KASP labeled primer combination for germplasm resource identification of siberian wildrye and application

Abstract

The invention discloses a primer combination of a KASP marker for germplasm resource identification of siberian wildrye and application, belongs to the technical field of biology, the primer combination is used for amplifying 31 SNP loci, and specifically provides a KASP-SNP primer combination with nucleotide sequences shown as SEQ ID NO.1-93. The invention further provides a kit for detecting the siberian wildrye germplasm resource identification of the siberian wildrye germplasm resource identification of the siberian wildrye germplasm resource identification of the siberian wildrye germplasm resource identification method. The invention further provides a kit containing the primer combination and application, the kit can be used for identifying germplasm and variety of the siberian wildrye, and the primer combination has important application value in determining genetic background and variety right of siberian wildrye resources in agricultural production and variety breeding processes. The primer group is used for constructing a siberian wildrye germplasm genetic distance matrix and a phylogenetic tree to identify the genetic relationship of siberian wildrye germplasm resource individuals, and can be used for screening materials required by siberian wildrye research and utilization, such as core germplasm construction, breeding population screening, genetic diversity research and the like. The method provided by the invention has the advantages of high throughput, accuracy, low cost, simplicity in operation, manpower and material resource saving and the like, and has a very wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a primer combination and application of a KASP marker for identifying Elymus sibiricus germplasm resources. Background Art

[0002] Elymus sibiricus L. is the model species of the genus Elymus L., Triticeae, Poaceae. It is a perennial, allotetraploid grass (2n=4x=28, StStHH), widely distributed in Eurasia, and can form dominant and community-building species in meadow steppe communities. Elymus sibiricus not only has good forage quality, but also has strong adaptability and excellent disease resistance to adverse environments such as high altitude, cold, drought, and salinity. It is widely used in the restoration of degraded grassland vegetation and the establishment of high-yield artificial grassland in the Qinghai-Tibet Plateau and other high-altitude areas in western China. It is also an important gene bank for improving wheat crops and forages. Due to its high seed production potential, Elymus sibiricus is one of the few native grass species in the Qinghai-Tibet Plateau that has achieved large-scale seed production and commercial use.

[0003] The wild resources of E. sibiricum are widely distributed and have diverse habitats, including alpine meadows, forest meadows, shrubs, alpine canyons, river valley gravel beaches, etc. at an altitude of 1500 to 4900 meters. Affected by the climatic factors of different habitats, there are obvious phenotypic and genetic differences between wild populations of E. sibiricum, which provides rich genetic resources and diverse selection basis for the development and utilization of E. sibiricum germplasm. Carrying out the identification of wild populations is a prerequisite for the protection and utilization of E. sibiricum resources. At present, the evaluation of E. sibiricum germplasm resources and molecular level research on genetic diversity are only found in second-generation molecular markers such as AFLP, ISSR, SSR, and SRAP. These markers have cumbersome operation steps and cannot be automated. Moreover, it takes a long time and has high labor costs for large-scale sample testing. It is urgent to establish an accurate, efficient and economical method for identifying E. sibiricum germplasm to promote the protection, research and utilization of E. sibiricum genetic resources.

[0004] Competitive allele-specific PCR (KASP) technology is an automated, high-throughput molecular marker developed based on SNP and Indel sites. Based on the difference in the end sites of the marker, it uses dual-color fluorescence to detect the two genotypes of a SNP site, and can accurately perform biallelic typing detection on the target SNP in genomic DNA samples. As a new generation of SNP detection technology, KASP genotyping technology has the advantages of high accuracy, strong site adaptability and suitability for large sample detection. It has certain advantages in genetic stability, accuracy, specificity, flexibility, test cost and detection efficiency. It is one of the mainstream SNP typing tools for animal and plant genetic breeding in the world. KASP marker libraries for wheat, rice and other crop genomes have been established. These marker technologies have extremely high application value in crop genetic breeding research. At present, there are no reports on the development and application of KASP molecular markers for E. sibiricum. Summary of the invention

[0005] The purpose of the present invention is to provide a set of KASP marker primer combinations and applications for the identification of Elymus sibiricus germplasm resources, aiming to provide effective gene resources and molecular markers for genetic diversity research, core germplasm construction, breeding population selection, germplasm resources and variety rights protection of Elymus sibiricus.

