Primers and multiplex PCR method for identification of diploid D-genome cotton varieties

Abstract

The invention discloses a primer and a multiplex PCR method for identifying diploid D genome cotton species, and belongs to the field of molecular biology. The primers are composed of specific primers and control primers. The specific primer F1 / R1 can specifically identify the diploid D genome cotton species. The control primer F2 / R2 is designed according to the conserved region of the cotton species and is used to determine the availability of the cotton genome and the stability of the PCR reaction. The multiplex PCR method of the invention using F1 / R1 and F2 / R2 as primers can amplify two bands of 550 bp and 1200 bp in diploid cotton species and tetraploid cotton species of A, B, C, E, F, and G genomes. However, only one band of 1200 bp is amplified in 13 diploid cotton species of the D genome, so the D genome cotton species can be quickly identified, and can be used for rapid and accurate distinction with other genome cotton species, so as to solve the problem of confusing the D genome cotton species with other cotton species.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to primers and a multiplex PCR method for identifying diploid D genome cotton varieties. Background Art

[0002] Multiplex PCR (mPCR) is the process of adding more than two pairs of primers to a reaction system to simultaneously amplify multiple nucleic acid fragments. The basic principle of multiplex PCR is the same as that of conventional PCR, except that more than one pair of primers is added to the same reaction system. If there is a template complementary to each pair of primers, they will bind to the corresponding parts of the template and simultaneously amplify more than one target DNA fragment in the same reaction system. The steps of multiplex PCR are similar to those of conventional PCR, and basically follow the three stages of denaturation, annealing, and extension: (1) Denaturation of template DNA: After the template DNA is heated to about 94-95°C for a certain period of time, the double-stranded template DNA or the double-stranded DNA formed by PCR amplification is dissociated to become a single strand so that it can bind to the primer and prepare for the next round of reaction; (2) Annealing (renaturation) of template DNA and primer: After the template DNA is heated to denature into a single strand, the temperature is reduced to about 55-65°C (adjusted according to the primer Tm value), and the primer and the complementary sequence of the template DNA single strand are paired and bound; (3) Primer extension: The DNA template-primer complex is heated at 72°C and under the action of DNA polymerase (such as TaqDNA polymerase), with dNTP as the reaction raw material and the target sequence as the template, according to the principle of base complementary pairing and semiconservative replication, a new semiconservative replication chain complementary to the template DNA chain is synthesized.

[0003] Multiplex PCR technology is an improvement on conventional PCR, which can achieve the simultaneous amplification and comparison of multiple different fragments in the same reaction tube, saving time, reagents and samples. The composition of the multiplex PCR reaction system and the conditions of the PCR cycle need to be optimized to ensure the simultaneous amplification of several fragments. In theory, as long as the conditions for PCR amplification are suitable, the number of primer pairs can be unlimited. However, due to various restrictions, the number of primer pairs that can actually be amplified is limited, and it is impossible to optimize the reaction for only one pair of primers or target fragments. Therefore, the requirements for primer design are high, and non-specific amplification or the generation of primer dimers should be avoided as much as possible when designing primers. The primer sequence should correspond to its target sequence one by one as much as possible, and the size of the target fragment should be different so that it can be separated and identified by gel electrophoresis.

[0004] Cotton (Gossypium spp.) is an important crop related to the national economy and people's livelihood. The genus Gossypium includes 45 diploid species (2n=2×=26, A, B, C, D, E, F, G, K chromosome type) and 7 tetraploid species (2n=4×=52, AD1~AD7). In the long-term evolution of cotton adapting to various harsh conditions and environments, the genus Gossypium has formed extremely rich genetic diversity. From the perspective of evolutionary origin, tetraploid cotton species are allotetraploids formed by the hybridization of diploid A group cotton species and diploid D group cotton species. The importance of D genome cotton identification lies in that it can provide accurate molecular markers and gene resources, reveal genetic variation and excellent sites, resolve genome origin disputes, promote modern variety genome research, promote cotton fiber quality improvement, and support multi-trait synergistic improvement. These research results are of great significance to improving the economic value and social benefits of cotton. However, existing technologies cannot quickly distinguish diploid D genome cotton species from tetraploid cotton species. Summary of the invention

[0005] The purpose of the present invention is to quickly and conveniently identify diploid D group cotton species and other diploid A, B, C, E, F, G, K group cotton species or tetraploid cotton species (AD1~AD7), and then provide primers and multiplex PCR methods for identifying diploid D genome cotton species.

