Application of miR-493 Promoter Region SNPs in Body Size and Meat Quality Traits Prediction of Qinchuan Cattle
Through the screening and detection of SNP molecular markers in the promoter region of the miR-493 gene, the problem of long breeding cycle of Qinchuan beef cattle was solved, early selection and seed retention were achieved, and the production performance of beef cattle was improved.
Patent Information
- Application Number
- CN202411576146.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2044-11-06
AI Technical Summary
Qinchuan cattle have a long breeding cycle and insufficient breeding markers, and existing technology makes it difficult to effectively improve their production performance.
Provide miR-493 gene promoter region molecular markers and detection primers. By detecting SNP sites in the miR-493 gene promoter region, screen out SNP molecular markers that are significantly correlated with Qinchuan cattle body size and meat quality traits. These markers are used to prepare test kits and perform genotype determination, thereby achieving early breeding and seed selection.
By quickly detecting the genotype of Qinchuan cattle, early selection of beef cattle populations can be achieved, significantly accelerating the beef cattle breeding process, improving selection efficiency, and enhancing beef cattle production performance.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The animal of the present invention belongs to the technical field of molecular markers, and specifically relates to a SNP molecular marker related to the body size and meat quality traits of Qinchuan cattle, a detection kit and an application thereof. Background Art
[0002] my country boasts a rich resource of local cattle breeds, but the degree of selection for meat production is relatively low compared to specialized beef cattle breeds abroad. Marker-assisted selection (MAS) is an essential tool for breeders to achieve efficient livestock and poultry breeding. Exploring single nucleotide polymorphism (SNP) marker loci associated with livestock and poultry traits has long been a hot topic in livestock and poultry genetics research. DNA marker technology is used to directly select for quantitative trait loci in livestock and poultry, selecting individuals with dominant genotypes for more effective livestock and poultry improvement. The development and application of MAS technology has overcome the limitations of traditional breeding methods, such as long breeding cycles, poor predictability, and low accuracy, shortening generation intervals, improving selection efficiency, and enabling the rapid, targeted development of new breeds.
[0003] Therefore, screening and developing molecular markers related to the economic traits of Qinchuan cattle and carrying out molecular marker-assisted selection breeding will become an effective means to improve the production performance of Qinchuan cattle, which is of great significance for accelerating the selection and breeding of Qinchuan cattle. Summary of the Invention
[0004] In order to solve the problems of long beef cattle breeding cycle and insufficient breeding markers in the Qinchuan cattle industry and breeding technology, the present invention provides the application of miR-493 gene promoter region molecular markers and detection primers in Qinchuan cattle body size, meat quality identification and breeding. The sequences of the miR-493 gene promoter molecular markers are shown as SIQ ID NO.1, SIQ ID NO.2, SIQ ID NO.3 and / or SIQ ID NO.4; wherein:
[0005] The nucleotide sequence shown in SIQ ID NO.1 is located at position g.67691871 of chromosome 21 of Qinchuan cattle, and there is an A / G mutation at this mutation site. This mutation site is significantly correlated with the height of Qinchuan cattle.
[0006] The nucleotide sequence shown in SIQ ID NO.2 is located at position g.67692006 of chromosome 21 of Qinchuan cattle, and there is a C / T base mutation at this mutation site. This mutation site is significantly associated with the oblique length, body height, and waist horn width of Qinchuan cattle.
[0007] The nucleotide sequence shown in SIQ ID NO.3 is located at position g.67692026 of chromosome 21 of Qinchuan cattle, and there is a T / C base mutation at this mutation site, which is significantly correlated with the backfat thickness of Qinchuan cattle.
[0008] The nucleotide sequence shown in SIQ ID NO.4 is located at position g.67692044 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the oblique body length, body height and waist horn width of Qinchuan cattle.
[0009] An optional solution is that the primers of the present invention are:
[0010] SNP F :5'-GCCCACAGACACCCATCAAG-3';
[0011] SNP R :5'-GAGCTGGCAGTATCCACGAAAT-3'.
[0012] The present invention also provides the application of miR-493 gene promoter molecular marker primers in the preparation of Qinchuan cattle body size, meat quality identification and breeding kits. The corresponding kit contains DNA polymerase,
[0013] miR-493 gene promoter region molecular marker forward primer and miR-493 gene promoter molecular marker reverse primer.
