Molecular marker for detecting protein content of wheat grains and application of molecular marker

Abstract

The invention belongs to the technical field of molecular marker detection, and particularly relates to a molecular marker for detecting the protein content of wheat grains and application of the molecular marker. The method comprises the following steps: detecting g.34 Ggt in a wheat grain protein content regulating gene TaGPC-6A; the site A is the 123rd nucleotide of SEQ ID NO: 1, and the type of the nucleotide is G or A. The invention further provides a method for identifying or assisting in identifying the protein content character of the wheat grains. The method comprises the following steps: detecting to-be-detected wheat g.34 Ggt; the genotype of the A site is g.34 Ggt; the to-be-detected wheat with the genotype of AA at the site A is high-protein wheat, and the grain protein content of the to-be-detected wheat is higher than that of the to-be-detected wheat with the genotype of GG. According to the invention, a dCAPS labeled primer pair is developed and is used for efficiently screening the protein content of wheat grains. The molecular marker provided by the invention can be used for detecting the genotype of TaGPC-6A, is applied to wheat grain protein content improvement breeding, and can greatly improve the breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker detection, and in particular relates to a molecular marker for detecting the protein content of wheat grains and an application thereof. Background Art

[0002] Wheat is one of the important food crops, providing about 20% of the calories and protein needed by humans. Grain protein content is one of the important quality indicators of wheat, and improving it will help improve the nutritional quality and processing quality of wheat. Strengthening basic research on the protein content of wheat grains will help cultivate high-quality special wheat varieties suitable for making foods such as bread or biscuits. The protein content of wheat grains is affected by both genetic factors and external environmental conditions. Because it is greatly affected by environmental effects and a large amount of seed samples are required for measurement, it is impossible to effectively measure and screen in the low generations of breeding, resulting in low accuracy and efficiency when using traditional breeding methods to select protein content.

[0003] In recent years, the rapid development of wheat functional genomics and molecular markers has provided opportunities for genetic improvement of wheat grain protein content. Molecular markers can be used to effectively identify genetic loci related to wheat grain protein content at the genetic level, and the use of molecular marker-assisted selection strategies for genetic improvement of wheat grain protein content can greatly improve breeding selection efficiency, thereby shortening the breeding period. Summary of the invention

[0004] The invention provides a molecular marker for detecting the protein content of wheat grains. The marker can be used for identifying or screening the protein content of wheat grains, thus providing more options for improving wheat quality.

[0005] In a first aspect, the present invention provides a product for detecting the g.34G>A site within the TaGPC-6A gene, the product comprising:

[0006] (1) A primer composition for detecting the genotype of the g.34G>A site within the TaGPC-6A gene, wherein the g.34G>A site is a SNP site within the TaGPC-6A gene in the wheat genome, which is the 123rd nucleotide of SEQ ID NO: 1, and the nucleotide type thereof is G or A; the primer composition comprises:

[0007] SNP34-F: 5'-AAGGCGTACTTGCGTGAGGTC-3';

[0008] SNP34-R: 5'-TGGCAAGCCTGGAGAAGATGG-3';

[0009] (2) A reagent or kit comprising the primer combination described in (1). The reagent or kit also includes restriction endonuclease Sac II or a sequencing reagent.

[0010] The second aspect of the present invention provides the use of the above product in any of the following:

[0011] (1) Identify the g.34G>A allele within the wheat TaGPC-6A gene;

[0012] (2) Identify or assist in identifying the protein content of wheat grains;

[0013] (3) screening or assisting in screening wheat plants, strains, lines or varieties with high wheat grain protein content;

[0014] (4) preparing a product for identifying or assisting in identifying or comparing the protein content of wheat grains to be tested;

[0015] (5) Molecular marker-assisted selection breeding of wheat.

[0016] The third aspect of the present invention provides a method for identifying the allele type of the g.34G>A site within the TaGPC-6A gene, which specifically comprises the following steps: using the genomic DNA of the wheat variety / line to be tested as a template, and performing PCR amplification using the primer combination in the above product, wherein the length of the amplified product is 1210 bp;

[0017] The PCR amplification product is then digested with restriction endonuclease Sac II, followed by agarose gel electrophoresis and band type determination; the amplification product can be distinguished as two band types of 962 bp and 248 bp after digestion, with a GG allele type; the amplification product has only one band type of 1210 bp after digestion, with an AA allele type; or the PCR amplification product is sequenced to obtain the g.34G>A site allele type within the TaGPC-6A gene.