[0006] In order to achieve the above object, the technical solution of the present invention is:

[0007] In a first aspect, the present invention provides primers for identifying diploid D genome cotton varieties, which are composed of specific primers and control primers. The forward primer (F1) sequence of the specific primer is shown in SEQ ID No.1, the reverse primer (R1) sequence of the specific primer is shown in SEQ ID No.2, the forward primer (F2) sequence of the control primer is shown in SEQ ID No.3, and the reverse primer (R2) sequence of the control primer is shown in SEQ ID No.4.

[0008] In a second aspect, the present invention also provides the use of primers for diploid D genome cotton variety identification in diploid D genome cotton variety identification products.

[0009] In a third aspect, the present invention also provides a kit for identifying diploid D genome cotton varieties, comprising the primers for identifying diploid D genome cotton varieties according to claim 1.

[0010] In a fourth aspect, the present invention also provides a multiplex PCR method for identifying diploid D genome cotton species, comprising the following steps:

[0011] S1, using the above-mentioned primers for diploid D genome cotton species identification, PCR amplification is performed with the entire nuclear genome DNA of the cotton species to be tested as a template;

[0012] S2. Perform electrophoresis detection on the PCR amplification products: If a 1200 bp target product is obtained, the cotton species to be tested is a diploid D genome cotton species; if two bands are obtained, one is the 1200 bp target product and the other is the 550 bp target product, the cotton species to be tested is a diploid A, B, C, E, F, G genome cotton species or a tetraploid AD genome cotton species.

[0013] Furthermore, the PCR amplification system was as follows: 0.5 μL each of the forward primer and reverse primer of the identification primer, 0.5 μL each of the forward primer and reverse primer of the control primer, 0.2 μL of total DNA, 2× Taq plus Master Mix 12.5μL; reaction system is 25μL; PCR amplification program is: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 7 seconds; 30 cycles; 72℃ for 5 minutes and storage at 4℃.

[0014] Furthermore, the 2× Taq plus Master Mix by Taq Enzyme, dNTP, Buffer, Mix Taq The concentration of the enzyme was 2×, the concentration of dNTP was 1 mM, and the buffer consisted of 1000 mM KCl, 200 mM Tris-HCl, pH 8.3, and 30 mM MgCl2.

[0015] Furthermore, the electrophoresis is 1.5% agarose gel electrophoresis.

[0016] Compared with the prior art, the technical effects of the present invention are:

[0017] The multiple primers F1 / R1+F2 / R2 provided by the present invention, the specific primer F1 / R1 can specifically identify the diploid D genome cotton species, and the control primer F2 / R2 is designed according to the conservative region of the cotton species, and is used to determine the availability of the cotton genome and the stability of the PCR reaction. The multiple PCR method of the present invention, which combines F1 / R1 and F2 / R2 to form multiple specific primers, can amplify two bands of specific nucleotide sequences of 550 bp and 1200 bp in PCR with diploid cotton species and tetraploid cotton species of A, B, C, E, F, and G genomes as templates. However, there is only one band in the PCR with 13 diploid cotton species of the D group as templates, so it can quickly identify cotton species containing the D (sub) genome, which is used for rapid and accurate distinction with other genome cotton species, and solves the problem of confusing the DNA of the D (sub) genome cotton species with other cotton species in experimental work, and has important practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0019] Figure 1 The results of PCR testing on various cotton varieties using F1 / R1+F2 / R2 multiple primers. DETAILED DESCRIPTION

[0020] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The test materials used in the following embodiments are purchased from conventional biochemical reagent stores unless otherwise specified.

[0021] Example

[0022] The following PCR verification was performed using F1 / R1+F2 / R2 multiple primers and 34 cotton species DNA as templates.

