A dsRNA and its application in preparing nano preparation for preventing and controlling pepper blight

Abstract

The invention discloses a dsRNA and its application in preparing a nano preparation for preventing and treating pepper blight, and relates to the technical field of pepper blight prevention and treatment. The dsRNA sequence is shown in SEQ ID NO.2; the dsRNA sequence is used to inhibit the HK2 gene, and the nucleotide sequence is shown in SEQ ID NO.1. The dsRNA is applied to the preparation of the nano preparation MSNs-dsRNA for antagonizing pepper phytophthora and preventing and treating pepper blight, and the expression of the HK2 gene can be targeted and inhibited. The MSNs-dsRNA nano preparation is highly effective in preventing and treating the blight caused by pepper phytophthora infection, and is expected to be developed into a new green fungicide.

Description

Technical Field

[0001] The invention relates to the technical field of pepper blight prevention and treatment, and more specifically to a dsRNA and application thereof in preparing a nano preparation for preventing and treating pepper blight. Background Art

[0002] There are more than 120 species of pathogens in the genus Phytophthora, which can harm almost all dicotyledonous plants and are known as "plant killers". The diseases caused by them are characterized by rapid spread, easy outbreaks and difficulty in prevention and control. They are called "crop diseases" in production. Pepper Phytophthora (P. capsici) is a type of pathogen with the widest host range among Phytophthora. It can harm more than 500 plant species in 26 families such as Solanaceae, Leguminosae, Cruciferae, Cucurbitaceae, and Rosaceae. The economic losses caused each year amount to billions of dollars, seriously affecting the quality and safety of vegetables and the ecological environment in the world. The use of fungicides is still one of the main means of disease prevention and control. However, there are relatively few types of oomycete inhibitors available, and the long-term use of single-site agents can easily lead to drug resistance in plant pathogenic oomycetes. Therefore, it is urgent to create a new strategy for crop disease prevention and control that is green, safe, efficient and coordinated in production.

[0003] Nucleic acid pesticides have the advantages of strong specificity, short effective period, no residue and little impact on non-target organisms. They are known as the third revolution in the history of pesticides and are a hot spot in the field of new green pesticide creation. Spray-induced gene silencing (SIGS) is a new plant protection method based on RNA interference (RNAi). This technology controls the expression of endogenous genes or target genes of pathogens in plants by exogenous application of double-stranded RNA (dsRNA) or small interfering RNAs (siRNA) instead of recombinant viruses or transgenic plants. In recent years, it has been reported to have good control effects on some plant pathogenic fungi. The main control research objects are Fusarium that causes wilt, Botrytis cinerea that causes gray mold in crops and post-harvest fruits, vegetables and flowers, Sclerotinia sclerotiorum that causes stem rot, and some other important pathogenic fungi. For example, studies by Koch et al. have shown that spraying dsRNA (CYP3-dsRNA) targeting three ergosterol biosynthesis genes (CYP51A, CYP51B, CYP51C) of Fusarium graminearum on the surface of barley Hordeum vulgare leaves can effectively inhibit the growth of Fusarium graminearum. However, in vitro application of dsRNA is unstable in the environment, easily degraded by RNA degrading enzymes, ultraviolet light and high temperature, and difficult to effectively introduce into the target organism, which seriously limits the actual application effect of sprayable nucleic acid pesticides. Therefore, how to enhance the stability of dsRNA is an urgent problem to be solved in this field.

[0004] Nanomaterials have the characteristics of small size effect, interface effect and good biocompatibility at the nanoscale. As dsRNA carriers, they can enhance the stability of dsRNA in the environment and its ability to enter the target biological tissues or cells, thereby improving the efficiency of targeted delivery. They are an effective means to solve the difficulty of exogenous application of nucleic acid pesticides. Mesoporous silica nanoparticles (MSNs) are a material with a regular nanoscale pore structure with a pore size of 2 to 50 nm and good adsorption and cation exchange capacity. The medical use of MSNs in anti-cancer, antimicrobial and therapeutic applications is particularly prominent because they have excellent performance in delivering many different small molecules and recent biological products (mRNA, siRNA, antigens, antibodies, proteins and peptides) at the target site. At the same time, they have key advantages in improving the bioavailability of various cargoes, including biological agents. Therefore, MSNs have great application potential as nucleic acid pesticide carriers.

