Application of miR-34c-5p and mimics thereof in hypoxic ischemic brain injury

Abstract

The invention belongs to the technical field of disease diagnosis and treatment and molecular biology, and particularly relates to application of miR-34c-5p and mimics thereof in hypoxic ischemic brain injury. Tests prove that the expression quantity of the miR-34c-5p in the damaged cortex after the hypoxic-ischemic brain injury is reduced, and the effect of treating the hypoxic-ischemic brain injury can be achieved by giving the exogenous miR-34c-5p. In order to reduce damage and stimulation to brain tissues, the invention further provides a liposome which is delivered through a nose and entraps miR-34c-5p mimics, so that a more feasible non-invasive treatment scheme is provided for clinical application, and therefore, the liposome has a good practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease diagnosis and treatment and molecular biology, and specifically relates to the application of miR-34c-5p and its mimics in hypoxic-ischemic brain damage. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Neonatal hypoxic-ischemic (HI) encephalopathy is a hypoxic-ischemic brain injury caused by perinatal asphyxia. It is a common disease that causes neonatal death and long-term neurological dysfunction in survivors. HI is a serious disease with a high incidence rate. At present, the clinical treatment of this disease is mainly comprehensive treatment, combined with mild hypothermia, hyperbaric oxygen, magnesium sulfate and gangliosides. However, the treatment effect is not significant, and it is very easy to cause adverse consequences such as tissue damage and infection. Therefore, there is an urgent need to improve our understanding of the HI injury process and explore various new therapies for brain damage caused by hypoxia and ischemia.

[0004] As an endogenous non-coding single-stranded small RNA (a class of 21 to 25 ribonucleotide single-stranded non-coding RNA molecules), microRNA (miRNA) binds to target messenger RNA (mRNA) through base pairing with 3′ untranslated regions (3′-UTRs), regulating direct cleavage and / or translation inhibition of target mRNA. MiRNA is widely involved in biological development, differentiation, apoptosis and other processes. Recent studies have shown that miRNA is a key factor in regulating other biological processes such as neuroinflammation, apoptosis and oxidative stress after cerebral hypoxia-ischemia.

[0005] The microRNA-34 (miR-34) family (miR-34a, miR-34b, and miR-34c) is one of the major upregulated miRNAs during neuronal differentiation, playing an important role in neural development and mature and differentiated neurons. Previous studies have shown that miR-34 can participate in the regulation of oxidative stress and its related cellular pathways in neurodegenerative diseases. At the same time, miR-34c-5p, a key member of the miR-34 family, has been reported to be involved in the pathological process of a variety of human diseases (such as neuropathic pain, diabetes, cancer, and acute myeloid leukemia). In neurological diseases, miR-34c-5p can cause neuroinflammation in drug-resistant epilepsy. However, it is unclear whether changes in the expression of miR-34c-5p will have an impact on neonatal HI injury.

[0006] In nanoparticle drug delivery systems, liposomes have become the most widely used drug carriers because of their good physicochemical properties, ability to protect drugs from degradation and high biocompatibility. They are also the only nanoparticle system approved by the U.S. Food and Drug Administration (FDA) for clinical use. The use of liposomes for drug loading can improve the safety and effectiveness of therapeutic molecules such as drugs, nucleic acids, vaccines and proteins. Passive drug loading through liposomes can prevent miRNA and its mimics in the human physiological environment from being removed or degraded before they take effect, providing a drug loading method that is more suitable for clinical application. Intranasal administration, as a non-invasive drug delivery method, can bypass the blood-brain barrier to allow drugs to enter the central nervous system directly, with the advantages of avoiding the first-pass effect and improving bioavailability. Compared with traditional intracerebroventricular administration, it causes less damage and stimulation, and is more feasible in clinical treatment applications. However, there are currently no reports on the use of liposome encapsulation of miR-34c-5p for the treatment of HI. Summary of the invention

[0007] In view of the deficiencies in the prior art, the present invention provides the use of miR-34c-5p and its mimics in hypoxic-ischemic brain injury. The present invention has been proved through experiments that in the diagnosis and treatment of HI, miR-34, especially miR-34c-5p, can be used as a target molecule for prediction and intervention, and the development of nanoparticle complexes using miR-34c-5p as a strategy and loaded by liposomes has important significance and potential application prospects for basic research on the prevention, diagnosis and treatment of neuronal damage after HI injury. Based on the above research results, the present invention is completed.