[0006] To achieve the above object, the present invention provides, in a first aspect, a primer combination of KASP markers for identification of Elymus sibiricus germplasm resources. The primer combination is used to amplify 31 SNP sites, and the information of the sites is shown in Table 2.

[0007] The second aspect of the present invention provides a KASP-SNP primer combination for identifying Elymus sibiricus germplasm resources. The primer combination is shown in Sequence Listing 1 (SEQ ID NO.1-93). Each KASP-SNP primer set consists of a first forward primer, a second forward primer and a reverse primer, and genotyping of the corresponding SNP site is performed by competitive allele-specific PCR. The specific information of the primer set is shown in Table 1.

[0008] Furthermore, the 5' ends of the specific parts of the first forward primer and the second forward primer in each of the KASP-SNP primer sets are connected with different universal fluorescent label adapter sequences. Furthermore, the universal fluorescent label adapter sequence is selected from FAM and VIC.

[0009] Table 1. 31 KASP-SNAP primer combinations used to identify Elymus sibiricus germplasm (SEQ ID NO. 1-93)

[0010]

[0011]

[0012]

[0013] The third aspect of the present invention provides a kit, which comprises the KASP-SNP primer combination described in the second aspect of the present invention.

[0014] As an optional method, each primer in the above kit is packaged separately.

[0015] As an option, the kit further comprises reagents for competitive allele-specific PCR.

[0016] The fourth aspect of the present invention also provides the use of the KASP-SNP primer combination described in the second aspect of the present invention in any of the following aspects:

[0017] (1) Construct a DNA fingerprint database of standard Elymus sibiricus germplasm resources;

[0018] (2) construct a phylogenetic tree of Elymus sibiricus germplasm resources;

[0019] (3) High-throughput identification of the tested Elymus sibiricum germplasm and its relationship with the standard Elymus sibiricum germplasm.

[0020] Among them, the standard Elymus sibiricum germplasm was selected from 60 Elymus sibiricum germplasms in the Qinghai-Tibet Plateau, Northeast China, Northwest China and North China, Russia and Mongolia, representing the main distribution areas of wild Elymus sibiricum. The information of the standard Elymus sibiricum germplasm is shown in Table 3.

[0021] The fifth aspect of the present invention provides a DNA fingerprint database of standard sibiricum germplasm resources, which includes the genotypes (Table 7) obtained by accurate double allele typing of the 31 SNP sites (Table 2) described in the first aspect based on the KASP marker primer combination for identification of sibiricum germplasm resources described in the second aspect for each standard sibiricum germplasm. The standard sibiricum germplasm is selected from 60 sibiricum germplasms in the Qinghai-Tibet Plateau, Northeast China, Northwest China and North China, Russia and Mongolia, representing the main distribution areas of wild sibiricum. The standard sibiricum germplasm information is shown in Table 3.

[0022] The genotype of each standard Elymus sibiricum germplasm based on the above 31 SNP loci was determined as follows:

[0023] (1) Extracting genomic DNA from each standard Elymus sibiricus germplasm;

[0024] (2) using the genomic DNA of each standard Elymus sibiricus germplasm of step (1) as a template, and performing competitive allele-specific PCR using the KASP-SNP primer combination described in the second aspect or the kit described in the third aspect to obtain an amplified product;

[0025] (3) analyzing the fluorescence signals of the amplified products, and determining the genotypes of 31 SNP sites in a certain standard Elymus sibiricus germplasm genome based on the fluorescence signals of the amplified products obtained by each KASP-SNP primer set;

[0026] The method for determining the genotyping of 31 SNP sites in a certain standard Elymus sibiricum germplasm genome is as follows:

