InDel molecular marker primer pair closely linked with eggplant peel green stripe gene and application of InDel molecular marker primer pair

Abstract

The invention discloses an InDel molecular marker primer pair closely linked with an eggplant peel green stripe gene and application of the InDel molecular marker primer pair. The nucleotide sequence of an upstream primer of the InDel molecular marker primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of a downstream primer of the InDel molecular marker primer pair is shown as SEQ ID NO.2. The primer pair disclosed by the invention can be used for identifying and screening the eggplant peel green stripe phenotype, and can be used for rapidly, accurately and effectively breeding eggplant varieties with eggplant peel green stripe characteristics, so that the crop breeding process is accelerated, and the breeding efficiency and success rate are improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an InDel molecular marker primer pair closely linked to an eggplant peel green stripe gene and an application thereof. Background Art

[0002] Eggplant (Solanum melongena L.), also known as Luosu, Kunlun melon, and Diaocaizi, belongs to the Solanum genus of the Solanaceae family (2n=2x=24). It is generally believed that the origin of eggplant may be Myanmar in Southeast Asia, India in South Asia, and surrounding countries in these tropical regions. Eggplant is widely grown in Africa, Asia, Central America, and the Mediterranean coastal areas. In contrast, the scale of eggplant cultivation in Europe and the United States is relatively small due to the lower latitude of cultivation and limited varieties. China ranks first in terms of total eggplant production and cultivated area, and eggplant occupies a major vegetable planting position in many parts of the country, accumulating a variety of eggplant germplasm resources.

[0003] As a vegetable of the Solanaceae family with abundant varieties, eggplant not only tastes good, but also has good medicinal value. For example, it contains antioxidants such as anthocyanins, lutein and zeaxanthin, which help reduce cell damage and prevent a variety of chronic diseases. Eggplant has different requirements for the appearance of its commercial fruit in different consumer regions. Therefore, when selecting varieties, it is necessary to consider whether these varieties can adapt to different market sales areas and different ecological conditions. For example, striped eggplants are very popular in South Asia and South America. In recent years, striped eggplants have also begun to appear in East Asia. Their market price is higher than that of ordinary eggplants, and consumer demand for them is rising. Although a large number of literatures have reported the mechanism by which chlorophyll affects the uniform coloring of eggplant peel, research on the formation of stripes caused by uneven distribution of pigments is still limited. Therefore, exploring the key regulatory genes of eggplant peel stripes is of great significance to promote the breeding of eggplant appearance quality.

[0004] Choosing the right molecular marker technology is crucial to improving the efficiency and accuracy of breeding. Molecular marker-assisted breeding technology develops molecular markers that are closely related to the target traits, conducts targeted testing and screening of plants at the genetic level, and achieves accurate selection of plants. Therefore, cloning the eggplant fruit grain green regulatory gene and developing functional markers that efficiently match the fruit grain trait have important theoretical and application value for breeding new eggplant varieties and realizing directional molecular design breeding of green fruit grains.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] The purpose of the present invention is to provide an InDel molecular marker primer pair closely linked to an eggplant peel green stripe gene and an application thereof, and the primer pair can be used to quickly and accurately identify the eggplant peel green stripes.

[0007] To achieve the above object, the present invention provides an InDel molecular marker primer pair tightly linked to the eggplant peel green stripe gene, the upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2.

[0008] SEQ ID NO.1, F: 5'-TTCTGGCTCTCTCACTAATCAAAT-3';

[0009] SEQ ID NO. 2, R: 5'-CATAAAGATTAAGTCAATGAGGAGAG-3'.

[0010] An InDel molecular marker tightly linked to an eggplant peel green stripe gene, wherein the InDel molecular marker uses eggplant genomic DNA as a template and amplifies the sequence using an InDel molecular marker primer pair;

[0011] The nucleotide sequence of the upstream primer of the InDel molecular marker primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2;

[0012] The nucleotide sequences amplified by the InDel molecular marker primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0013] A kit containing an InDel molecular marker primer pair or an InDel molecular marker.

[0014] An application of an InDel molecular marker primer pair or a molecular marker or a kit, comprising:

[0015] (1) Application in identifying green stripes on eggplant peel;

[0016] (2) Application of molecular marker-assisted breeding for green stripes on eggplant peel.

[0017] A method for identifying green stripes on eggplant peel comprises the following steps:

[0018] (1) Using the DNA of the eggplant material to be tested as a template, PCR amplification of SEQ ID NO.1-2 was performed using InDel molecular marker primers to obtain PCR products;

[0019] (2) Detect the amplified product by gel electrophoresis and observe the electrophoresis detection results.

[0020] Preferably, in the above technical solution, the PCR reaction system of step (1) is: in a 12 μL reaction system, 2 μL of DNA template solution, 5 μL of 2×Taq Mix, 1 μL of forward primer and 1 μL of reverse primer, the concentration is 10 uM / L, and the total volume is filled to 12 μL with 3 μL ddH2O;

[0021] PCR amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 30 cycles; extension at 72°C for 5 min.