[0008] Specifically, the present invention relates to the following technical solutions:

[0009] The first aspect of the present invention provides the use of a substance for promoting the expression of miR-34c-5p and / or enhancing its activity in any one or more of the following:

[0010] (a) preparing products for improving HI-mediated cerebral infarction and reducing HI-mediated brain tissue loss;

[0011] (b) preparing a product for reducing HI-mediated apoptosis;

[0012] (c) preparing products that alleviate microglial activation and inflammatory response after HI;

[0013] (d) preparing products for preventing and / or treating hypoxic-ischemic brain damage.

[0014] The second aspect of the present invention provides a liposome for nasal delivery of miR-34c-5p mimics, wherein the liposome contains at least the above-mentioned miR-34c-5p mimics.

[0015] The third aspect of the present invention provides the use of the above liposome in the preparation of a non-invasive drug for treating hypoxic-ischemic brain damage. Specifically, the drug dosage form is a preparation for nasal delivery.

[0016] A fourth aspect of the present invention provides a method for treating hypoxic-ischemic brain damage, the method comprising administering the above-mentioned liposomes to a subject; further, the administration method may specifically be nasal delivery.

[0017] Beneficial technical effects of one or more of the above technical solutions:

[0018] The above technical solution has been proved through experiments that the expression of miR-34c-5p in the damaged cortex after HI is reduced, and the administration of exogenous miR-34c-5p can play a role in treating HI. Furthermore, in order to reduce damage and stimulation to brain tissue, the above technical solution provides a liposome containing miR-34c-5p mimics for nasal delivery, thereby providing a more feasible non-invasive treatment solution for clinical application, and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0020] Figure 1The diagrams are the expression changes of miR-34c-5p in brain injury tissue after HI detected by qRT-PCR in the embodiment of the present invention, and the results of the effect of intracerebroventricular injection of miR-34c-5p mimics on brain injury 72h after HI. Among them, (A) detected the changes in the expression of miR-34c-5p in the damaged tissue of the HI group compared with the Sham group 72h after HI, and (B) detected the changes in the expression of miR-34c-5p in the damaged tissue of the mimics group compared with the NC group 72h after HI after intracerebroventricular injection of miR-34c-5p mimics. The left figures in (C) and (D) are representative brain images 72h after HI (N=4 / group), TTC staining shows that the white area is the cerebral infarction area, and the right figure is a quantitative analysis of the cerebral infarction area 72h after HI (N=4 / group). (E) is a representative Nissl staining of coronal sections of each group (scale bar=200μm). Statistics = mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001. Data were analyzed using one-way ANOVA with Bonferroni correction.

[0021] Figure 2 The results of the experiment of miR-34c-5p mimics reducing HI-induced apoptosis in the embodiment of the present invention are shown in Figure 1. Among them, (A) is a TUNEL staining image, and the upper, middle and lower parts are coronal sections of each group (scale bar = 500 μm), representative images of the damaged cortex and representative images of the hippocampus (scale bar = 100 μm). (B) shows the Western blotting results of cleaved-caspase-3 and caspase-3 in the damaged cortex, which were quantified using Image-Pro Plus 6.0, and the results are expressed as the ratio of cleaved-caspase-3 / caspase-3 (N = 4 / group). Statistical value = mean ± standard deviation; *p < 0.05, **p < 0.01. Data were analyzed using one-way ANOVA and corrected by Bonferroni.

[0022] Figure 3 The results of the effect of miR-34c-5p mimics on neuroinflammation after HI in the embodiment of the present invention are shown in Figure 1. The first row in (A) is a representative Iba-1 staining image in the right damaged cortex 72 hours after HI, scale bar = 50 μm, and the second row is a representative local enlarged image of Iba-1 positive cells, scale bar = 20 μm. (B, C) are the Western blotting results of TNF-α and IL-1β in the damaged cortex 72 hours after HI injury (N = 4 / group). Statistical value = mean ± standard deviation; *p < 0.05, **p < 0.01, ***p < 0.001. Data were analyzed using one-way ANOVA and corrected by Bonferroni.