[0027] If the fluorescence signal displayed by a certain standard old wheat germplasm based on a certain SNP site is the same color as the fluorescence label adapter sequence of the first forward primer of the primer set for amplifying the SNP site, then the genotype of the standard old wheat germplasm based on the SNP site is the same base homozygous as the base at the corresponding position of the reference genome Chuancao No. 2 old wheat; if the fluorescence signal displayed by a certain standard old wheat germplasm based on a certain SNP site is the same color as the fluorescence label adapter sequence of the second forward primer of the primer set for amplifying the SNP site, then the genotype of the standard old wheat germplasm based on the SNP site is the same as the reference genome Chuancao No. 2 old wheat. The bases at the corresponding positions of Sichuan Cao No. 2 old sibiricum are different from the homozygous mutant bases; if the fluorescent signal displayed by a standard old sibiricum germplasm based on a certain SNP site is a mixed color of the color displayed by the fluorescent label adapter sequence of the first forward primer of the primer set for amplifying the SNP site and the color displayed by the fluorescent label adapter sequence of the second forward primer, then the genotype of the standard old sibiricum germplasm based on the SNP site is heterozygous, one base is the same as the base at the corresponding position of the reference genome Sichuan Cao No. 2 old sibiricum, and the other base is a mutant base different from the base at the corresponding position of the reference genome Sichuan Cao No. 2 old sibiricum.

[0028] The sixth aspect of the present invention provides a method for high-throughput identification of a test Elymus sibiricus germplasm or identification of its relationship with a standard Elymus sibiricus germplasm, comprising the following steps:

[0029] (1) extracting genomic DNA of the tested Elymus sibiricus;

[0030] (2) using the genomic DNA of step (1) as a template, and using the KASP-SNP primer combination described in the second aspect or the kit described in the third aspect to perform competitive allele-specific PCR to obtain an amplified product;

[0031] (3) analyzing the fluorescence signals of the amplified products, and determining the genotypes of the first to the thirty-first SNP sites in the tested E. sibiricum genome based on the fluorescence signals of the amplified products obtained by each KASP-SNP primer set;

[0032] (4) comparing the genotyping results of the first SNP site to the thirty-first SNP site in the genome of the tested E. sibiricum obtained in step (3) with the genotyping results of the first SNP site to the thirty-first SNP site in the genome of each standard E. sibiricum germplasm in the DNA fingerprint database of the fifth aspect; when the number of different SNP sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 2 or more, determining that the tested E. sibiricum germplasm does not belong to the standard E. sibiricum germplasm; when the number of different SNP sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 0 or 1, determining that the tested E. sibiricum belongs to the standard E. sibiricum germplasm or is suspected to be the standard E. sibiricum germplasm;

[0033] (5) If the tested E. sibiricum germplasm is not any of the standard E. sibiricum germplasms in the above DNA fingerprint database, identify the relationship between the tested E. sibiricum germplasm and the standard E. sibiricum germplasm. The specific method is as follows: based on the genotyping results of the tested E. sibiricum germplasm and the standard E. sibiricum germplasm in the DNA fingerprint database, a genetic distance matrix and a phylogenetic tree are constructed, and the relationship between the tested E. sibiricum germplasm and the standard E. sibiricum germplasm is identified based on the genetic distance and the clustering results in the phylogenetic tree; when the genetic distance between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is smaller, the relationship is closer and they are obviously clustered together in the phylogenetic tree; otherwise, the relationship is more distant.

[0034] In the present invention, the reaction procedure of competitive allele-specific PCR is: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, annealing and extension at 61-55°C for 1 minute, 10 cycles, and a decrease of 0.6°C per cycle; denaturation at 95°C for 20 seconds, annealing at 55°C for 60 seconds, and 27 cycles. After the PCR reaction is completed, the data is read. If the typing is not sufficient, amplification is continued. The amplification procedure is denaturation at 95°C for 20 seconds, annealing at 55°C for 60 seconds, and the typing is checked every 3 cycles until the typing is obvious.

[0035] The beneficial effects of the present invention compared with the prior art are as follows:

[0036] The invention provides a group of KASP-SNP molecular markers that can be used for identifying sibiricum resources and an application method thereof, which can identify sibiricum germplasm resources with high throughput, accuracy, stability, rapidity and low cost.