[0005] Since the target genes in Phytophthora that can effectively inhibit the growth and development of pathogens and the infection and pathogenicity through gene silencing are still unclear, this greatly restricts the application of SIGS in crop disease prevention and control. Therefore, discovering and identifying more RNA molecules targeting different target genes is the premise and focus of RNAi pesticides and targeted control technology research. Histidine kinase (HKHistidine Kinase) is a "key component responsible for signal collection and transmission in the two-component signal system. It can sense and transmit a variety of environmental and intracellular stimulation signals. The component system is commonly found in bacteria, fungi, slime molds and higher plants, and is widely involved in cell physiological and biochemical processes. It is worth noting that its homologous genes have not been identified in mammals and humans so far. Therefore, histidine kinase has the potential to become a target for the prevention and control of pepper Phytophthora. Previous studies by our team have shown that the histidine kinase gene HK2 is a key factor in regulating the growth and development and pathogenicity of pepper Phytophthora. There is currently no report on the use of dsRNA related to this gene in the prevention and control of pepper blight.

[0006] Therefore, how to target this gene, design a highly effective dsRNA fragment, and apply it to the prevention and treatment of pepper blight by combining it with mesoporous silica nanomaterials is an urgent problem that technicians in this field need to solve. Summary of the invention

[0007] In view of this, the present invention provides a dsRNA and application thereof in preparing a nanoformulation for preventing and treating pepper blight.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] In one aspect, an embodiment of the present invention provides a dsRNA, wherein the dsRNA sequence is shown as SEQ ID NO.2; the dsRNA sequence is used to inhibit the HK2 gene, and the nucleotide sequence of the HK2 gene is shown as SEQ ID NO.1.

[0010] The second aspect of the embodiment of the present invention also provides the use of the dsRNA in preparing a nanoformulation for antagonizing Phytophthora capsici and preventing and controlling pepper blight.

[0011] The third aspect of the embodiment of the present invention provides a nanoformulation for preventing and treating pepper blight, comprising the dsRNA, mesoporous silica and polyethyleneimine, and the mass ratio of the three is 1:80:12.

[0012] In a preferred embodiment, the concentration of the dsRNA is 1.0 mg / mL; the concentration of the mesoporous silica is 1.0 mg / mL; and the concentration of the polyethyleneimine is 0.5 mg / mL.

[0013] The fourth aspect of the embodiments of the present invention provides the use of the nano-formulation in the preparation of a chemical preparation for preventing and treating pepper blight.

[0014] A fifth aspect of the embodiments of the present invention provides a method for preventing and controlling pepper blight, wherein the nano preparation is sprayed on pepper leaves.

[0015] It can be seen from the above technical solution that compared with the prior art, the technical effects achieved are as follows:

[0016] 1) The present invention cloned a new double-stranded ribonucleic acid dsRNA for the first time, efficiently targeted the histidine kinase gene HK2 of Phytophthora capsici, induced the silencing of the target gene through RNAi, and the silencing efficiency reached more than 55%, without affecting the expression of non-target genes, and had high specificity. At the same time, the target gene HK2 is an important functional gene in the growth, development and pathogenicity of Phytophthora, and its homologous gene has not yet been identified in mammals and humans, which is highly safe for non-target organisms.

[0017] 2) The nanomaterial mesoporous silica used in the present invention has excellent properties such as high specific surface area, good biocompatibility, adjustable pore size and high loading capacity, which can significantly improve the transfection efficiency, interference efficiency and stability of dsRNA.