[0023] Figure 4 The results of the effect of liposomes loaded with miR-34c-5p mimics delivered nasally on brain injury 72h after HI in the embodiment of the present invention are shown in Figure 1. (A) After nasogastric administration of liposomes loaded with miR-34c-5p mimics, the expression of miR-34c-5p in the damaged tissue of the mimics@liposome group was detected compared with the NC@liposome group 72h after HI. The left picture in (B) is a representative brain image 72h after HI (N=4 / group), TTC staining shows that the white area is the area of ​​cerebral infarction, and the right picture is a quantitative analysis of the area of ​​cerebral infarction 72h after HI (N=4 / group). (C) is a representative Nissl staining of coronal sections of each group (scale bar = 200μm). (D) is a TUNEL staining image, with the upper and lower representative images of the damaged cortex and hippocampus of each group, respectively (scale bar = 100μm). (E) The first row shows representative Iba-1 staining images in the right damaged cortex 72 h after HI, scale bar = 50 μm, and the second row shows local magnification of representative Iba-1 positive cells, scale bar = 20 μm. Statistical value = mean ± standard deviation; *p < 0.05. Data were analyzed by one-way ANOVA and corrected by Bonferroni.

[0024] Figure 5 Identification of liposomes encapsulating miRNA in the embodiment of the present invention. (A) The left picture is the particle size analysis of liposomes encapsulating NC (NC@liposome), with a fitting peak of 143nm; the right picture is the particle size analysis of liposomes encapsulating miR-34c-5p mimics (mimics@liposome), with a fitting peak of 119nm. (B) is an electron micrograph of NC@liposome and mimics@liposome, scale bar = 50μm. DETAILED DESCRIPTION

[0025] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0026] It should be noted that the terms used here are only for describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. If the experimental methods of specific conditions are not indicated in the following specific embodiments, the conventional methods and conditions of molecular biology in the art are usually followed, and such techniques and conditions are fully explained in the literature. See, for example, Sambrook et al., the techniques and conditions described in "Molecular Cloning: Laboratory Manual", or according to the conditions recommended by the manufacturer.

[0027] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention and are not intended to limit the content thereof. If the specific experimental conditions are not specified in the examples, they are usually carried out under conventional conditions or under conditions recommended by the sales company; the materials and reagents used in the examples, unless otherwise specified, can be purchased through commercial channels.

[0028] In a typical embodiment of the present invention, the substance that promotes the expression of miR-34c-5p and / or increases its activity is used in any one or more of the following:

[0029] (a) preparing products for improving HI-mediated cerebral infarction and reducing HI-mediated brain tissue loss;

[0030] (b) preparing a product for reducing HI-mediated apoptosis;

[0031] (c) preparing products that alleviate microglial activation and inflammatory response after HI;

[0032] (d) preparing products for preventing and / or treating hypoxic-ischemic brain damage.

[0033] The product may be a drug or an experimental reagent for non-medical use, and the experimental reagent may be used for basic research, such as constructing HI-related cell models or animal models to study the occurrence and development mechanism of HI and other related diseases.

[0034] The substance that promotes miR-34c-5p expression and / or improves its activity can be a substance that upregulates miR-34c-5p expression and / or promotes its activity based on Mimics technology; as well as a promoter or lentivirus that upregulates miR-34c-5p expression; and also includes compound promoters. In a specific embodiment of the present invention, the substance that promotes miR-34c-5p expression and / or improves its activity is a miR-34c-5p mimic (miR-34c-5p mimics, SEQ ID NO.1-2).

[0035] According to the present invention, when the product is a medicine, the medicine further comprises at least one inactive pharmaceutical ingredient.

[0036] In another embodiment of the present invention, the inactive drug ingredients include pharmaceutically acceptable carriers, excipients and / or diluents, such as pharmaceutically compatible inorganic or organic acids or bases, polymers, copolymers, block copolymers, monosaccharides, polysaccharides, ionic and nonionic surfactants or lipids, pharmacologically harmless salts such as sodium chloride, flavoring agents, vitamins such as vitamin A or vitamin E, tocopherols or provitamins, antioxidants such as ascorbic acid, and stabilizers and / or preservatives for extending the use and storage time of the active drug ingredients or formulations, and other commonly used inactive drug ingredients or adjuvants and additives known in the prior art, and mixtures thereof.

[0037] The drug may be in the form of an oral preparation, an injection or a nasogastric formulation (i.e., a formulation delivered through the nasal cavity), preferably a nasogastric formulation.

[0038] The present invention proves through experiments that the nasal delivery of liposomes encapsulating miR-34c-5p mimics causes less damage and stimulation to the brain, providing a more feasible non-invasive treatment plan for clinical application.

