provides a kit for screening wheat varieties with strong salt tolerance at the seedling stage, which comprises the primer pair.

[0010] Furthermore, the molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:5.

[0011] Furthermore, in the kit, the molar ratio of the upstream primer 1 having a nucleotide sequence as shown in SEQ ID No.1 to the upstream primer 2 having a nucleotide sequence as shown in SEQ ID No.2 is 1:1.

[0012] The present invention also provides an identification method for identifying salt tolerance of wheat seedlings using the primer pair, comprising the following steps: (1) extracting genomic DNA of wheat to be tested, using it as a template, performing a KASP reaction using the primer pair, and reading the fluorescence signal of the reaction product using a KASP genotyping detection device; (2) If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of BB genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of bb genotype.

[0013] Furthermore, in step (1), the Touchdown PCR reaction program in the KASP reaction is: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

[0014] Furthermore, the PCR reaction system in step (1) is: 0.25 μL of a 10 μM mixed primer consisting of upstream primer 1: upstream primer 2: downstream primer = 2:2:5; 2.5 μL of 2× PAMRS Pro SNP Gentyping PCR Mix; 1.25 μL of water; 1 μL of DNA template 100 ng / μL, and a total volume of 5 μL.

[0015] Furthermore, the salt tolerance of the tested wheat with the bb genotype at the seedling stage is significantly higher than that of the tested wheat with the BB genotype.

[0016] The present invention also provides the application of the primer pair, the kit or the identification method in breeding highly salt-tolerant wheat varieties at the seedling stage.

[0017] Furthermore, wheat varieties with bb genotype are bred as salt-tolerant wheat varieties at the seedling stage.

[0018] Compared with the prior art, the advantages and beneficial technical effects of the present invention are as follows: using the primer pair provided by the present invention, KASP analysis is performed on 213 wheat varieties, and the fluorescence reading results show that the genotypes of 69 wheat varieties are BB, and the genotypes of 144 wheat varieties are bb, and the salt tolerance of the wheat with the bb genotype at the seedling stage is significantly higher than that of the wheat with the BB genotype, which proves that the primers provided by the present invention can identify or assist in identifying wheat varieties with different salt tolerance at the seedling stage, and can quickly screen wheat varieties with high tolerance at the seedling stage, greatly improving the breeding efficiency; and the identification method provided by the present invention is simple, reliable, and practical, has important application value in wheat breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the KASP fluorescence detection results of the wheat varieties Lumai 23 (HEX allele, genotype BB) and Linfeng 3 (FAM allele, genotype bb), which have completed PCR product sequencing verification.

[0020] Figure 2 These are the results of KASP fluorescence detection of 213 wheat varieties, among which the HEX allele genotype is BB and the FAMallele genotype is bb.

[0021] Figure 3 The statistical results of leaf length relative to salt tolerance index of wheat seedlings with different genotypes. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments. The given examples are only for illustrating the present invention, but not for limiting the scope of the present invention.

[0023] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0024] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0025] The 213 wheat varieties used in the present invention are natural populations composed of wheat variety materials collected from different provinces or wheat regions in my country and foreign introduced varieties that have a great influence on the genetic background of wheat in my country, and can represent the current status of genetic diversity of wheat germplasm resources in my country. The origins of the 213 wheat varieties are shown in Table 1.

[0026] 2× PAMRS Pro SNP Gentyping PCR Mix is ​​a product of Wuhan Jingpeptide Biotechnology Co., Ltd.

[0027] Example 1: Determination of leaf length of tested wheat varieties under salt treatment and control conditions at seedling stage and calculation of leaf length relative salt tolerance index 1. Obtaining leaf length of tested wheat varieties under salt treatment and control conditions For each wheat variety to be tested, 18-20 healthy, undamaged, and plump seeds were selected. After soaking for 24 hours, they were placed in a culture medium covered with moist filter paper. The culture medium was placed in a refrigerator at 4 degrees for 48 hours to break dormancy. 16 seeds with the same bud length were selected and divided into groups, with 8 seeds in each group. The wheat to be tested was treated with 150mmol / L NaCl solution to simulate salt stress, and a control group was set up at the same time. After one week of treatment, the longest leaf length of each wheat plant in the experimental group and the control group was measured.

