Bacillus altitudinis with yield-increasing and stress-resisting functions and application of bacillus altitudinis

Abstract

The invention relates to the technical field of biology, and discloses bacillus altitudinis with yield increasing and stress resistance functions and application of the bacillus altitudinis WR10. The endophytic bacillus altitudinis WR10 is fast in growth, wide in enzyme system, salt-tolerant and easy in large-volume and low-cost scale-up culture; the bioavailability of the phosphorus element in the soil can be increased, and the stress of high salinity on plants can be relieved; besides, the endophytic bacillus altitudinis WR10 also can degrade phytic acid in soil and improve the phosphorus content of wheat plants, indexes such as fresh weight and dry weight of wheat seedlings are obviously improved, and the growth of wheat in adverse situations is greatly promoted; in the aspect of yield increase, a small amount of plant endophytic bacillus altitudinis WR10 is sprayed on leaf surfaces, so that the yield of wheat in a field can be increased by more than 10%.

Description

Technical Field

[0001] The invention relates to the field of biotechnology and discloses a strain of Bacillus spp. with the functions of increasing production and resisting stress and application thereof. Background Art

[0002] At present, grain production in many parts of the country has entered a bottleneck period. As it becomes increasingly difficult to increase production, new technologies and sustainable solutions are needed.

[0003] Agricultural microorganisms have shown great application prospects in increasing the yield of cash crops and improving stress resistance. Microorganisms can secrete a variety of physiologically active substances, directly or indirectly regulate the soil environment and stimulate plant growth. Therefore, the application of microbial agents with specific functions is an important way to meet the development of modern agriculture and future agriculture. However, most strains are difficult to survive after entering the soil because they are difficult to compete with indigenous microorganisms. Bacillus has advantages in fermentation technology, dosage form processing, storage, and reproduction because of its spores and strong heat resistance.

[0004] Bacillus is a relatively new species in the genus Bacillus and is rarely used in the agricultural field. Bacillus has low nutritional requirements for growth and simple culture conditions, making it suitable for industrial production. Currently, some fertilizer products on the market have added Bacillus, but most of the reported Bacillus are used for disease resistance of cash crops, and have not been used for yield increase and stress resistance of field crops (such as wheat). Therefore, screening Bacillus with the function of increasing wheat yield and developing effective microbial fertilizers will have a significant impact on the new round of 100 billion jin of grain production capacity increase and is of great significance to the development of green agriculture. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Bacillus altitudinis with yield-increasing and stress-resistance functions and an application thereof. Bacillus altitudinis WR10 grows fast, has a wide enzyme system, and is salt-tolerant. It can increase the yield of wheat in the field, increase the bioavailability of phosphorus in the soil, and alleviate the stress of high salt on plants, greatly promoting the growth of wheat in adverse conditions.

[0006] In order to achieve the above technical effects, the technical solution adopted by the present invention is:

[0007] A strain of Bacillus altitudinis with yield-increasing and stress-resistance functions, wherein the Bacillus altitudinis is an endophytic Bacillus altitudinis WR10, namely Bacillus altitudinis WR10, which was deposited in the China Center for Type Culture Collection on July 1, 2024, with a deposit number of CCTCC M 20241449.

[0008] In order to achieve the above technical effects, the present invention also provides a microbial composite preparation, characterized in that the microbial composite preparation contains the Bacillus altitudinis WR10.

[0009] Furthermore, the effective active ingredient of the microbial composite preparation is the fermentation liquid or fermentation filtrate of Bacillus saltitudinis WR10.

[0010] Furthermore, the culture medium of the fermentation broth of Bacillus altitudinis WR10 is LB liquid culture medium.

[0011] In order to achieve the above technical effects, the present invention also provides the use of Bacillus subtilis with yield-increasing and stress-resistant functions or the microbial composite preparation in promoting plant growth.

[0012] Furthermore, the plant includes but is not limited to wheat.

[0013] In order to achieve the above technical effects, the present invention also provides the use of Bacillus or microbial composite preparations with yield-increasing and stress-resistant functions in alleviating soil phosphorus deficiency or high salt stress environments.