[0039] In another specific embodiment of the present invention, a liposome for nasal delivery of miR-34c-5p mimics is provided, wherein the liposome contains at least the above-mentioned miR-34c-5p mimics (SEQ ID NO.1-2).

[0040] The average particle size of the liposome is 119 nm.

[0041] In the present invention, the liposome can be prepared by using common liposome components (such as soybean lecithin and cholesterol) through methods such as thin film dispersion method.

[0042] In another specific embodiment of the present invention, the liposome is prepared by:

[0043] The miR-34c-5p mimics were added into the blank liposome solution, mixed evenly, and incubated to obtain the product.

[0044] The specific preparation method of the blank liposome includes: dispersing soybean lecithin and cholesterol into ethanol for dissolution, rotary evaporating until the ethanol is evaporated to dryness, and then adding phosphate buffered saline (PBS) thereto for hydration.

[0045] Wherein, the mass ratio of the soybean lecithin to cholesterol is 1-10:1, preferably 4:1.

[0046] The specific conditions of rotary evaporation are: rotary evaporation treatment is carried out at 80-120 rpm (preferably 100 rpm) at a temperature of 25-40° C. (preferably 30° C.).

[0047] In another specific embodiment of the present invention, the use of the above liposome in the preparation of a non-invasive drug for treating hypoxic-ischemic brain damage is provided. Specifically, the drug dosage form is a preparation for nasal delivery.

[0048] In another specific embodiment of the present invention, a method for treating hypoxic-ischemic brain damage is provided, the method comprising administering the above-mentioned liposomes to a subject; further, the administration method may specifically be nasal delivery.

[0049] In another specific embodiment of the present invention, the drug administration subjects can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, gorillas, etc.

[0050] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0051] Example

[0052] 1.HI model: The experimental animals were C57BL / 6J suckling mice at 7 days postnatal (P7), weighing 4-6 g. The experimental animals were purchased from the Experimental Animal Center of Shandong University. The animal experiments were conducted in accordance with the International Guidelines for Animal Research provided by the Council for International Organizations of Medical Sciences, and the procedures were approved by the Animal Ethics and Welfare Committee of Shandong University. The experimental operators were trained in accordance with the guidelines of the Animal Care and Use Committee.

[0053] The HI model was established by using the Rice–Vannucci method in C57BL / 6J mice at 7 days postnatal. Briefly, C57BL / 6J mice were anesthetized with 2% isoflurane and the right common carotid artery was ligated. After the operation, the mice rested for 30 minutes and then were treated in a hypoxic environment (9.7% O2) for 60 minutes. In the sham group, the right common carotid artery was exposed after anesthesia, but it was not ligated, and hypoxia was not performed after skin suture.

[0054] 2. Experimental grouping: Newborn mice were randomly divided into the following 6 groups: sham group, HI group, HI+NC group and HI+miR-34c-5p mimics, HI+NC@liposome group and HI+miR-34c-5pmimics@liposome group. NC / mimics (2.5 μL) was administered intracerebroventricularly 72 h before HI, and NC@liposome / mimics@liposome (10 μL) was administered intranasally 24 h before HI. Pathology and gene protein expression were detected 72 h after HI injury.

[0055] 3. Preparation of blank liposomes: Weigh 40 mg of soybean lecithin and 10 mg of cholesterol, ultrasonically disperse them in 15 mL of ethanol, and pour them into a round-bottom flask after dissolving. Use a rotary evaporator to perform rotary evaporation (30°C, 100 rpm) until the ethanol is evaporated and a liposome film is formed at the bottom of the round-bottom flask. Add 0.01 M phosphate buffer (PBS) to it, rotate it on a rotary evaporator at room temperature to hydrate it. Take out the liposome solution and store it in a 4°C refrigerator.

[0056] 4. Preparation of miRNA-loaded liposomes: Add NC or miR-34c-5p mimics (S: AGGCAGUGUAGUUAGCUGAUUGC, SEQ ID NO.1; AS: AAUCAGCUAACUACACUGCCUUU, SEQ ID NO.2, Jima Gene) into the blank liposome solution and mix by pipetting. Incubate at room temperature for 1 h to obtain liposomes loaded with miRNA (each 10 μL contains the same dose of miRNA as that injected into the lateral ventricle).