[0018] The present invention can identify or assist in identifying the protein content trait of the wheat grain to be tested based on the genotype of the wheat to be tested. Therefore, the fourth aspect of the present invention provides a method for identifying the protein content trait of wheat grains, comprising: obtaining the genotype of the wheat to be tested by using the above-mentioned method for identifying the g.34G>A site allele type within the TaGPC-6A gene, and then identifying or assisting in identifying the protein content trait of the wheat grain to be tested based on the genotype, wherein the grain protein content of the wheat to be tested whose g.34G>A site genotype is AA is higher than that of the wheat to be tested whose g.34G>A site genotype is GG; the genotype of GG indicates that the nucleotide type of the g.34G>A site in the wheat genome is a homozygous type of G; the genotype of AA indicates that the nucleotide type of the g.34G>A site in the wheat genome is a homozygous type of A.

[0019] A fifth aspect of the present invention provides a method for breeding new high-quality wheat varieties / lines, comprising the following steps:

[0020] (1) Using the above method to detect the allele type of the g.34G>A site within the TaGPC-6A gene in the candidate wheat breeding material;

[0021] (2) Select wheat breeding materials with the AA allele as the male / female parent for subsequent breeding.

[0022] Compared with the prior art, the main beneficial technical effects of the present invention are:

[0023] 1. The present invention utilizes the cloned wheat grain protein content regulating gene TaGPC-6A (SEQ ID NO: 1), and through analysis, it is found that the g.34G>A site inside it is significantly associated with the wheat grain protein content trait. On this basis, the present invention develops and converts the g.34G>A site into a dCAPS marker. Studies have shown that the dCAPS marker of the present invention can be used to detect the genotype of TaGPC-6A, and the method is simple and accurate.

[0024] 2. The present invention can be applied to wheat molecular marker-assisted selection breeding to achieve early screening of wheat grain protein content traits, which can greatly improve the efficiency of selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the haplotype analysis diagram of the TaGPC-6A gene in Example 1 of the present invention.

[0026] Figure 2 This is a comparison chart of grain protein content among the four haplotypes of the TaGPC-6A gene in Example 1 of the present invention.

[0027] Figure 3This is a diagram showing the result of enzyme digestion of the amplified products of the SNP34-F and SNP34-R primer pairs in Example 2 of the present invention. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution in the embodiment of the present invention will be clearly described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the reagents, carriers and other test materials involved are all commercially available conventional products unless otherwise specified; the test methods, detection methods, etc. involved are all conventional methods unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0030] Wheat materials involved in the embodiments:

[0031] A natural population consisting of 451 wheat varieties / lines was used for haplotype analysis of the wheat grain protein content regulatory gene TaGPC-6A and association analysis between the allele type of the g.34G>A site within the TaGPC-6A gene and the grain protein content phenotype.

[0032] Example 1 Discovery of SNPs Tightly Linked to Wheat Grain Protein Content Trait within Wheat Grain Protein Content Regulatory Gene TaGPC-6A

[0033] 1. Group planting

[0034] 451 wheat varieties / lines used for TaGPC-6A gene haplotype analysis and grain protein content phenotype determination were planted in the Yuanyang Research Base of Henan Agricultural University during the 2023-2024 growing season. A completely randomized block design was used. Each planting plot was 2m long and 1.5m wide. There were 12 rows in the plot. Each variety was planted in two rows, with single grains sown on demand. The spacing between plants in the rows and within the rows was 20cm and 10cm, respectively. The experimental fields were managed according to the standards. There was no drought, lodging, or pests and diseases during the entire growth period. After maturity and harvest, the crops were uniformly threshed, dried, and stored.

[0035] 2. Determination of grain protein content

[0036] The protein content of grains of 451 wheat varieties / lines was measured using a Perten DA7250 near-infrared analyzer (Perten, Sweden). To ensure the accuracy and reliability of the test results, each sample was repeated three times, and each repeated measurement was repeated three times. The average of the nine measured values ​​was taken as the final investigation value. The measurement results are shown in Table 1.

[0037] Table 1. Mean values ​​of grain protein content and genotypes of g.34G>A locus in 451 wheat varieties / lines

[0038]

[0039]

[0040]

[0041]

[0042]

[0043] 3. Haplotype analysis of the wheat grain protein content regulatory gene TaGPC-6A

[0044] Leaves of 451 wheat varieties / lines were sampled at the seedling stage, and the coding region of the TaGPC-6A gene was amplified after extracting genomic DNA, and then the amplified product was sequenced.