[0014] The present invention also provides a Qinchuan cattle seed selection and seed preservation method, which comprises the following steps:
[0015] 1) Extracting genomic DNA from the selected cattle, detecting and sequencing the genotype of the miR-493 gene promoter molecular marker of the selected cattle;
[0016] 2) Individuals with the AA genotype at the miR-493 gene SNP1 g.67691871 A / G site, the CC genotype at the SNP2 g.67692006 C / T site, the TT genotype at the SNP3 g.67692026 T / C site, and / or the AA genotype at the SNP4 g.67692044 A / G site were selected for breeding. Among them, individuals with AA genotype at SNP1 (rs525652231, A / G), CC genotype at SNP2 (rs521422772, C / T), and AA genotype at SNP4 (rs518556071, A / G) were selected. These beef cattle individuals have advantages in body height, body oblique length, and waist width; individuals with TT genotype at SNP3 (rs41991252, T / C) were selected. These beef cattle individuals have advantages in backfat thickness.
[0017] The present invention identifies miR-493 molecular markers associated with body size and meat quality traits in beef cattle. Through screening, genotyping, and association analysis of SNPs in the miR-493 gene in Qinchuan cattle, four SNP markers, SNP1 (rs525652231, A / G), SNP2 (rs521422772, C / T), SNP3 (rs41991252, T / C), and SNP4 (rs518556071, A / G), in the promoter region of the miR-493 gene were found to be significantly associated with body size and meat quality traits in Qinchuan cattle. Based on this discovery, the present invention enables rapid detection and determination of individual genotypes in beef cattle populations, enabling early selection and seed preservation, significantly accelerating the beef cattle breeding process. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 1.2% agarose gel electrophoresis diagram of the PCR amplification product containing the SNP site in the promoter region of the Qinchuan cattle miR-493 gene in the example.
[0019] Figure 2 The figures are the sequence comparison results of the PCR amplification products of the four SNP sites in 15 test samples of the present invention.
[0020] Figure 3 This is the sequencing peak diagram of the four SNP sites of the miR-493 gene of the present invention. DETAILED DESCRIPTION
[0021] Unless otherwise specified, the scientific and technical terms used herein are understood according to the knowledge of ordinary technicians in the relevant fields.
[0022] MiRNAs are small, single-stranded noncoding RNAs (miRNAs) approximately 22 nucleotides (19-25 nt) in length, processed from stem-loop precursors. MiRNAs play a crucial post-transcriptional regulatory role during development, and each miRNA may regulate the transcriptional expression of dozens or even hundreds of genes. Therefore, even subtle changes in miRNA activity can have significant impacts on systemic development.
[0023] miR-493 is involved in multiple biological processes in the body, including cell proliferation, mitosis, growth, autophagy, and apoptosis. Studies have shown that miR-493 is significantly differentially expressed in the longissimus dorsi muscle of Lantang pigs between the first and 90th day of life, and that miR-493 is associated with myogenesis in pigs. Furthermore, miR-493 is involved in regulating myocyte proliferation and differentiation in cattle and in regulating adipogenesis. Further cluster analysis of bovine miR-493 target genes revealed that miR-493 target genes are enriched in signaling pathways closely related to growth, development, and adipogenesis in beef cattle, including the Cell cycle, P53, MAPK, and PI3K / AKT pathways. Furthermore, studies have shown that miR-493 plays a key role in the osteogenic differentiation of bone marrow mesenchymal stem cells. These studies indicate that miR-493 is an important candidate functional gene influencing traits such as growth, meat production, and fat deposition in livestock and poultry.
[0024] Existing research has found that the SNP density in precursor and mature miRNAs is lower than in adjacent flanking regions, while flanking regions further from the miRNAs have a higher SNP density. 49.5% of SNPs (841 / 1700) in flanking regions, including promoter regions, can alter the secondary structure of their corresponding miRNAs from stable to unstable, and most of these SNPs subsequently affect target gene expression. This study discovered four SNP molecular markers in the miR-493 promoter region that are associated with body size and meat quality traits in Qinchuan cattle, potentially enabling early breeding of Qinchuan cattle.
[0025] Example 1:
[0026] 1. Test materials
[0027] 1.1 Experimental animals
[0028] The Qinchuan cattle group, a representative of local yellow cattle in my country, was used as the test object, and blood samples were collected through venous blood collection.