[0057] 5. Determination of cerebral infarction area: After HI for 72 hours, the mice were sacrificed for TTC staining to observe the degree of brain edema and cerebral infarction area of ​​the mice. Cerebral infarction area (%) = (contralateral hemisphere area - ipsilateral hemisphere healthy area) / contralateral hemisphere area × 100%.

[0058] 6. Nissl staining: After 72 hours of HI, the mice were sacrificed and Nissl staining was performed to observe the tissue loss in the damaged brain area of ​​the mice.

[0059] 7. TUNEL staining: After 72 hours of HI, the mice were sacrificed and apoptotic cells were marked using TUNEL apoptosis detection kit. Apoptotic cells were counted using Image J. Cell apoptosis rate (%) = number of apoptotic cells / total number of cells × 100%.

[0060] 8. Immunohistochemical staining: The mice were sacrificed after HI for 72 hours, and immunohistochemical staining was performed using a microglia-specific antibody against ionized calcium channel protein (Iba1) to specifically mark microglia.

[0061] 9. RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR): TRIzol method was used to lyse cells and tissues to extract total RNA. qRT-PCR reaction was performed in Bio-rad IQ5 real-time quantitative PCR system.

[0062] 10. Western blotting analysis: EVs, cells or ipsilateral cortex were homogenized in RIPA buffer containing protease / phosphatase inhibitors and PMSF for 15 min, and then the protein concentration was determined using a BCA protein assay kit. Chemiluminescent signals were generated using an ECL kit and then detected using a Tanon imaging system.

[0063] Experimental results:

[0064] 1. Changes in miR-34c-5p expression after HI. Elevated miR-34c-5p alleviates HI-induced brain damage

[0065] like Figure 1 As shown in the figure, qRT-PCR was used to detect the expression level of miR-34c-5p in HI brain injury tissues, and TTC staining and Nissl staining were used to analyze the effect of increased miR-34c-5p expression on the degree of brain tissue damage. (A) shows that compared with the Sham group, the expression of miR-34c-5p in the HI group was significantly downregulated after 72h of HI; as shown in (B), after the administration of miR-34c-5pmimics through the lateral ventricle, miR-34c-5p in the mimics group was significantly increased after 72h of HI compared with the NC group. (C) and (D) are representative brain images of this group and quantitative analysis of cerebral infarction area. (E) is the Nissl staining result of brain tissue in these groups. The results showed that the expression of miR-34c-5p in the damaged cortex after HI was reduced, and the administration of exogenous miR-34c-5p could significantly improve cerebral infarction and reduce brain tissue loss.

[0066] 2. MiR-34c-5p mimics reduces HI-induced apoptosis

[0067] like Figure 2 As shown, (A) is a TUNEL staining image of the cortex and hippocampus in the right damaged area after HI for 72 hours. The increased expression of miR-34c-5p reduced the number of TUNEL-positive cells in the hippocampus and cortex. (B) shows the changes in protein expression of Cleaved-caspase-3 and caspase-3 in the damaged cortex, which were quantitatively analyzed using Image-Pro Plus 6.0. The results are expressed as the ratio of Cleaved-caspase-3 / caspase-3, as shown in Figure (C). The results show that miR-34c-5p mimics can reduce HI-induced cell apoptosis.

[0068] 3. Effects of MiR-34c-5p mimics on neuroinflammation after HI

[0069] like Figure 3 As shown, (A) is a representative Iba-1 staining of the right damaged cortex after HI 72h, and the second line is a local enlargement of a representative Iba-1 positive cell. It can be seen that the microglia in the cortex are activated 72h after HI, the cell body becomes larger, and the process becomes shorter, and the administration of miR-34c-5p mimics can reverse the morphological changes of microglia and alleviate microglia activation. (B, C) are the Western blotting results of TNF-α and IL-1β in the right damaged cortex 72h after HI injury. The figure shows that miR-34c-5p mimics reduces the expression of proinflammatory cytokines after HI. The results show that miR-34c-5p mimics can alleviate the activation of microglia after HI and reduce the inflammatory response.