[0018] 3) The MSNs-dsRNA nanoformulation provided by the present invention was sprayed on tobacco leaves and then inoculated with pepper phytophthora. The experiment showed that the nanoformulation can significantly inhibit the infection of pepper phytophthora. Compared with the control group, the lesion area of ​​the treatment group was reduced by 72.6%; the tomato plant pot experiment showed that after spraying the MSNs-dsRNA nanoformulation, the incidence of tomato plants decreased by 83.3%.

[0019] In summary, the dsRNA provided by the present invention can target and inhibit the expression of the HK2 gene, and the MSNs-dsRNA nanoformulation is highly effective in preventing and treating the disease caused by Phytophthora capsici infection, and is expected to be developed into a new type of green fungicide. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0021] Attached Figure 1 The result diagram of electrophoresis detection of transcription products in Example 1; wherein: lane M is DL 2000 DNA marker, and lane 1 is the dsRNA band of the present invention.

[0022] Attached Figure 2 This is the electrophoresis detection diagram of dsRNA and MSNs binding. Among them: Lane M is DL 2000DNA marker, Lane 1 is dsGFP, Lane 2 is dsGFP Lane 3 is the dsRNA of the present invention, and lane 4 is the dsRNA of the present invention combined with MSNs.

[0023] Attached Figure 3 This is the expression of the histidine kinase gene HK2 after the MSNs-dsRNA nanoformulation in Example 3 treated with Capsicum frutescens.

[0024] Attached Figure 4 This is the infection of Phytophthora capsici on Nicotiana benthamiana leaves in vitro after treatment with the MSNs-dsRNA nanoformulation in Example 4. A is a leaf lesion phenotype diagram, and B is a bar graph for lesion area analysis.

[0025] Attached Figure 5 This is the occurrence of pepper blight on tomato seedlings after treatment with the MSNs-dsRNA nanoformulation in Example 5. A is a diagram showing the disease status of tomato seedlings, and B is a bar graph showing the statistical analysis of the disease index. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] The sequence in the dsRNA of the present invention is derived from the cDNA coding sequence of the histidine kinase gene HK2 of Phytophthora capsici, and the sequence is shown in SEQ ID NO. 1. A 247 bp base sequence in HK2 (shown in SEQ ID NO. 2) is selected as the transcription template of the target dsRNA of the present invention.

[0028]

[0029] CTCGGCTTGACAGCGTATGCGATGAGCGGAGACCGACAGAAGTGTCTTGACTGTGGCATGGATGAGTTCATGGTGAAACCCCATCTCGAAGCTGAGTCTTCGTAAAGCCATCCGGCAGTGGATGCGT ATCCGTTACCTTGGCCACAGAACGCTGCACTGGGAGCTGTGGATGTTACACTCATGGACGCAGTCTCGACTGCCAGACTTGCACCCGCCTCACGCCACATGCAGCAGTTGGATCTTGCTC, as in SEQ Shown as ID NO.2.

[0030] Main material: Promega's T7 RiboMAX TM The Express RNAi System kit was purchased from Promega; DNA marker was purchased from Bao Biotechnology Dalian Co., Ltd.; 2×Phanta Max Master Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; and the remaining reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The tomato material used was AC variety, and Phytophthora capsici LT1534 was donated by the College of Plant Protection, Nanjing Agricultural University and preserved in this laboratory.

[0031] Example 1 In vitro synthesis of dsRNA.

[0032] Step 1: Preparation of dsRNA transcription template.

[0033] ① Cultivate P. capsici in liquid V8 medium for 3 days, collect mycelium, and extract P. capsici genomic DNA using the CTAB method.

[0034] ② The extracted genomic DNA of Phytophthora capsici was used as a template and PCR amplification was performed with dsRNA specific primers (SEQ ID NO.3, SEQ ID NO.4). When amplifying the fragment, a T7 promoter sequence was added to the 5' end of the two primers of PCR, and the amplified fragment automatically contained the T7 promoter sequence.

[0035] GGATCCTAATACGACTCACTATAGGCTCGGCTTGACAGCGTAT, SE Q ID NO. 3.