[0028] 2. Calculation of leaf length salt tolerance index and leaf length relative salt tolerance index In order to minimize the random errors generated during the experiment, Jimai 60 was used as the control variety when conducting different batches of salt stress and control treatments. It was used to homogenize the leaf length salt tolerance index of the tested varieties to facilitate comparative analysis of data between different batches of treatments.

[0029] Leaf length salt tolerance index = longest leaf length in salt stress treatment / longest leaf length in control group; Relative salt tolerance index of leaf length = leaf length salt tolerance index of the tested variety / leaf length salt tolerance index of Jimai 60; The calculation results of leaf length relative to salt tolerance index of different wheat varieties are shown in Table 1.

[0030] Table 1 Leaf length relative salt tolerance index of different wheat varieties and their corresponding genotypes

[0031] Example 2: Correlation analysis between KASP fluorescence detection results and salt tolerance of wheat seedlings 1. Preparation of primer pairs Primers for detecting salt tolerance in wheat were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.: Upstream Primer 1: 5'-GAAGGTGACCAAGTTCATGCTTCGGGAGATAAGGATACAGGTGT-3' (SEQ ID No. 1, wherein GAAGGTGACCAAGTTCATGCT is a universal tag sequence); Upstream Primer 2: 5'-GAAGGTCGGAGTCAACGGATTTCGGGAGATAAGGATACAGGTGG-3' (SEQ ID No. 2, wherein GAAGGTCGGAGTCAACGGATT is a universal tag sequence); The 3' ends of the upstream primer 1 and the upstream primer 2 are alleles of the same SNP.

[0032] Downstream primer: 5'-CATGTGGTCCTTCAGACTAGTGAA-3' (SEQ ID No. 3, the reverse complementary sequence of positions 43-66 of SEQ ID No. 4).

[0033] The primer pairs were purified by PAGE.

[0034] When used, the molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:5. The nucleotide sequence of the product amplified using the above primer pair is shown in SEQ ID No.4.

[0035] 2. Genotyping Methods 1. Extraction of genomic DNA Extracting genomic DNA from wheat leaves to be tested In this embodiment, the wheat to be tested is 213 wheat varieties in Table 1.

[0036] 2. Prepare PCR reaction system Table 2 PCR reaction system

[0037] The PCR reaction system (5 μL) is shown in Table 2.

[0038] 3. KASP and fluorescence detection and analysis (1) Take the PCR reaction system in step 2 and place it on a 9600 PCR Thermo Cycler instrument to perform PCR amplification reaction. The PCR program is as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

[0039] (2) After completing step (1), use the KASP genotyping detection device to read the fluorescent signal.

[0040] Some experimental results can be found in Figure 1 (HEX allele is Lumai 23, FAM allele is Linfeng 3, and each sample has 3 replicates). The results showed that the fluorescence detection results of the two haploid wheat varieties after KASP were divided into FAM allele and HEX allele.

[0041] Based on the fluorescence detection results of KASP, the following conclusions were drawn: KASP was performed using the genomic DNA of wheat varieties Lumai 23 and Linfeng 3 with known target sequences as templates using the above primer pairs and 2× PAMRS Pro SNP Gentyping PCR Mix. The fluorescence signal was read by the KASP genotyping detection equipment, and then the following judgment was made: if the fluorescence detection result showed HEX allele, the genotype of the wheat was BB; if the fluorescence detection result showed FAM allele, the genotype of the wheat was bb.

[0042] The genotypes of 213 wheat varieties were typed according to the above method, and the genotyping results are shown in Table 1 (HEXallele is the wheat to be tested with a genotype of BB, and FAM allele is the wheat to be tested with a genotype of bb). The results showed that the genotype of 69 wheat varieties was BB, and the genotype of 144 wheat varieties was bb.

[0043] 3. Correlation analysis between genotype and wheat salt tolerance The relative salt tolerance index of leaf length of wheat seedlings of genotype BB and genotype bb was statistically analyzed. The results are shown in Figure 3 The results showed that the salt tolerance of wheat varieties with bb genotype at the seedling stage was significantly higher than that of wheat varieties with BB genotype (P<0.001).