[0022] The gel in step (2) is 8% non-denaturing polyacrylamide gel.

[0023] Preferably, in the above technical solution, the method for determining the electrophoresis detection result in step (2) is:

[0024] The InDel molecular marker primer amplified a 104 bp fragment, indicating that the eggplant sample to be tested was a variety with green skin and stripes;

[0025] The InDel molecular marker primer amplified a 94 bp fragment, indicating that the eggplant sample to be tested was a variety with pure green peel and no lines;

[0026] The InDel molecular marker primers simultaneously amplified fragments of 104 bp and 94 bp, indicating that the sample to be tested was a heterozygote.

[0027] Compared with the prior art, the present invention has the following beneficial effects: the InDel molecular marker primer pair and its application which are closely linked to the eggplant peel green stripe gene of the present invention, use the parents NO211, P13 and F1 to perform polymorphism screening on the developed Indel marker. After screening, it was found that the molecular marker GS-IDm4.01 has a stable polymorphism between the parents. Combined with the F1 test results, GS-IDm4.01 was judged to be a dominant marker, and the band amplified by the marker was clear, with obvious differences between the parents. According to the InDel molecular marker, the InDel primer sequence was designed, PCR amplification was performed, the test results were observed, and the green stripes on the eggplant peel were identified. The primers of the present invention can be used for the identification and screening of the green stripe phenotype of the eggplant peel, and can quickly, accurately and effectively select eggplant varieties with the characteristics of the green stripes on the eggplant peel, accelerate the crop breeding process, and improve the efficiency and success rate of breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1It is an electrophoresis diagram of the amplification results of the InDel molecular marker primer pair according to the present invention in the green streaked inbred line NO211, the pure green streakless inbred line P13 and their F1 generation; in the figure, P1 is NO211; P2 is P13; and F1 is the hybrid generation of NO211 and P13.

[0029] Figure 2 It is an electrophoresis diagram of the verification results of the InDel molecular marker primer pair according to the present invention in 22 eggplant germplasm materials with known peel phenotype of green stripes or not. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described in detail below in conjunction with the accompanying drawings, but it should be understood that the protection scope of the present invention is not limited by the specific implementation modes.

[0031] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.

[0032] 1. Acquisition of Molecular Markers

[0033] 1. Construction of positioning groups

[0034] The high-generation inbred lines NO211 and P13 were selected as the maternal (P1) and paternal (P2) parents, respectively, to construct genetically segregating populations (F1, BC1P1, BC1P2, and F2). The NO211 fruit is round with green stripes on the skin, while the P13 fruit is long and has a pure green skin without stripes. In addition, we sequenced and assembled the NO211 line to generate the first high-quality eggplant T2T genome as a reference genome for subsequent BSA resequencing. To identify candidate genes for green fruit stripes, an F2 population (6,539 individuals) was constructed by self-pollinating F1 plants. High-quality genomic DNA was isolated from leaves using the CTAB method.

[0035] 2. Molecular marker development

[0036] Based on the eggplant T2T genome assembled by our research group, we precisely located the candidate gene SmGLK that controls the green fruit pattern of eggplant. According to the BSA-seq results, Indel markers were developed at the variant sites in the upstream and downstream regions of the SmGLK gene. Some stable sites (generally 15bp≥differential base number≥3bp) were selected for primer design and PCR amplification.

[0037] 3. Obtaining the molecular marker GS-IDm4.01

[0038] The developed Indel markers were screened for polymorphism using the parents NO211, P13 and F1. After screening, it was found that the molecular marker GS-IDm4.01 had stable polymorphism between the parents. Combined with the F1 test results, GS-IDm4.01 was judged to be a dominant marker, and the bands amplified by the marker were clear and significantly different between the parents ( Figure 1 ).

[0039] like Figure 1 The results show that the DNA amplification product of molecular marker GS-IDm4.01 in the eggplant green grained inbred line NO211 is a 104 bp fragment, and the DNA amplification product in the eggplant pure green grainless inbred line P13 is a 94 bp fragment. The DNA amplification product of the F1 generation of NO211 and P13 hybrids contains fragments of 104 bp and 94 bp in size. The nucleotide sequences of the primer pair SEQ ID NO.1 and SEQ ID NO.2 of marker GS-IDm4.01 are as follows:

[0040] SEQ ID NO.1, F: 5'-TTCTGGCTCTCTCACTAATCAAAT-3';

[0041] SEQ ID NO. 2, R: 5'-CATAAAGATTAAGTCAATGAGGAGAG-3'.