[0036] GGATCCTAATACGACTCACTATAGGGAGCAAGATCCAACTGCT, SE Q ID NO.4.

[0037] PCR reaction system used (50 μL):

[0038]

[0039] The PCR reaction program is:

[0040]

[0041] After the reaction, 5 μL of the reaction product was detected by 1.2% agarose gel electrophoresis at 100 V for 25 min, and the bands were observed by gel imaging. Gel imaging showed a single band at around 247 bp, which was consistent with the expected sequence size, and the fragments were recovered using the DNA purification kit of Guangzhou Meiji Biotechnology Co., Ltd.

[0042] Step 2: dsRNA synthesis: Using the electrophoresis product recovered from the gel as a template, Promega's T7RiboMAX TM dsRNA was synthesized using the Express RNAi System transcription kit.

[0043] Reaction system (20 μL):

[0044]

[0045] Reaction conditions: Incubate at 37°C for 30 min, anneal at 70°C for 10 min, and then cool to room temperature. Dilute 100U / μL RNase T1 to 10U / μL with RNase T1 Dilution Buffer. For every 20μL of reaction product, add 1μL of freshly diluted RNase solution and 1μL DNase I and incubate at 37°C for 30 min.

[0046] Step 3: Electrophoresis to detect the transcription product. The result is as follows Figure 1 As shown in the figure, lane M is DNA DL2000 marker; lane 1 is HK2-dsRNA.

[0047] Step 4: dsRNA purification: Add 55 μL of 95% ethanol to the transcript, mix well and place on ice for 5 minutes, centrifuge at 12,000 rpm for 10 minutes. Carefully aspirate the supernatant and wash the precipitate with 0.5 ml of 70% cold ethanol, and remove all ethanol after washing. Air-dry the precipitate at room temperature for 15 minutes, and resuspend the transcript dsRNA in 50 μL of nuclease-free water. Detect the A of the product 260 The concentration was determined by the absorbance value and stored at -20°C.

[0048] Example 2 Preparation of MSNs-dsRNA nanoformulation.

[0049] Step 1: Preparation of mesoporous silica (MSNs) working solution: Dissolve the nanomaterial MSNs in DEPC water and mix by ultrasonic vibration to a final concentration of 1 mg / mL.

[0050] Step 2, combination of MSNs and dsRNA: First, 1 μg of dsRNA targeting the GFP gene and 1 μg of dsRNA targeting the HK2 gene were evenly mixed with 1.2 μL of polyethyleneimine PEI (0.5 mg / mL), and shaken for 10 minutes to fully mix. Add 4 μL of mesoporous silica (1.0 mg / mL), mix and stabilize at room temperature for 10 minutes. Thereafter, the solution was mixed with 4 μL of sodium citrate buffer (0.1 M, pH 4.0), and then 9.8 μL of nuclease-free water was added to make the final volume 20 μL to obtain MSNs-dsRNA nanoformulations targeting the GFP gene (abbreviated as MSNs-dsGFP) and MSNs-dsRNA nanoformulations targeting the HK2 gene (abbreviated as MSNs-dsHK2).

[0051] Step 3: Electrophoresis detection: Use 1.2% agarose gel electrophoresis to detect MSNs-dsRNA nanoparticles, 110V constant voltage electrophoresis for 25 minutes. The results are as follows Figure 2 As shown, lane M is DNA DL2000 marker, lane 1 is dsGFP, lane 2 is MSNs-dsGFP, lane 3 is dsHK2, and lane 4 is MSNs-dsHK2. Figure 2 It can be seen that there are no obvious dsRNA bands in lanes 2 and 4, indicating that mesoporous silica (MSNs) can completely load dsRNA to form a stable MSNs-dsRNA nanoformulation.

[0052] Example 3 Detection of the inhibition of the expression of the target gene HK2 of Phytophthora capsici by MSNs-dsRNA nanoformulation.