[0014] Furthermore, the environment includes but is not limited to a soil environment.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. The Bacillus altitudinis WR10 of the present invention has fast growth, a wide enzyme system, and salt tolerance, and is easy to culture in large volume and at low cost; it can not only increase the bioavailability of phosphorus in the soil, but also alleviate the stress of high salt on plants.

[0017] 2. The highland Bacillus WR10 of the present invention can also degrade phytic acid in the soil, increase the phosphorus content of wheat plants, and significantly improve indicators such as the fresh weight and dry weight of wheat seedlings, greatly promoting the growth of wheat in adverse conditions and increasing wheat yield in the field. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a picture of the colony streaking of Bacillus WR10 on the LB plate in Example 1;

[0019] Figure 2 This is a Gram staining photograph of Bacillus subtilis WR10 cells in Example 1;

[0020] Figure 3 This is a scanning electron microscope photograph of Bacillus subtilis WR10 cells in Example 1;

[0021] Figure 4 This is a phylogenetic tree diagram of Bacillus WR10 based on the gyrB gene in Example 1;

[0022] Figure 5 This is a statistical diagram of the growth of Bacillus WR10 at different salt concentrations in Example 2;

[0023] Figure 6 This is a statistical chart of wheat grain germination rate under different concentrations of salt stress by Bacillus WR10 in Example 3;

[0024] Figure 7 This is a photo of the dissolution zone around the colony of the plate test of the phosphate solubilization ability of Bacillus subtilis WR10 in Example 4;

[0025] Figure 8 This is a statistical chart showing that Bacillus WR10 in Example 5 increases the biomass of wheat seedlings under phosphorus deficiency stress. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below in conjunction with the embodiments. However, it should not be understood that the scope of the above subject matter of the present invention is limited to the following embodiments, and all technologies realized based on the content of the present invention belong to the scope of the present invention.

[0027] Example 1

[0028] Screening, identification, observation and preservation of Bacillus subtilis WR10

[0029] (1) Screening and dyeing

[0030] Bacillus altaica can be isolated from high-altitude sediments or healthy wheat root tissue. Taking isolation from wheat as an example, healthy wheat seedlings can be collected, the root surface can be rinsed with water, and then ultrasonically cleaned for 5 minutes. Cut 0.5 clean roots into small pieces and put them in a mortar, add 5mL of deionized water and grind them into juice. Transfer 1mL of juice to a 2mL centrifuge tube and boil for 5 minutes. Pipette 100μL to coat the LB solid plate and culture it at 30℃ for 12h to form milky white, round, moist colonies, such as Figure 1 A single colony was picked from the plate and inoculated into LB liquid medium containing 5 mM FeSO4. It could grow well and reach a stable phase in 12 hours, with fast growth.

[0031] Take 10μL of the strain from the glycerol tube, streak it on the LB solid plate, and culture it at 30℃ for 12h. Pick the colony in the central area of ​​the slide, add 1 drop of water to dilute it, and go through the four steps of primary staining with ammonium oxalate-crystal violet staining, mordanting with iodine solution, decolorizing with 75% ethanol, and counterstaining with safranin in sequence. Observe under a microscope and record the staining results; pick the purified and stained single colony from the LB solid culture medium plate to the sterile LB liquid culture medium, culture it at 200r / m and 30℃ for 24±2h, shake it evenly, mix 40% sterile glycerol with the bacterial solution at a volume ratio of 1:1, divide it into sterile sterile tubes, mark it and store it in a -80℃ refrigerator.

[0032] (2) Molecular identification of strains

[0033] Take the plate containing the corresponding numbered strains out of the 4°C refrigerator, pick a single colony as a DNA template, and perform PCR amplification. Since 16S rRNA cannot effectively distinguish different Bacillus, select the gyrB gene for amplification, sequencing, and sequence alignment. The specific operations are as follows:

[0034] ① Amplification system 50μL:

[0035] The 50 μL system consists of the following five parts: 2x Taq enzyme Mix, upstream primer gyrBF (1 μL), downstream primer gyrBR (1 μL), DNA template (1 μL), and ddH2O (22 μL);

[0036] The gyrBF sequence is: 5'-TTATCTACGACCTTAGACG-3', and the gyrR sequence is: 5'-TAAAGTGAAGTCTTCTCCG-3'.