[0037] The present invention utilizes the reference genome and variant group big data of old sibiricum to develop a KASP-SNP primer combination with polymorphism in old sibiricum. The KASP-SNP primer combination provided by the present invention can be used to identify old sibiricum germplasm resources and varieties, and has important application value for clarifying the genetic background and variety rights of old sibiricum resources in agricultural production and variety selection; at the same time, it can be used for identification of individual kinship of old sibiricum germplasm resources, and provides effective gene resources and molecular markers for old sibiricum genetic diversity research, core germplasm construction, breeding population selection, etc. The present invention breaks through the gap of lack of KASP-SNP molecular markers in old sibiricum molecular research, solves the problems of cumbersome and time-consuming operation process of using AFLP, ISSR, SSR, SRAP and other markers in the current old sibiricum research, limited number of markers, difficulty in integrating detection data, and inability to achieve large-scale accurate detection, etc., realizes the full automation of reading detection data in the identification of old sibiricum resources, improves the accuracy of results and detection efficiency, and also avoids the generation of cross contamination and false positives. The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, saving manpower and material resources, and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the genotype diagram of 60 Elymus sibiricum germplasm populations detected by the KASP molecular marker of the present invention.

[0039] Markings in the figure: ■ indicates that the FAM fluorescence on the horizontal axis accounts for a higher proportion, which is homozygous type 1; ▲ indicates that the VIC fluorescence on the vertical axis accounts for a higher proportion, which is homozygous type 2; ● indicates that the proportions of the two fluorescence in the middle area are equal, which is a heterozygous type; ★ indicates a negative control (NTC); × indicates an undetected sample.

[0040] Figure 2 Phylogenetic tree constructed based on genotyping results of KASP markers for 60 Elymus sibiricus accessions. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] Example 1: SNP sites and KASP primer combinations for identifying old sibiricum resources

[0044] The present invention is based on the whole genome resequencing data of 90 E. sibiricum germplasms from the Qinghai-Tibet Plateau, Northeast China, Northwest China and North China, Russia and Mongolia. These 90 E. sibiricum resources cover the main distribution areas of wild E. sibiricum and represent a wide range of genetic diversity of E. sibiricum. They were compared with the E. sibiricum reference genome Chuancao 2 (assembled by the inventor's research group: https: / / www.biorxiv.org / content / 10.1101 / 2024.04.17.589894v1). A total of 80,148,422 high-quality SNPs were identified; 31 SNP sites that can be designed as KASP primers were screened, and finally 31 SNP sites were obtained (Table 2).

[0045] Table 2. Basic information of 31 SNP loci

[0046]

[0047]

[0048] The specific method is as follows:

[0049] 1. Core SNP site screening

[0050] Based on the whole genome resequencing data of 90 old wheat germplasms from the Qinghai-Tibet Plateau, Northeast China, Northwest China and North China, Russia and Mongolia, these 90 old wheat resources cover the main distribution areas of wild old wheat and represent a wide range of old wheat genetic diversity. A total of 80,148,422 high-quality SNPs were identified, which were aligned to the Sichuan Cao No. 2 old wheat reference genome using the software BWA (Burrows-WheelerAligner), and high-quality SNPs were identified using GATK (GenomeAnalysis Toolkit). The screening principles are:

[0051] (1) Specificity: To ensure that the selected SNP markers have high specificity, 200 bp of sequence upstream and downstream of each SNP were extracted, totaling 401 bp. Then, BLAST (Basic Local Alignment Search Tool) was performed to retain only those SNPs that could be uniquely aligned to the reference genome.

[0052] (2) Uniform distribution and high quality: Based on the premise that SNP markers are evenly distributed on the 14 chromosomes of E. sibiricum, SNPs with no missing genotype data were retained, and SNPs with minor allele frequency (MAF) lower than 20% were eliminated.

[0053] (3) Polymorphism information content (PIC): The PIC value of SNP loci was calculated using a Perl script, and loci with a PIC value less than 0.35 were eliminated.