[0053] Step 1. Treatment of pepper phytophthora with MSNs-dsRNA nanoformulation: The pepper phytophthora strain LT1534 was inoculated into V8 solid culture medium and cultured in a 28°C incubator in the dark for 2 days. Take fresh mycelium from the edge of the colony and inoculate it into 10mL of V8 liquid culture medium, then add 10μL of the MSNs-dsGF P and MSNs-dsHK2 nanoformulations prepared in Example 2 to the culture medium, and use an equal volume of MSNs and water as a control treatment. The above treatment was cultured in a 28°C incubator. After 3 days of co-incubation, the mycelium was taken out to absorb the water, the mycelium was collected and quickly frozen in liquid nitrogen, and stored at -80°C for use.

[0054] Step 2, RNA extraction and detection: RNA extraction from mycelium of Phytophthora capsici was performed using FastPure UniversalPlant Total RNA Isolation Kit (Nanjing Novogene Biotech Co., Ltd.). The specific steps are as follows:

[0055] 1) Grind the mycelium block in liquid nitrogen and add 600 μL Buffer EL. Vortex vigorously for 30 seconds and centrifuge at 12000 rpm for 5 minutes.

[0056] 2) Take about 500 μL of the supernatant and transfer it to FastPure gDNA-Filter Columns III. Centrifuge at 12,000 rpm for 30 seconds. Discard FastPure gDNA-Filter Columns III and collect the filtrate.

[0057] 3) Add 250 μL of anhydrous ethanol to the collection tube and vortex to mix for 15 seconds.

[0058] 4) Transfer the above mixed solution to FastPure RNA Columns V, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate.

[0059] 5) Add 700 μL Buffer RWA to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0060] 6) Add 500 μL Buffer RWB to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0061] 7) Repeat step 6).

[0062] 8) Place FastPure RNA Columns V back into the collection tube and centrifuge at 12000 rpm for 2 min.

[0063] 9) Transfer FastPure RNA Columns V to new RNase-free Collection Tubes 1.5mL centrifuge tubes, add 100μL of RNase-free ddH2O preheated at 65℃ to the center of the adsorption column membrane, let it stand at room temperature for 5 minutes, and centrifuge at 12000rpm for 1 minute.

[0064] Step 3: Reverse transcription of test samples:

[0065] 1) Remove gDNA, the reaction system is as shown in Table 1

[0066] Table 1

[0067] 4×gDNAwiperMix 4μL Template RNA 800ng Nuclease-free water 0-11μL Total volume 16μL

[0068] 2) Mix by gently pipetting. Incubate at 42℃ for 2 minutes.

[0069] 3) Reverse transcription into cDNA, the reaction system is shown in Table 2;

[0070] Table 2

[0071] 5×HiScriptIIIqRTSuperMix 4μL Previous step reaction solution 16μL Total volume 20μL

[0072] 4) Mix by gently pipetting. Reaction conditions: 37℃ for 15min, 85℃ for 15sec.

[0073] Step 4, qRT-PCR detection: Real-time PCR method was used to detect the relative expression of the target gene HK 2 and the housekeeping gene Actin, and their silencing efficiency was calculated. The results showed that compared with the control group, the expression level of HK2 in the MSNs-dsHK2 treatment group was significantly reduced by more than 55% ( Figure 3 ).

[0074] Example 4: Detection of the inhibitory effect of MSNs-dsRNA nanoformulation on pepper phytophthora by in vitro leaf inoculation of Nicotiana benthamiana

[0075] The pepper phytophthora strain LT1534 was inoculated into V8 solid culture medium and cultured in a 28°C constant temperature incubator in the dark for 2 days. 10 μL of the MSNs-dsRNA (200 ng / μL) nanoformulation prepared in Example 2 was dripped onto the leaves of Nicotiana benthamiana, and then a freshly cultured pepper phytophthora hyphae block (5 mm in diameter) was inoculated into the droplet and placed in a 28°C incubator for moisturizing culture. The experimental results were observed after 48 hours. A total of 5 treatment groups were set up, (1) water as the control treatment; (2) mesoporous silica (MSNs) suspension treatment alone; (3) PEI-MSNs mixed solution treatment; (4) MSNs-dsGFP treatment; (5) MSNs-dsH K2 treatment. Five leaves were treated in each experiment and repeated 3 times.