[0037] The length of the amplified fragment is 992 bp, and the amplified nucleotide sequence is shown in SEQ ID NO: 1:

[0038] SEQ ID NO: 1

[0039] TTATCAACAATTCAAACGCGGTGTTCCAGTTGGAGATTTAGAGATCATC

[0040] GGTGAAACAGATGTAACAGGG

[0041] ACAACCACTCATTTTGTGCCAGATCCAGAAATTTTCACTGAAACCATTG

[0042] AATTTGATTACGACACACTTG

[0043] CTAACCGTGTACGTGAGTTAGCTTTCTTAACAAAAGGCGTCAACATCAT

[0044] CATTGAAGACTTACGTGAAGG

[0045] CAAAGAACGAAGAAACGAATACTGCTATGAAGGCGGTATTAAGAGCTA

[0046] TGTAGAACATTTGAATCGCTCG

[0047] AAGGAAGTCGTTCATGAAGAACCAGTTTACATCGAGGGTGAAAAGA

[0048] CGGAATCACCGTTGAAGTTGCAC

[0049] TGCAATACAACGATTCCTATACAAGCAATATTTATTCTTTGCCAATAAC

[0050] ATCAACACATATGAAGGTGG

[0051] ATCACACGAAGCTGGCTTTAAACCGGTCTGACGCGTGTCATCAATGA

[0052] TTATGCTCGTAAAAATGGCGTA

[0053] TTCAAAGATGGTGACTCGAATTTGAGCGGAGAAGATGTACGAGAAGG

[0054] CTTAACAGCCATTATCTCTATCA

[0055] AACATCCAGACCCTCAATTTGAGGACAAACGAAGACAAAGCTCGGT

[0056] AACTCAGAAGCAAGAACCATTAC

[0057] CGACTCCCTTCTCTCGAAGCACTTGAGAAATTCCTCTTAGAGAACCC

[0058] TGATGCTGCAAAGAAAATTGTG

[0059] GAGAAAGGTGTGATGGCAGCTCGTGCAAGAATGGCTGCCAAAAAGGC

[0060] ACGTGAGCTGACAAGACGTAAAA

[0061] GTGCACTGGAAGTCTCTAGCTTGCCTGGGAAACTGGCAGACTGTTCTT

[0062] CTAAAGATCCTTCCATCTCTGA

[0063] GCTTTATATCGTAGAGGGAGATTCTGCGGGCGGATCTGCTAAGCAAGGT

[0064] CGTGATCGACATTTCCAAGCG

[0065] ATCTTACCGTTAAGAGGGAAGATCCTAAACGTTGAAAAAGCCCGACTA

[0066] GATAAAATTTTATCTAACAACG

[0067] AGGTTCGTTCAA

[0068] ②Amplification conditions

[0069] Pre-denaturation temperature: 105°C

[0070] First step denaturation: 95℃, 5min; 95℃, 30s

[0071] Second step annealing: 55℃, 30s

[0072] The third step extension: 72℃, 60s

[0073] Cycle times: 95°C, 30s, 35 cycles

[0074] Step 4: Final extension: 72°C, 5 min

[0075] Step 5: Hold: 8℃, 10min

[0076] ③ Agarose gel electrophoresis

[0077] Weigh 1g agarose and dissolve it in 100mL TBE electrophoresis buffer. Heat in a microwave until the solution is clear and transparent. Add 1‰ GelRed nucleic acid dye, shake evenly, let it stand until there are no bubbles, slowly pour it into the gel plate, let it stand for about 1h, take out the solidified gel block and place it in the electrophoresis tank, add 4μL PCR amplification product to each gel well, run the gel at 120V for 20min, take out the gel block and place it in a gel imager, select UV light and take pictures, record the corresponding sample number with a clear band at about 1000bp on the gel block, and place the remaining PCR amplification product of the sample in a 4℃ refrigerator.