[0042] The nucleotide sequence of NO211 (104 bp), SEQ ID NO.3 is as follows:

[0043] TTCTGGCTCTCTCACTAATCAAATCCATCCTTAAACTCTATATATAGTGACAACTTTAATATACCTAGACTTTTTTTTCTCTCCTCATTGACTTAATCTTTTAG

[0044] The nucleotide sequence of P13 (94 bp), SEQ ID NO.4 is as follows:

[0045] TTCTGGCTCTCACTAATCAAATCCATCCTTAATAGTGACAACTTTA ATATACCTAGACTTTTTTTTCTCTCCTCATTGACTTAATCTTTTAG

[0046] 2. Application of molecular marker GS-IDm4.01

[0047] 1. Test materials

[0048] The present invention uses 7 eggplant germplasms with green peels and 15 eggplant germplasms with pure green peels and no peels to verify the molecular marker GS-IDm4.01. The germplasm materials used can be obtained from the Agricultural College of Guangxi University.

[0049] 2. Test methods

[0050] The molecular marker GS-IDm4.01 was used to perform genotype detection on the above test materials, and the template was the genomic DNA of the above test materials.

[0051] PCR reaction system (12 μL): 2 μL of DNA template solution, 5 μL of 2×Taq Mix, 1 μL of forward primer and reverse primer each, with a concentration of 10 uM / L, and 3 μL of ddH2O to make up the total volume to 12 μL.

[0052] PCR amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 30 cycles; extension at 72°C for 5 min.

[0053] Subsequently, the amplified products were electrophoresed on 8% non-denaturing polyacrylamide gel, stained with 1% silver nitrate for 5 minutes, and then developed with a mixture of sodium hydroxide and formaldehyde, and finally observed and photographed. When the electrophoresis gel map was read, the same band type as 'NO211' was recorded as 'b', the same band type as 'P13' was recorded as 'a', and the hybrid containing both parental band types was recorded as 'h'.

[0054] 3. Test results

[0055] The electrophoresis results are as follows Figure 2 As shown, the molecular marker GS-IDm4.01 contains a fragment of 104bp in the PCR amplification products of the germplasms with green peel and stripes (1-7), and a fragment of 94bp in the PCR amplification products of the germplasms with pure green peel and stripes (8, 10-22), which is consistent with the phenotypic identification results of the green peel stripes (with / without) of the tested materials. The PCR amplification product of the germplasm with pure green peel and stripes (9) contains a fragment of 104bp. The marker genotype of the tested material is inconsistent with the phenotype of green peel stripes (with / without), which may be because the marker is closely linked to the gene but has not reached the level of co-segregation. The phenotype and genotype of the peel with / without green stripes of 22 eggplant germplasm resources were statistically analyzed, and the results are shown in Table 1:

[0056] Table 1 Statistics of phenotypes and genotypes of 22 eggplant germplasm resources with or without green stripes on the fruit skin

[0057]

[0058]

[0059] The above results show that the molecular marker GS-IDm4.01 of the present invention has strong specificity, and the detection accuracy rate reaches 95.5%, and can be used for the identification and screening of the presence or absence of green stripe phenotype in eggplant peel.

[0060] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. An InDel molecular marker primer pair tightly linked to the eggplant peel green stripe gene, characterized in that: The nucleotide sequence of the upstream primer of the InDel molecular marker primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. An InDel molecular marker tightly linked to the eggplant peel green stripe gene, characterized in that: The InDel molecular marker uses eggplant genomic DNA as a template and amplifies the sequence using the InDel molecular marker primer pair; The nucleotide sequence of the upstream primer of the InDel molecular marker primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; The nucleotide sequences amplified by the InDel molecular marker primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit comprising the InDel molecular marker primer pair according to claim 1 or the InDel molecular marker according to claim 2.

4. A use of the InDel molecular marker primer pair according to claim 1 or the molecular marker according to claim 2 or the kit according to claim 3, comprising: (1) Application in identifying green stripes on eggplant peel; (2) Application of molecular marker-assisted breeding for green stripes on eggplant peel.

5. A method for removing green stripes from eggplant peel, characterized in that: The following steps are involved: (1) Using the DNA of the eggplant material to be tested as a template, PCR amplification of SEQ ID NO.1-2 was performed using InDel molecular marker primers to obtain PCR products; (2) Detect the amplified product by gel electrophoresis and observe the electrophoresis detection results.

6. The method according to claim 4, characterized in that Step (1) PCR reaction system: In a 12 μl reaction system, 2 μl of DNA template solution, 5 μl of 2×Taq Mix, 1 μl of forward primer and 1 μl of reverse primer, with a concentration of 10 uM / L, and 3 μl of ddH2O were used to make up the total volume to 12 μl; PCR amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 30 cycles; extension at 72°C for 5 min. The gel in step (2) is 8% non-denaturing polyacrylamide gel.

7. The method according to claim 4, characterized in that The method for determining the electrophoresis detection result in step (2) is as follows: The InDel molecular marker primer amplified a 104 bp fragment, indicating that the eggplant sample to be tested was a variety with green skin and stripes; The InDel molecular marker primer amplified a 94 bp fragment, indicating that the eggplant sample to be tested was a variety with pure green peel and no lines; The InDel molecular marker primers simultaneously amplified fragments of 104 bp and 94 bp, indicating that the sample to be tested was a heterozygote.

Images