[0045] The specific steps are as follows:

[0046] ① DNA extraction: DNA of 451 wheat varieties / lines at the seedling stage was extracted using the SLS method.

[0047] The specific implementation steps are as follows:

[0048] (1) Take an appropriate amount of wheat leaves and put them into a 2 mL centrifuge tube containing steel balls, freeze them quickly in liquid nitrogen, grind them with a grinder, add 800 μL SLS, shake for 20 min, and mix them thoroughly; the SLS contains 288 mM NaCl, 200 mM Tris-HCl, 25 mM EDTA, and 0.5% SDS;

[0049] (2) Then add an equal volume of three-in-one solution (phenol: chloroform: isoamyl alcohol = 25:24:1);

[0050] (3) Oscillate for 10 min to mix thoroughly;

[0051] (4) Centrifuge at 12,000 rpm for 15 min, transfer the supernatant to another new 2 mL centrifuge tube, add an equal volume of pre-cooled isopropanol, and let stand for 10 min for precipitation;

[0052] (5) Centrifuge at 12,000 rpm for 15 min, discard the supernatant, add 0.5 mL of 75% (volume percentage) ethanol aqueous solution, and let stand for 5 min.

[0053] (6) Centrifuge at 12,000 for 5 min, discard the supernatant, dry under vacuum, and add 100 μL TE to dissolve the precipitate to obtain wheat leaf genomic DNA.

[0054] ②Amplification and sequence analysis of TaGPC-6A gene coding region

[0055] Design PCR primers, TaGPC-6A-F and TaGPC-6A-R are designed at the positions of the start codon ATG and the stop codon TAG, respectively. The specific information is as follows:

[0056] TaGPC-6A-F: 5'-ATGGAGGTGGAGTCTAGC-3';

[0057] TaGPC-6A-R: 5'-CACATGCGCACCTTCCAC-3'.

[0058] PCR amplification was performed using the DNA of 451 wheat varieties / lines as templates using the primer pair consisting of TaGPC-6A-F and TaGPC-6A-R. The PCR amplification system is shown in Table 2, and the PCR amplification program is shown in Table 3.

[0059] Table 2. PCR amplification system of TaGPC-6A gene using primer pairs composed of TaGPC-6A-F and TaGPC-6A-R

[0060] Components volume 2×Phanta buffer 25μL dNTP 1μL Phanta Enzyme 1μL Primer F 2μL Primer R 2μL DNA 2μL <![CDATA[ddH2O]]> To 50μL

[0061] Table 3. Primer pair consisting of TaGPC-6A-F and TaGPC-6A-R for PCR amplification of TaGPC-6A gene

[0062]

[0063] The PCR products were subjected to 1% agarose gel electrophoresis, and after the target band was detected and amplified, they were sent to Shanghai Bioengineering for sequencing.

[0064] The sequencing results were analyzed and the results were as follows Figure 1As shown in the figure, among the 451 wheat varieties / lines tested, there are 4 SNP sites in the coding region of the TaGPC-6A gene, which are located at the 19bp, 21bp, 34bp and 1297bp positions from the first start codon ATG in SEQ ID NO:1, and the TaGPC-6A gene can be divided into four haplotypes based on these 4 SNP sites, named Hap1, Hap2, Hap3 and Hap4. The four haplotypes of TaGPC-6A were analyzed in combination with the phenotypic values ​​of grain protein content, and the results are shown in the figure. Figure 2 As shown, the grain protein content of wheat varieties / lines with Hap3 type is significantly higher than that of the other three haplotypes. Further analysis found that the variable site g.34G>A located at the 34th bp from the first start codon ATG in SEQ ID NO:1 is a specific site that distinguishes Hap3 from the other three haplotypes, and this site is closely linked to the grain protein content.

[0065] Example 2 Development of dCAPS marker at g.34G>A site within TaGPC-6A gene

[0066] The sequence of the g.34G>A site inside the TaGPC-6A gene was analyzed, and it was found that the site was located on the recognition sequence of the restriction endonuclease Sac II. When the site was of the GG genotype, it could be recognized and cleaved by Sac II, but when the site was of the AA genotype, it could not be recognized by Sac II. Based on this, the dCAPS marker was developed. First, a specific primer pair SNP34-F and SNP34-R were designed based on the Chinese Spring reference genome sequence to amplify a DNA fragment containing the g.34G>A site. The length of the amplified fragment was 1210bp, and the sequence of the amplified product was shown in SEQ ID NO:2. The nucleotide sequence of the primer pair is as follows:

[0067] SNP34-F: 5'-AAGGCGTACTTGCGTGAGGTC-3';

[0068] SNP34-R: 5'-TGGCAAGCCTGGAGAAGATGG-3'.