[0078] ④DNA purification

[0079] The PCR amplification product stored in the 4°C refrigerator was taken out and the PCR product was purified using the PCR Cleanup Kit nucleic acid purification kit.

[0080] ⑤Sequence identification

[0081] The resuspended DNA obtained in the above steps was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing, and the sequence returned by email was input into the sequence search column of the NCBI website for retrieval, and representative sequences were selected for phylogenetic analysis. The results showed that the strain WR10 provided by the present invention had the highest similarity (99%) with Bacillus altitudinis Strain 41KF2b, so it was named Bacillus altitudinis WR10.

[0082] The plant endophytic Bacillus altitudinis WR10 strain was deposited in the China Center for Type Culture Collection on July 1, 2024, with a deposit address of: Address: Wuhan University, Wuhan, China, Postal Code 430072. The deposit number is CCTCC M 20241449, and the classification name is plant endophytic Bacillus altitudinis WR10 (Bacillus altitudinis WR10).

[0083] The cell morphology of Bacillus WR10 with the deposit number of CCTCC M 20241449 is as follows Figure 2 and Figure 3 . Figure 2 The bacteria of WR10 observed under an optical microscope using an oil immersion lens were long rod-shaped and Gram-positive; Figure 3 As shown under an electron microscope, the length is 2.5μm to 3.0μm, the width is 1.5μm to 1.8μm, and it has flagella all over its body, and it can move. Figure 4As shown, by comparing the gyrB sequence of the strain WR10 of the present invention and making a phylogenetic tree for analysis, it was found that the strain was most closely related to Bacillusaltitudinis Strain 41KF2b.

[0084] Example 2

[0085] Determination of salt tolerance of Bacillus WR10

[0086] Pick a single WR10 colony and activate it in LB liquid culture medium. After activating it for 2 generations at a 5% inoculation rate, inoculate it into LB liquid test tubes containing different concentrations of NaCl (the experimental concentration conditions are: 0, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, or 14.0%, w / v) at a 1% inoculation rate, and culture it at 30°C and 150 rpm for 24 hours. Take 1 mL of the bacterial solution and dilute it 5 times. Measure the OD value (absorbance value) of the bacterial solution at a wavelength of 600nm, and measure it three times in parallel. Standardize the OD600 in the absence of NaCl to 100%, and calculate the relative biomass under different salt concentrations. Make a bar graph with salt concentration as the horizontal axis and relative absorbance as the vertical axis as shown in the following figure Figure 5 As shown. Figure 5 It can be seen that strain WR10 has good salt tolerance and can still obtain more than 80% of biomass in a culture medium with more than 2 M NaCl.

[0087] Example 3

[0088] The effect of WR10 on promoting wheat seed germination under high salt stress was tested using a hydroponic model:

[0089] First, soak wheat seeds (Zhoumai 26) in 75% ethanol for 10 minutes, and then rinse with sterile water for 3 times. Take 8 glass dishes with a diameter of 12 cm and divide them into four test groups, with two dishes in each test group; spread 3 filter papers in each glass dish, add 15mL of freshly prepared Hoagland Nutrient Solution (Hoagland Nutrient Solution, Solarbio, Cat.LB0140), and add 4M NaCl aqueous solution at the same time, so that the final concentration of NaCl is 0, 100mM, 200mM, and 400mM, respectively. Add the WR10 cell suspension cultured overnight to one dish in each test group, so that the final concentration is 10 6 cfu / mL, place the sterilized and rinsed seeds regularly on the filter paper, 25 seeds per dish. Place the dishes horizontally in a sealed bag and place them in an incubator at 20 degrees. After 5 days, take out the plate and count the relative germination rate (RGR) of each test group. The seeds are considered to have germinated when white sprouts visible to the naked eye appear. Figure 6It can be seen that in a low-salt environment (0-100mM NaCl), adding the high-salt Bacillus WR10 cells of the present invention has no obvious effect on the germination of wheat seeds, and the germination rate is above 98%. However, in a high-salt environment (200-400mM NaCl), the germination of wheat seeds is significantly inhibited, while the germination rate is significantly improved when the high-salt Bacillus WR10 cells of the present invention are added. For example, under 200mM salt stress, WR10 can increase the germination rate from 65% to 82%, and under 400mM salt stress, WR10 can increase the germination rate from less than 20% to 50%. This shows that the high-salt Bacillus WR10 of the present invention has great potential for improving saline-alkali land.