[0070] 4. Effect of nasal delivery of miR-34c-5p mimics@liposome on brain injury 72h after HI

[0071] like Figure 4As shown, (A) after nasogastric administration of mimics@liposomes, miR-34c-5p was significantly increased in the mimics@liposome group compared with the NC@liposome group after HI72h. (B) is a representative brain image of this group and a quantitative analysis of the cerebral infarction area, which shows that nasal delivery of mimics@liposomes can reduce the cerebral infarction area caused by HI. (C) is a Nissl staining result of brain tissue in this group. (D) is a TUNEL staining image of the cortex and hippocampus in the right damaged area 72h after HI. Nasal administration of mimics@liposomes reduced the number of TUNEL-positive cells in the hippocampus and cortex. (E) is a representative Iba-1 staining of the right damaged cortex 72h after HI. The second row is a local enlarged image of representative Iba-1-positive cells. After nasogastric administration of mimics@liposomes, the activation of microglia was alleviated. The results showed that liposomes loaded with miR-34c-5p mimics delivered via nasal administration had the same effect as direct intracerebroventricular injection of miR-34c-5p mimics in alleviating HI-induced brain damage, reducing cerebral infarction and brain tissue loss caused by HI, reducing the number of apoptotic cells, and alleviating the activation of microglia after HI. In terms of the therapeutic effect on brain damage after HI, under the condition of single administration of the same dose, as shown by quantitative analysis of cerebral infarction area, the results of direct intracerebroventricular injection of miR-34c-5p mimics were better than those of nasal delivery of miR-34c-5pmimics@liposome, and the efficiency of nasal delivery of liposome-encapsulated miRNA to the brain can be improved by multiple administrations. Compared with traditional intracerebroventricular administration, this method causes less damage and stimulation, providing a more feasible non-invasive treatment option for clinical application.

[0072] 5. Identification of miRNA-encapsulated liposomes

[0073] like Figure 5 As shown, (A) is the particle size analysis diagram of liposomes encapsulating NC and miR-34c-5p mimics, and the fitting peaks are 143nm and 119nm. (B) is the electron micrograph of liposomes encapsulating NC and miR-34c-5p mimics, which shows hollow vesicles and uniform distribution. The results show that encapsulating miR-34c-5p mimics has no effect on the size and morphology of liposomes, and liposomes can be used as carriers to load and transport miR-34c-5p mimics.

[0074] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a substance that increases miR-34c-5p expression and / or activity in any one or more of the following: (a) preparing products for improving HI-mediated cerebral infarction and reducing HI-mediated brain tissue loss; (b) preparing a product for reducing HI-mediated apoptosis; (c) preparing products that alleviate microglial activation and inflammatory response after HI; (d) preparing products for preventing and / or treating hypoxic-ischemic brain damage.

2. The use according to claim 1, characterized in that: The product is an experimental reagent for pharmaceutical or non-medical use, and the experimental reagent can be used for basic research.

3. The use according to claim 1, characterized in that: The substance that promotes the expression of miR-34c-5p and / or increases its activity is a substance that upregulates the expression of miR-34c-5p and / or promotes its activity based on the Mimics technology; and a promoter or lentivirus that upregulates the expression of miR-34c-5p; it also includes compound promoters; further, the substance that promotes the expression of miR-34c-5p and / or increases its activity is miR-34c-5p mimics (SEQ ID NO.1-2).

4. The use according to claim 1, characterized in that: The drug is administered in the form of an oral preparation, an injection or a nasogastric formulation (i.e., a formulation delivered through the nasal cavity); preferably, the nasogastric formulation.

5. A liposome for nasal delivery of miR-34c-5p mimics, characterized in that: The liposome contains at least miR-34c-5p mimics (SEQ ID NO.1-2).

6. The liposome according to claim 5, wherein The average particle size of the liposome is 119 nm.

7. The liposome according to claim 5, wherein The liposome, its preparation method comprises: The miR-34c-5p mimics are added to the blank liposome solution, mixed evenly, and incubated to obtain the product.

8. The liposome according to claim 7, wherein The specific preparation method of the blank liposome comprises: dispersing soybean lecithin and cholesterol in ethanol to dissolve, rotary evaporating until the ethanol is evaporated to dryness, and then adding phosphate buffer to hydrate the liposome; Wherein, the mass ratio of soybean lecithin to cholesterol is 1-10:1; The specific conditions of rotary evaporation are: rotary evaporation at 80-120 rpm at a temperature of 25-40°C.

9. Use of the liposome according to any one of claims 5 to 8 in the preparation of a non-invasive drug for treating hypoxic-ischemic brain damage.

10. The use according to claim 9, characterized in that: The pharmaceutical dosage form is a preparation for nasal delivery.

Images