[0029] 1.2 Test reagents
[0030] Agarose (BIOWEST); Blood genome extraction kit (provided by Tiangen Biochemical Technology Co., Ltd.); PCR primers (the following SNPs F and SNP R ).
[0031] 1.3 DNA analysis software
[0032] PCR primer design software: Primer Premier 5; sequence analysis software: DNAman, Chromas;
[0033] Data analysis software: IBM SPSS statistics 19.
[0034] 2. Detection of gene polymorphism
[0035] The extraction of genomic DNA was carried out according to the instructions of the blood genomic DNA extraction kit of TIANGEN Company. The quality of genomic DNA was detected by 1.2% agarose gel electrophoresis. The extracted genomic DNA was stored at -20℃ for future use.
[0036] Considering that the proportion of the selected SNP haplotypes should not be too low when detecting Qinchuan cattle related traits through SNP, the present invention randomly selected 15 samples of DNA to detect gene mutations or gene polymorphisms in the promoter region of the miR-493 gene of Qinchuan cattle. Based on the sequencing results of 15 cattle, multiple sequence alignment was performed using DNAman software to obtain the screening and genotype detection results of 4 SNP sites in 15 samples, as shown in the following figure: Figure 2 shown.
[0037] According to the annotated sequence of the bovine miR-493 gene in the NCBI database (GenBank No.: NC_037348.1), primers were designed for its promoter region. The exon fragments were amplified by PCR and sequenced. Four polymorphic sites were found, including SNP1 (rs525652231, A / G; sequence shown in SIQ ID NO.1), SNP2 (rs521422772, C / T; sequence shown in SIQ ID NO.2), SNP3 (rs41991252, T / C; sequence shown in SIQ ID NO.3), and SNP4 (rs518556071, A / G; sequence shown in SIQ ID NO.4). Figure 3 shown.
[0038] SNP1 (rs525652231, A / G)
[0039] CCCAGCACC[A / G]CACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCGGCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGGGAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCC CGTGGGGCTTTAGTCCCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGGAATGTTCTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTGAAATGGATTCACCGCGAGGAGGCAGGCAA
[0040] SNP2(rs521422772,C / T)
[0041] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCGGCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGGGAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTAGT[C / T]CCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGGAATGTTCTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTGAAATGGATTCACCGCGAGGA
[0042] SNP3(rs41991252,T / C)
[0043] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCGGCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGGGAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTAGTCCCCCCGTCAGTCACTCTGT[T / C]CTCCTCCGTTTTGGAGGAATGTTCTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTGAAATGGATTCACCGCGAGGA
[0044] SNP4(rs518556071,A / G)
[0045] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCGGCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGGGAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTAGTCCCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGG[A / G]ATGTTCTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTGAAATGGATTCACCGCGAGGA
[0046] 3. SNPs typing and association analysis of Qinchuan cattle body size and meat quality traits
[0047] The fragments of the above-mentioned loci were amplified using the provided kit primer pairs and reagents (provided by Beijing Qingke Biotechnology Co., Ltd., Xi'an Branch).
[0048] Primer pairs:
[0049] SNP F :5'-GCCCACAGACACCCATCAAG-3';
[0050] SNP R :5'-GAGCTGGCAGTATCCACGAAAT-3'
[0051] The reaction system of the PCR kit is as follows:
[0052]
[0053] PCR reaction conditions: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 58°C for 15 s, extension at 72°C for 20 s, 36 cycles; extension at 72°C for 5 min, and storage at 4°C.
[0054] The results of 1.2% agarose gel electrophoresis of the PCR products of Qinchuan cattle miR-493 gene primers are as follows Figure 1 shown.
[0055] The PCR products were sequenced and analyzed, and the genotyping and genetic parameter analysis results of the above four SNP sites in the Qinchuan cattle population are shown in Table 1:
[0056] Table 1 Analysis of genetic parameters related to SNP loci
[0057]
[0058] As can be seen from Table 1, in the Qinchuan cattle population, at the SNP1 (rs525652231, A / G) site, AA is the dominant genotype and A is the dominant allele; at the SNP2 (rs521422772, C / T) site, CC is the dominant genotype and C is the dominant allele; at the SNP3 (rs41991252, T / C) site, TC is the dominant genotype and T is the dominant allele; at the SNP4 (rs518556071, A / G) site, AA is the dominant genotype and A is the dominant allele. The chi-square test showed that SNP2 and 4 were both in Hardy-Weinberg equilibrium ( P >0.05), SNP1 and 3 showed Hardy-Weinberg disequilibrium ( P <0.05).