[0090] Example 4

[0091] Determination of phosphate solubilization ability of Bacillus WR10

[0092] This embodiment uses LB solid culture medium with different phosphorus sources added to visually measure the phosphorus solubilizing capacity. Specifically, add 0.05% (w / v) Ca3(PO4)2 or calcium phytate (Ca-phytate) to different LB solid culture media, sterilize at 120°C for 30 minutes, shake the culture medium until it cools to about 55°C, pour it into a plate for later use, and store it in a 4°C refrigerator if the time is long. Pipette 5μL of the WR10 bacterial suspension cultured overnight and vertically add it to the LB solid culture medium with different phosphorus sources, place it horizontally in an incubator, and culture it at 30°C for 24 hours for observation. Take pictures after the culture is completed to obtain the following Figure 7 The comparison diagram of the dissolution zone around the colony is shown, in which the size of the dissolution zone indicates the strength of the phosphorus dissolving ability. The results show that the bacterial agent of the present invention has obvious dissolution zones around the colonies, whether on a medium containing calcium phosphate or calcium phytate, indicating that it has strong phosphorus dissolving ability for both inorganic phosphorus and organic phosphorus. This shows that the highland Bacillus WR10 of the present invention has the ability to improve the bioavailability of insoluble phosphorus in the soil and can be used to promote plant phosphorus absorption.

[0093] Example 5

[0094] Test on the ability of Bacillus WR10 to hydrolyze insoluble phosphorus sources and promote the growth of wheat seedlings

[0095] This example uses a hydroponic model to evaluate the ability of WR10 to promote wheat growth by adding insoluble inorganic phosphorus and organic phosphorus sources under phosphorus deficiency conditions. Specifically, referring to Example 3, 3 filter papers were laid flat in each glass dish with a diameter of 12 cm, and 15 mL of freshly prepared 1 / 2 strength Hogland nutrient solution without phosphorus was added. Then, KH2PO3 solution was added to the dish marked as phosphorus deficiency condition (NC, negative control) to make the final concentration of phosphorus element 10 μM; KH2PO3 solution was added to the dish marked as normal phosphorus condition (PC, positive control) to make the final concentration of phosphorus element 500 μM; Ca3(PO4)2 dry powder was added to the dish marked as inorganic phosphorus condition to make the final concentration 250 μM; Calcium phytate (Ca-phytate) dry powder was added to the dish marked as organic phosphorus condition to make the final concentration 100 μM. Each marked plate was prepared in duplicate, and 1 mL of WR10 cell suspension cultured overnight was added to one of the plates (final concentration was 106 cfu / mL). Then 120 wheat seedlings that had germinated for 3 days and were in good condition and growing neatly were randomly transferred to the filter paper, 15 per plate. The culture medium was replaced every 2 days, and the root dry weight (RDW) of all wheat seedlings was counted after 2 weeks. Figure 8 As shown. Figure 8 It can be seen that the dry weight of wheat roots is significantly lower than normal when phosphorus is deficient, and WR10 has no significant effect on the dry weight of wheat roots in both cases. However, when an insoluble phosphorus source is present, whether it is inorganic Ca3(PO4)2 or organic calcium phytate, WR10 significantly increases the dry weight of wheat roots, and the average root weight of each seedling increases from 18±1.5mg to 26±2.3mg. Considering that most of the currently cultivated soils contain a large amount of insoluble phosphorus, the application of the highland Bacillus WR10 of the present invention has the ability to improve soil fertility and promote plant growth.