[0023] 1 Materials and Methods

[0024] 1.1 Experimental Materials

[0025] The experimental material is the nuclear genomic DNA of each cotton species shown in Table 1, with a concentration of 100 ng / μL; the primers are specific primers designed in the intergenic region IGS (nad7-ccmb): F1: GCCAGCATACGATCTCGTATG (as shown in SEQ ID No.1); R1: CACATGGTTGTACTGGTCAGC (as shown in SEQ ID No.2); the control primer uses NCBI-Blast to select a conservative sequence as the control primer, and sequencing analysis is performed on it, which verifies that the primer can amplify bands in all 34 cotton species, verifying the validity of the 34 cotton genomes. The primer is named F2 / R2, and the sequences of F2 and R2 are shown in SEQ ID No.3 and SEQ ID No.4, respectively.

[0026] The primers were synthesized by Changchun Kumei Biotechnology Co., Ltd. and purified by PAGE. 2×Taq plus Master Mix (containing red dye) was produced by Biosharp. After PCR, no DNA loading buffer was needed for staining. 6 μL could be directly loaded and tested by electrophoresis.

[0027] 0.2 ml PCR tube; PCR instrument from Techne, UK; agarose gel was made of TAE containing 1.5% agarose, and the electrophoresis solution was 1×TAE; the nucleic acid dye Gelview was produced by Beijing Biotech Biotechnology Co., Ltd., and the electrophoresis instrument was produced by Beijing Junyi Company; the gel imaging instrument was SH-510 produced by Hangzhou Shenhua Technology Co., Ltd.

[0028] 1.2 Experimental methods

[0029] 1) Add DNA, two pairs of primers (F1 / R1, F2 / R2), and 2×Taq plus Master Mix according to the above system proportions into a 0.2 ml sterilized PCR tube, and the system volume is 25 μL;

[0030] 2) Centrifuge the 96-well plate, shake it, and after centrifugation, place it in a PCR instrument and run the above PCR process:

[0031] The PCR reaction system is as follows:

[0032]

[0033] The amount of dd H2O used in the above system depends on the concentration of the template DNA, where 2× Taq Plus Master Mix is ​​2x, which can be Taq It is composed of enzyme + dNTP + Buffer.

[0034] The PCR reaction process is as follows:

[0035] ,

[0036] 3) Take out the product and load the sample;

[0037] 4) Voltage: 120 V, current: 200 mA, electrophoresis time: 60 min;

[0038] 5) Take the glue and read the tape.

[0039] 2 Experimental results

[0040] The gel reading results showed that the F2 / R2 primer test proved that the DNA of 34 cotton species were available ( Figure 1 ); After the specific primers F1 / R1 and the control primers F2 / R2 were combined, the target bands (two bands) were produced in 21 cotton species including A, B, C, E, F, G, and AD groups, and only one band was produced in 13 cotton species of the D genome (G. thurberii, G. harkenissi, G. claustaki, G. davidsonii, G. upland, G. raymondii, G. pseudo-like, G. loose, G. lobate, G. schwantimann, G. horseradish, G. turnerii, G. trilobate). Figure 1 ). This allows the distinction between group D and other cotton species. Figure 1 The names of cotton species corresponding to each genome are shown in Table 1. Table 1 shows the information of 34 cotton species. Figure 1 Amplification results of each cotton species from left to right.

[0041] Table 1 Information on 34 types of cotton

[0042]

[0043] Table 2 Primer sequence list

[0044]

[0045] The above description of the disclosed embodiments is intended to enable those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. Primers for identifying diploid D genome cotton species, characterized in that: It consists of a specific primer and a control primer. The forward primer sequence of the specific primer is shown in SEQ ID No.1, the reverse primer sequence of the specific primer is shown in SEQ ID No.2, the forward primer sequence of the control primer is shown in SEQ ID No.3, and the reverse primer sequence of the control primer is shown in SEQ ID No.

4.

2. Use of the primers for diploid D genome cotton variety identification according to claim 1 in diploid D genome cotton variety identification products.

3. A kit for identifying diploid D genome cotton species, characterized in that: The invention comprises the primers for identifying diploid D genome cotton species as described in claim 1.

Images