[0054] (4) Hardy-Weinberg equilibrium: Use VCFtools software and set the parameters --max-missing 1 --maf 0.2 --hwe 0.01 to retain sites with p values ​​greater than 0.01 in the Hardy-Weinberg test.

[0055] (5) Uniqueness: Perl script was used to screen out SNP sites with no other site mutations within 100 bp before and after the marker. 52 core SNP sites were screened out.

[0056] 4. KASP-SNP primer design

[0057] For the 52 core SNP sites screened, 200 bp of the upstream and downstream sequences of the SNP were extracted to design and develop KASP primers. Two allele-specific primers and one universal primer were designed for each KASP target site, and competitive allele-specific PCR (KASP) was performed using Bio-Rad's CFXConnectTM real-time system. Finally, 31 core SNP sites were successfully converted into KASP markers (Table 1). Each KASP marker primer consists of two forward primers F1 and F2 with different terminal bases and a reverse primer R. The 5' end of the forward primer F1 is added with a universal fluorescent tag sequence FAM-tail: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.94), and the 5' end of the forward primer F2 is added with a universal fluorescent tag sequence VIC-tail: GAAGGTCGGAGTCAACGGATT (SEQ ID NO.95).

[0058] Example 2: Verification of the KASP-SNP primer combination developed in Example 1 and construction of a DNA fingerprint database of Elymus sibiricus germplasm based on 31 SNP loci

[0059] The basic information of the 60 tested E. sibiricum germplasms in this example is shown in Table 3. The 60 tested E. sibiricum germplasms were selected from the Qinghai-Tibet Plateau, Northeast China, Northwest China and North China, Russia and Mongolia in China, representing the main distribution areas of wild E. sibiricum.

[0060] Table 3. Basic information of 60 tested Elymus sibiricum germplasms

[0061]

[0062]

[0063]

[0064] Note: QTP: Tibetan Plateau population, NE: Northeast China population, NW: Northwest China population, NC: North China population, XJ: Xinjiang, GS: Gansu, SC: Sichuan, QH: Qinghai, XZ: Tibet, NM: Inner Mongolia, HB: Hebei.

[0065] 1. Extraction of genomic DNA from Elymus sibiricus germplasm

[0066] The genomic DNA of the tested E. sibiricum germplasm was extracted using a plant DNA extraction kit (DP350, Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the DNA concentration and purity were detected using a NanoDrop2000 UV spectrophotometer (Thermo Fisher Scientific, MA, USA).

[0067] 2. KASP tag verification

[0068] (1) Newly synthesized primers were diluted to 10 μM with TE (pH 8.0), and then mixed in a ratio of 1:1:3 for forward typing primer F1: forward typing primer F2: downstream universal primer. 1.25 μL of primer mixture was added to every 5 μL of reaction system.

[0069] (2) DNA sample dilution and addition: The genomic DNA sample of the tested Elymus sibiricum germplasm was diluted to a single-digit ratio according to the lowest concentration of the sample, and the entire batch of samples was diluted. Each 5 μL reaction system contained 1.25 μL of the diluted DNA sample.

[0070] (3) Construction of PCR reaction system (96-well plate) see Table 4;

[0071] Table 4 PCR reaction system

[0072] Reagents 5μL reaction system 2*KASP master mix 2.5μL Mixed primers 1.25μL DNA template 1.25μL water 0μL total 5μL

[0073] (4) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed.

[0074] (5) After centrifugation, PCR amplification was performed, and the amplification procedure was as shown in Table 5;

[0075] Table 5 PCR amplification program

[0076]

[0077] step temperature time Number of cycles 1 95℃ 20sec 3 55℃ 60sec

[0078] (6) If the typing result is not ideal, continue amplification. The amplification program is as shown in Table 6. Check the typing status every 3 cycles until the typing is obvious.