[0096] Example 6

[0097] Determination of enzyme production ability of Bacillus WR10

[0098] Different methods were used to qualitatively test the enzyme production capacity of the strains in this embodiment. Specifically, the determination of alkaline phosphatase, acid phosphatase, esterase, galactosidase, and glucosidase was determined using API ZYM colorimetric test tube kit (Bio Mérieux, Lyon, France). Nitroreductase and nitrite reductase activities were determined by API 20NE kit Bio Mérieux, Lyon, France). Phenotypic determinations of other enzymes were performed on plates with different substrates added. The catalase assay used 3% H2O2 as a substrate, the amylase assay used 2% soluble starch as a substrate, and the phytase assay used 0.05% calcium phytate as a substrate, all based on LB medium. The 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase assay was performed on DF basal medium using 3mMACC as a substrate. WR10 bacterial solution was inoculated and observed and recorded after different periods of culture. Some positive results of qualitative determinations are shown in Table 1:

[0099] Table 1 Statistics of enzymes related to stress resistance encoded by Bacillus WR10

[0100]

[0101]

[0102] The test results in Table 1 indicate that the Bacillus WR10 of the present invention has the function of synthesizing these enzymes and has multiple stress resistance and growth-promoting functions at the protein level.

[0103] Example 7

[0104] Experiment on the ability of Bacillus WR10 to increase wheat yield in the field

[0105] In 2023, a microbial yield-increasing experiment was conducted at wheat planting bases in different cities in Henan Province. Drones were used to spray wheat leaves in the early stage of grain filling. Two treatment groups were set up in the experiment. Treatment group 1 was sprayed with 1.5L LB liquid culture medium, which was the control group (CK); treatment group 2 was 1.5L overnight cultured Bacillus WR10 fermentation liquid (containing 1010cfu / mL live cells). Each treatment was 10 mu of land. The experiment started at the end of April and was mechanically harvested at the end of May. The test index after harvesting was the net weight of the grain. The specific index test results in 4 cities in Henan are shown in Table 2:

[0106] Table 2 Statistics on the effect of Bacillus WR10 on wheat yield in different regions

[0107]

[0108] The statistical results in Table 2 show that the application of Bacillus WR10 can promote wheat yield, with an average yield increase of 12.1% per mu and a net increase of 58.96 kg.

[0109] During the application process, the Bacillus altitudinis WR10 of the present invention can be directly applied to the soil alone or sprayed; or it can be compounded with other fertilizers, crop fertilizers or drugs to form a microbial composite preparation and applied to the soil, or sprayed, to promote plant growth or alleviate stress such as phosphorus deficiency and high salt in the growth environment.

[0110] It should be noted that the above embodiments are only described using wheat as an example, but the plants to which the bacterial agent or microbial composite preparation of the present invention can be applied include but are not limited to wheat; and the environment is not limited to the soil environment, and may also be various environments suitable for plant growth such as soilless cultivation.

[0111] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A strain of Bacillus subtilis with yield-increasing and stress-resistant functions, characterized in that: The Bacillus altitudinis is an endophytic Bacillus altitudinis WR10, i.e., Bacillus altitudinis WR10, which was deposited in the China Center for Type Culture Collection on July 1, 2024, with a deposit number of CCTCC M 20241449.

2. A microbial composite preparation, characterized in that: The microbial composite preparation comprises the Bacillus altitudinis WR10 described in claim 1.

3. The microbial composite preparation according to claim 2, characterized in that: The effective active ingredient of the microbial composite preparation is the fermentation liquid or fermentation filtrate of Bacillus altitudinis WR10.

4. Use of the highland Bacillus with yield-increasing and stress-resistant functions as claimed in claim 1 or the microbial composite preparation as claimed in claim 2 in promoting plant growth.

5. The use according to claim 4, characterized in that: The plants include, but are not limited to, wheat.

6. Use of the high-yield and stress-resistant Bacillus described in claim 1 or the microbial composite preparation described in claim 2 in alleviating soil phosphorus deficiency or high salt stress environment.

7. The use according to claim 6, characterized in that: The environment includes but is not limited to the soil environment.

Images