[0076] The results are as follows Figure 4 As shown, the lesion area of ​​treatment group 5 (MSNs-dsHK2) was significantly smaller than that of control group 1 (Mock), and its lesion area was reduced by 72.6%; while there was no significant difference between treatment groups 2, 3, 4 and control group 1. The results show that the MSNs-dsRNA nanoformulation of the present invention has a significant inhibitory effect on the infection of pepper phytophthora.

[0077] Example 5 Application of MSNs-dsRNA Nanoformulation in the Prevention and Control of Pepper Blight

[0078] Step 1. Preparation of zoospores of pepper phytophthora: inoculate pepper phytophthora strain LT1534 into V8 solid culture medium and culture in a constant temperature incubator at 28°C in the dark for 2 days. Take fresh mycelium from the edge of the colony, inoculate into 10mL V8 liquid culture medium, and culture at 28°C for 3 days. Take out the mycelium block, wash it with sterile water for 3 times until the mycelium turns white, spread the mycelium in a culture dish and add 10mL sterile water. After 24 hours of strong light treatment, place the culture dish under a microscope. After a large number of sporangia are observed, put it in a 4°C refrigerator for 30 minutes, take it out and place it at room temperature for 30 minutes, filter and remove the mycelium to obtain pepper phytophthora zoospores. Use a hemocytometer to adjust the concentration of the zoospore suspension to 10 4 pcs / mL, for future use.

[0079] Step 2, tomato seedling treatment: after germination, sow the tomato seeds and wait for them to grow two true leaves for inoculation experiments. Set up water, MSNs, and MSN-dsGFP as control groups, and MSN-dsHK2 as treatment groups, with 6 pots of plants in each group, and repeat 3 times. Spray the nanoformulation containing 10 μg dsRNA on each leaf, keep moist and dark at 25℃ for 12 hours, and then use a scalpel to vertically scratch the roots 0.5 cm away from the stem of the tomato seedlings for root injury treatment. Use a pipette to absorb 5 mL of zoospore suspension (10 4 After 24 h of dark humidity treatment, the diseased plants were counted and photographed after 2 days of normal light (10 h light, 14 h dark) at 25 °C.

[0080] The results are as follows Figure 5 As shown, the morbidity of the control group plants reached more than 85%, while the morbidity of the treated group MSN-dsHK2 was 16.7%, and the control efficiency reached 83.3%. It shows that the MSN-dsRNA nanoformulation of the present invention can effectively reduce the occurrence of pepper blight and has broad market application prospects.

[0081] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0082] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A dsRNA, characterized in that The dsRNA sequence is shown as SEQ ID NO.2; the dsRNA sequence is used to inhibit the HK2 gene, and the nucleotide sequence of the HK2 gene is shown as SEQ ID NO.

1.

2. Use of the dsRNA according to claim 1 in the preparation of a nanoformulation for antagonizing Phytophthora capsici and preventing and controlling pepper blight.

3. A nano preparation for preventing and treating pepper blight, characterized in that: The method comprises the dsRNA according to claim 1, mesoporous silica and polyethyleneimine, wherein the mass ratio of the three is 1:80:

12.

4. The nano preparation for preventing and treating pepper blight according to claim 3, characterized in that: The concentration of the dsRNA is 1.0 mg / mL; the concentration of the mesoporous silica is 1.0 mg / mL; and the concentration of the polyethyleneimine is 0.5 mg / mL.

5. Use of the nano preparation according to claim 4 in the preparation of chemical preparations for preventing and treating pepper blight.

6. A method for preventing and controlling pepper blight, characterized in that: The nano preparation according to claim 3 is sprayed on pepper leaves.

Images