[0079] Table 6 PCR reaction conditions

[0080] (7) After completing the above steps, when the temperature of each PCR amplification product drops below 25°C, the fluorescence value is read by scanning the FAM and VIC beams of the microplate reader. The present invention uses an Omega Fluorostar scanner

[0081] The signals of both FAM and VIC fluorescent groups were detected by PCR (BMG Labtech, Ortenberg, Germany), and the genotyping data were analyzed using Kluster Caller software (LGC Genomics, Beverly, MA, USA).

[0082] Among the above 60 tested E. sibiricum germplasms, the genotype of each germplasm at each of the above 31 SNP sites constitutes the standard E. sibiricum germplasm resource DNA fingerprint database based on 31 SNP sites of the present invention (Table 7). This database can be used to identify whether an E. sibiricum germplasm of unknown genetic background belongs to the above 60 tested E. sibiricum germplasms or to which specific germplasm it belongs.

[0083] The results of SNP typing of some primer sets for the tested Elymus sibiricus germplasm are shown in Figure 1 .

[0084] The results showed that 31 primer sets can obtain good typing results in 60 tested old wheat germplasms. The 60 old wheat germplasms were divided into 3 genotypes. The sample genotypes clustered near the X-axis were genotypes connected to the FAM fluorescent label sequence, and the sample genotypes clustered near the Y-axis were genotypes connected to the VIC fluorescent label sequence, both of which were homozygous genotypes; the two types of fluorescence in the middle area accounted for a similar proportion, indicating a heterozygous genotype, and the square close to the origin was the negative control NTC, which was always clustered together and close to the base and did not produce a fluorescent signal. It can be seen that the primer combination developed in Example 1 can be applied to the identification of old wheat germplasm.

[0085]

[0086]

[0087]

[0088] Example 3 Identification of the tested Elymus sibiricum germplasm and its genetic relationship with the standard Elymus sibiricum germplasm

[0089] This example provides a method for detecting whether the tested Elymus sibiricum germplasm belongs to the germplasms of 60 tested Elymus sibiricum germplasms and identifying its genetic relationship with the standard Elymus sibiricum germplasm.

[0090] 1. Extraction of genomic DNA from Elymus sibiricus germplasm to be tested

[0091] According to the method of step 1 in Example 2, the "leaves of the tested Elymus sibiricum germplasm" were replaced with "leaves of the tested Elymus sibiricum germplasm", and the other steps remained unchanged to obtain the genomic DNA of the tested Elymus sibiricum germplasm.

[0092] 2. Configuration of SNP primers and PCR reaction system

[0093] According to the method of step 2 in Example 2, the "genomic DNA of the tested Elymus sibiricum germplasm" was replaced with the "genomic DNA of the tested Elymus sibiricum germplasm", and the other steps remained unchanged to obtain the PCR product of the tested Elymus sibiricum germplasm.

[0094] 3. Fluorescence signal detection

[0095] The PCR products of the tested Elymus sibiricus germplasm were taken for fluorescence signal analysis, and the genotypes of 31 SNP loci were obtained.

[0096] The genotypes of the 31 SNP loci of the tested Elymus sibiricum germplasm were compared with the genotypes of the 31 SNP loci of the 60 tested Elymus sibiricum germplasms (Table 7), and the number of different SNP loci between the tested Elymus sibiricum germplasm and the 60 standard Elymus sibiricum germplasms was counted, and then the following judgment was made:

[0097] If the number of difference sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 2 or more, the tested E. sibiricum germplasm and the standard E. sibiricum germplasm belong to different E. sibiricum germplasms; the more the number of difference sites, the more distant the genetic relationship.

[0098] If the number of difference sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 1 or 0, the tested E. sibiricum germplasm and the standard E. sibiricum germplasm are or are suspected to be the same E. sibiricum germplasm.