[0044] Example 3: Application of the primers in breeding salt-tolerant wheat varieties The application of the present invention in breeding salt-tolerant wheat varieties comprises the following steps: 1. Extract the genomic DNA of the wheat to be tested, use it as a template, use the primer pair to perform KASP reaction, and read the fluorescence signal of the reaction product.

[0045] The primer pair includes an upstream primer and a downstream primer; the upstream primer includes an upstream primer 1 and an upstream primer 2: the upstream primer 1 is a nucleotide sequence as shown in SEQ ID No.1, the upstream primer 2 is a nucleotide sequence as shown in SEQ ID No.2, and the downstream primer is a nucleotide sequence as shown in SEQ ID No.3.

[0046] The touchdown PCR reaction program in the KASP reaction was as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

[0047] The PCR reaction system was: 0.25 μL of a 10 μM mixed primer consisting of upstream primer 1: upstream primer 2: downstream primer = 2: 2: 5; 2× PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; water 1.25 μL; 1 μL of DNA template 100 ng / μL, and a total volume of 5 μL.

[0048] 2. If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of BB genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of bb genotype. The relative salt tolerance index of leaf length of the wheat to be tested with bb genotype is significantly higher than that of the wheat to be tested with BB genotype, and the wheat variety with bb genotype is selected as the salt-tolerant wheat variety at the seedling stage.

[0049] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A KASP primer pair for identifying salt tolerance of wheat seedlings, characterized in that: The primer pair includes an upstream primer and a downstream primer: the upstream primer includes an upstream primer 1 and an upstream primer 2: The upstream primer 1 is a nucleotide sequence as shown in SEQ ID No.1, or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence as shown in SEQ ID No.1 are replaced and / or deleted and / or added and have the same function as the nucleotide sequence as shown in SEQ ID No.1; The upstream primer 2 is a nucleotide sequence as shown in SEQ ID No.2, or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence as shown in SEQ ID No.2 are replaced and / or deleted and / or added and has the same function as the nucleotide sequence as shown in SEQ ID No.2; The downstream primer is a nucleotide sequence as shown in SEQ ID No.3, or a DNA molecule having the same function as the nucleotide sequence shown in SEQ ID No.3 after substitution and / or deletion and / or addition of 1-3 nucleotides.

2. The KASP primer pair according to claim 1, characterized in that The nucleotide sequence of the product amplified using the primer pair is shown in SEQ ID No.

4.

3. A kit for screening salt-tolerant wheat varieties at the seedling stage, characterized in that: The kit comprises the KASP primer pair as claimed in claim 1.

4. The kit according to claim 3, characterized in that The molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:

5.

5. A method for identifying salt tolerance of wheat seedlings using the KASP primer pair according to claim 1, characterized in that: The following steps are involved: (1) extracting genomic DNA of wheat to be tested, using it as a template, performing a KASP reaction using the KASP primer pair, and reading the fluorescence signal of the reaction product; (2) If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of BB genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of bb genotype.

6. The identification method according to claim 5, characterized in that: The Touchdown PCR reaction program in the KASP reaction in step (1) is: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C for 1 min, 10 cycles, the annealing temperature of each cycle is 0.8°C lower than that of the previous cycle; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

7. The identification method according to claim 5, characterized in that: The PCR reaction system in step (1) is: 0.25 μL of a 10 μM primer mixture consisting of upstream primer 1: upstream primer 2: downstream primer = 2: 2: 5; 2.5 μL of 2× PAMRS ProSNP Gentyping PCR Mix; 1.25 μL of water; 1 μL of DNA template 100 ng / μL, and a total volume of 5 μL.

8. The identification method according to claim 5, characterized in that: The salt tolerance of the tested wheat with the bb genotype is significantly higher than that of the tested wheat with the BB genotype.

9. Use of the primer pair according to claim 1 or the kit according to claim 3 in breeding salt-tolerant wheat varieties.

10. The use according to claim 9, characterized in that: The wheat varieties with bb genotype were selected as salt-tolerant wheat varieties.

Images