[0059] The results of association analysis between different genotypes and body size traits are shown in Table 2:
[0060] At the SNP1 site in the promoter region of miR-493, the height of individuals with AA genotype was significantly higher than that of individuals with AG and GG genotypes ( P <0.05).
[0061] At SNP2, the CC genotype individuals were significantly higher in body length and height than the TT genotype; the CC genotype individuals were significantly higher in waist width than the TC and TT individuals ( P <0.01).
[0062] At SNP4, individuals with AA genotype showed significantly higher body length than those with GG genotype ( P <0.05); AA genotype individuals were in height ( P <0.05), waist width ( P <0.01) were significantly higher than those of individuals with AG and GG genotypes.
[0063] Table 2 Association analysis between miR-493 promoter region SNPs and body size traits
[0064]
[0065] Note: Data are expressed as mean ± standard error, a, b, different lowercase letters indicate significant differences ( P <0.05); Different capital letters in A and B indicate extremely significant differences ( P <0.01).
[0066] In terms of the beef quality traits of Qinchuan beef, the backfat thickness trait of individuals with SNP3 TT genotype was significantly higher than that of individuals with CC genotype ( P <0.05). However, there were no significant differences in carcass traits of Qinchuan cattle among the genotypes at other loci, as shown in Table 3:
[0067] Table 3 Association analysis between miR-493 promoter region SNPs and meat quality traits
[0068]
[0069] Note: Same as Table 2
[0070] It should be noted that the above embodiments are preferred examples of the present application and are only used to illustrate the technical solution of the present invention so that those skilled in the art can fully understand the present invention. The present invention is not limited to the above embodiments. On the basis of the technical solution of the present invention, some additions or replacements can be made to the technical features therein, which will be obvious to those skilled in the art. Therefore, without departing from the technical solution of the present invention, the additions or replacements made all fall within the scope of protection claimed in the present invention.
Claims
1. Application of primers for detecting miR-493 gene promoter molecular markers in Qinchuan cattle body size, meat quality identification, and breed selection, wherein the sequences of the miR-493 gene promoter molecular markers are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and / or SEQ ID NO.4; wherein: The nucleotide sequence shown in SEQ ID NO.1 is located at position g.67691871 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the height of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.2 is located at position g.67692006 of chromosome 21 of Qinchuan cattle, and there is a C / T base mutation. This mutation site is significantly associated with the oblique length, body height and waist horn width of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.3 is located at position g.67692026 of chromosome 21 of Qinchuan cattle, and there is a T / C base mutation. This mutation site is significantly correlated with the backfat thickness of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.4 is located at position g.67692044 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the oblique body length, body height and waist horn width of Qinchuan cattle.
2. The use according to claim 1, characterized in that The primers are: SNP F :5’-GCCCACAGACACCCATCAAG-3’; SNP R :5’-GAGCTGGCAGTATCCACGAAAT-3’。 3. Use of primers for detecting miR-493 gene promoter molecular markers in the preparation of Qinchuan cattle body size, meat quality identification and breeding kits; the sequences of the miR-493 gene promoter molecular markers are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and / or SEQ ID NO.4; wherein: The nucleotide sequence shown in SEQ ID NO.1 is located at position g.67691871 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the height of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.2 is located at position g.67692006 of chromosome 21 of Qinchuan cattle, and there is a C / T base mutation. This mutation site is significantly associated with the oblique length, body height and waist horn width of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.3 is located at position g.67692026 of chromosome 21 of Qinchuan cattle, and there is a T / C base mutation. This mutation site is significantly correlated with the backfat thickness of Qinchuan cattle; The nucleotide sequence shown in SEQ ID NO.4 is located at position g.67692044 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the oblique body length, body height and waist horn width of Qinchuan cattle.
4. A method for selecting and preserving Qinchuan cattle using the miR-493 gene promoter molecular marker primers according to claim 1, characterized in that: The method comprises the following steps: 1) Extracting genomic DNA from the selected cattle, detecting and sequencing the genotype of the miR-493 gene promoter molecular marker of the selected cattle; 2) Individuals with the AA genotype at the g.67691871 A / G locus, the CC genotype at the g.67692006 C / T locus, the TT genotype at the g.67692026 T / C locus, and the AA genotype at the g.67692044 A / G locus of the miR-493 gene were selected for seed preservation.