[0099] Furthermore, if the tested E. sibiricum germplasm is not any of the standard E. sibiricum germplasms in the above DNA fingerprint database, the genetic relationship between the tested E. sibiricum germplasm and the standard E. sibiricum germplasm can be identified. The specific method is as follows: Based on the genotyping results of the tested E. sibiricum germplasm and the standard E. sibiricum germplasm in the DNA fingerprint database, the distance matrix between individuals is calculated based on SNP using MEGAX software, and the phylogenetic tree is constructed using the neighbor-joining method ( Figure 2 ), and 1000 bootstrap repetitions were performed. The population structure was analyzed using Admixture software (v1.3.0). The genetic relationship between the tested E. sibiricum germplasm and the standard E. sibiricum germplasm was identified based on the genetic distance and the clustering results in the phylogenetic tree. The smaller the genetic distance between the tested E. sibiricum germplasm and a certain standard E. sibiricum, the closer the genetic relationship is, and they are obviously clustered together in the phylogenetic tree. Conversely, the genetic relationship is more distant.

[0100] Furthermore, the materials required for the research and utilization of Elymus sibiricus germplasm can be screened based on the above-mentioned kinship, such as: core germplasm construction, breeding population selection, genetic diversity research, etc.

[0101] The above specific description of the present invention is only used to illustrate the present invention and is not limited to the technical solutions described in the embodiments of the present invention. Those skilled in the art should understand that the present invention can still be modified or replaced by equivalents to achieve the same technical effects; as long as the use requirements are met, they are within the protection scope of the present invention.

Claims

1. A primer combination of KASP markers for identification of Elymus sibiricus germplasm resources, characterized in that: The primer combination is used to amplify 31 SNP sites. The basic information of the 31 SNP sites is shown in the following table: Basic information of 31 SNP loci 2. The primer combination according to claim 1, characterized in that The primer combination is a KASP-SNP primer combination, the nucleotide sequences of the primers in the primer combination are shown in SEQ ID NO.1-93, and are used to amplify the 31 SNP sites, wherein each KASP-SNP primer set consists of a first forward primer, a second forward primer and a reverse primer.

3. The primer combination according to claim 2, characterized in that: The 5' ends of the specific parts of the first forward primer and the second forward primer in each primer set are connected with different universal fluorescent label adapter sequences.

4. The primer combination according to claim 3, characterized in that: The universal fluorescent tag linker sequences are FAM and VIC.

5. A kit, characterized in that: It comprises the primer combination according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit also includes reagents for competitive allele-specific PCR.

7. Use of the primer combination according to any one of claims 2 to 4, characterized in that: Use of the primer combination according to any one of claims 2 to 4 in any of the following aspects: (1) Construct a DNA fingerprint database of standard Elymus sibiricus germplasm resources; (2) construct a phylogenetic tree of Elymus sibiricus germplasm resources; (3) Construct a DNA fingerprint database of standard Elymus sibiricum germplasm resources and conduct high-throughput identification of the Elymus sibiricum germplasm to be tested and its relationship with the standard Elymus sibiricum germplasm.

8. A DNA fingerprint database of standard Elymus sibiricus germplasm resources, characterized in that: The genotype obtained by accurate double allele typing of the 31 SNP sites of each standard sibiricum germplasm based on the primer combination described in claim 2 is a DNA fingerprint database of standard sibiricum germplasm resources.

9. A method for high-throughput identification of Elymus sibiricus germplasm, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of the tested Elymus sibiricus; (2) using the genomic DNA of step (1) as a template, and performing competitive allele-specific PCR using the primer combination of claim 2 or the kit of claim 5 to obtain an amplified product; (3) analyzing the fluorescence signals of the amplified products, and determining the genotype of the 1st to 31st SNP sites in the tested E. sibiricum genome based on the fluorescence signals of the amplified products obtained by each KASP-SNP primer set; (4) comparing the genotyping results of the 1st to 31st SNP sites in the genome of the tested E. sibiricum obtained in step (3) with the genotyping results of the 1st to 31st SNP sites in the genome of each standard E. sibiricum germplasm in the DNA fingerprint database according to claim 8; when the number of different SNP sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 2 or more, determining that the tested E. sibiricum germplasm does not belong to the standard E. sibiricum germplasm; when the number of different SNP sites between the tested E. sibiricum germplasm and a certain standard E. sibiricum germplasm is 0 or 1, determining that the tested E. sibiricum belongs to the standard E. sibiricum germplasm or is suspected to be the standard E. sibiricum germplasm.

Images