[0069] DNA of some lines were randomly selected from 451 wheat varieties / lines and amplified using the above primer pairs. The PCR amplification system is shown in Table 4, and the PCR amplification procedure is shown in Table 5.

[0070] Table 4. PCR amplification system of the primer pair composed of SNP34-F and SNP34-R for the DNA fragment where g.34G>A is located

[0071] Components volume 10×Taqplus buffer 3μL dNTP 1μL Taq plus DNA Polymerase 1μL Primer F 1μL Primer R 1μL DNA 2μL <![CDATA[ddH2O]]> To 30μL

[0072] Table 5. PCR amplification procedure of the primer pair composed of SNP34-F and SNP34-R for the DNA fragment where g.34G>A is located

[0073]

[0074]

[0075] 20 μL of the amplified product was taken out and digested with restriction endonuclease Sac II at 37° C. The digestion reaction system is shown in Table 6.

[0076] Table 6. Reaction system of amplification products by primer pair SNP34-F and SNP34-R

[0077] Components volume PCR products 20μL 10×buffer 3μL Sac II 1μL <![CDATA[ddH2O]]> To 30μL

[0078] The above enzyme digestion products were subjected to 1% agarose gel electrophoresis to detect whether the DNA fragments amplified by the SNP34-F and SNP34-R primer pairs could be digested by enzymes. Figure 3 As shown in the figure, the DNA fragment of the wheat line with the GG genotype at the g.34G>A site can be successfully cut into two fragments of 962 bp and 248 bp in length, while the DNA fragment of the wheat line with the AA genotype at the g.34G>A site cannot be cut. This result shows that the dCAPS marker can be used to distinguish the allele type of the g.34G>A site.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A test TaGPC-6A The product of the g.34 G>A site within the gene is characterized by: The products include: (1) For detection TaGPC-6A Primer composition for the genotype of the g.34 G>A site within the gene, wherein the g.34 G>A site is a TaGPC-6A A SNP site within the gene is the 123rd nucleotide of SEQ ID NO: 1, and the nucleotide type is G or A; the primer composition comprises: SNP34-F :5’- AAGGCGTACTTGCGTGAGGTC -3’; SNP34-R :5'- TGGCAAGCCTGGAGAAGATGG -3'; (2) A reagent or kit comprising the primer composition described in (1).

2. Use of the product according to claim 1 in any of the following items, characterized in that: include: (1) Identification of wheat TaGPC-6A Allele type of g.34 G>A site within the gene; (2) Identify or assist in identifying the protein content of wheat grains; (3) Screening or assisting in the screening of wheat plants, strains, lines or varieties with high wheat grain protein content; (4) Preparing products for identifying or assisting in identifying or comparing the protein content of wheat grains to be tested; (5) Molecular marker-assisted selection breeding of wheat.

3. Identification TaGPC-6A The method for determining the allele type of the g.34 G>A site within a gene is characterized in that The steps include: Using the genomic DNA of the wheat variety / line to be tested as a template, PCR amplification is performed using the primer combination of the product of claim 1; Then, restriction endonucleases were used Sac II. The PCR amplification product was digested by enzymes, and then subjected to agarose gel electrophoresis to determine the band type. After digestion, the amplification product could be distinguished into two band types, 962 bp and 248 bp, with the GG allele type. After digestion, the amplification product had only one band type, 1210 bp, with the AA allele type. Alternatively, the PCR amplification product can be sequenced to obtain TaGPC-6A Allele type of g.34 G>A site within the gene.

4. A method for identifying the protein content of wheat grains, characterized in that: include: The method of claim 3 is used to obtain the genotype of the wheat to be tested, and then the genotype is used to identify or assist in identifying the protein content trait of the wheat grain to be tested; The grain protein content of the wheat to be tested whose genotype at the g.34 G>A site is AA is higher than that of the wheat to be tested whose genotype at the g.34 G>A site is GG.

5. A method for breeding new high-quality wheat varieties / lines, characterized in that: The steps include: (1) Using the method of claim 3 to detect the TaGPC-6A The allele type of the g.34 G>A site within the gene; (2) Select wheat breeding materials with the AA allele as the paternal / maternal parent for subsequent breeding.

Images