Camellia sinensis gene csCIP1 flowering delaying function and application thereof

By cloning and overexpressing the CsCIP1 gene in tea plants, the flowering time of tea plants was delayed, which solved the problem of difficult regulation of tea flowering time and improved the yield and quality of tea.

CN119432899BActive Publication Date: 2026-07-03TEA RES INST GUANGDONG ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411380848.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2026-07-03
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

The flowering time of tea trees is difficult to control effectively, which inhibits vegetative growth and affects the yield and quality of tea.

Method used

The CsCIP1 gene, which is homologous to the AtCIP1 gene in Arabidopsis thaliana, was cloned and overexpressed in tea plants. A recombinant expression vector was constructed and transformed into Agrobacterium tumefaciens to infect the plants and delay flowering.

Benefits of technology

Delaying the flowering time of tea trees reduces nutrient consumption, increases tea yield and quality, and provides genetic resources and theoretical support for tea variety improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119432899B_ABST
    Figure CN119432899B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of tea cultivation technology, specifically relating to the delayed flowering function of the tea tree gene CsCIP1 and its application. This invention discovered a sequence CsTGY12G0001995 homologous to the Arabidopsis thaliana AtCIP1 gene in tea trees, which was named CsCIP1. Overexpression of this gene in Arabidopsis thaliana resulted in transgenic plants flowering later than the wild type, demonstrating that this gene has a delayed flowering function and providing a candidate gene for the targeted breeding of delayed-flowering tea varieties. The functional analysis of the tea tree gene CsCIP1 and its delayed flowering provides important genetic resources and strong theoretical support for improving tea varieties in agricultural production, and has broad application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tea cultivation technology, specifically relating to the delayed flowering function of the tea tree gene CsCIP1 and its application. Background Technology

[0002] Tea (Camellia sinensis), an important leaf-based economic crop, is primarily harvested for its fresh leaves. The yield and quality of tea are closely related to economic benefits, especially the quality and yield of spring tea, which directly impact the annual tea production value. Therefore, it is necessary to suppress reproductive growth and promote vegetative growth. As a perennial woody plant, the tea tree alternates between vegetative and reproductive growth. Tea trees are characterized by abundant flowering and a long flowering period. However, reproductive growth absorbs a large amount of nutrients, thus inhibiting vegetative growth and affecting tea yield and quality. Studies by Du Sijia et al. have found that excessive flowering leads to changes in sugar content and delayed new shoot emergence the following year (Du Sijia. The Influence and Mechanism of Tea Tree Reproductive Growth on the Formation of Tea Quality Components. Fujian Agriculture and Forestry University, 2023.). Studies by Chen Dongmei et al. have shown that the types and proportions of amino acids in tea flowers and leaves are relatively similar, and excessive flowering can affect the amino acid content of tea to some extent, thereby affecting the quality of tea (Chen Dongmei, Fan Weiwei, He Jinwu. Comparative analysis of amino acid content in Hainan tea and tea flower. Packaging and Food Machinery, 2020, 38(01):30-32+60.). Other studies have shown that flower removal can effectively improve the yield and quality of spring tea (Wang Jing, Shi Yang, Zhang Yan, et al. Study on the effects of removing tea flowers on the yield and biochemical composition of spring tea from albino tea trees. Tea Communications, 2022, 49(04):464-471.). Studies by He Zhihua et al. have found that reducing the consumption of nutrients by flower bud differentiation and flowers and fruits can improve the utilization rate of water and fertilizer by tea trees, thereby increasing tea yield (He Zhihua, Xia Yan, Zhang Yulong, et al. Study on the effects of different organic fertilizers on tea yield and flowering in organic tea gardens. Agricultural Mechanization Research, 2019, 41(01):190-195.). Therefore, delaying the flowering time of tea trees can shorten the flowering period, reduce the nutrient consumption caused by flowering, and accumulate more energy for the sprouting of new shoots and buds in spring. This is a new approach to improve the yield and quality of spring tea in a green, safe, and efficient manner.

[0003] The flowering of tea plants is regulated not only by internal genetic factors and hormone levels, but also by external environmental conditions such as temperature and light duration. These external environmental conditions primarily regulate flowering by altering physiological metabolism or hormone levels, promoting or inhibiting the expression of flowering genes. At the molecular level, the balanced expression of genes regulating flowering time and inflorescence meristem determines the timing of flower primordia formation and flowering. Therefore, identifying flowering genes and clarifying their regulatory functions provides important genetic resources and strong theoretical support for improving tea varieties. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, this invention discovered a sequence in tea plants that is homologous to the Arabidopsis thaliana AtCIP1 gene and named it CsCIP1. Studies have shown that overexpression of the tea plant gene CsCIP1 in Arabidopsis thaliana can delay flowering, which is expected to provide important gene resources and strong theoretical support for improving tea plant varieties.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] This invention provides the application of the CsCIP1 gene in delayed flowering, wherein the CsCIP1 gene has the nucleotide sequence shown in SEQ ID NO:1.

[0007] Preferably, the primers for cloning the CsCIP1 gene from tea plants are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0008] This invention also provides the application of biological materials containing the CsCIP1 gene in delayed flowering, wherein the CsCIP1 gene has the nucleotide sequence shown in SEQ ID NO:1; the biological materials containing the CsCIP1 gene include recombinant plasmids containing the CsCIP1 gene. Of course, other recombinant vectors containing the CsCIP1 gene are also included.

[0009] The present invention also provides a method for delaying plant flowering, specifically: firstly, a recombinant expression vector for the CsCIP1 gene driven by the 35S promoter is constructed using a gateway system; after transformation and plasmid extraction, the vector is transduced into Agrobacterium competent cells; and finally, transgenic plants are obtained through infection.

[0010] Preferably, the plant includes (but is not limited to) Arabidopsis thaliana.

[0011] Preferably, the infection is an Agrobacterium-mediated flower immersion infection method.

[0012] Compared with the prior art, the beneficial effects of the present invention are:

[0013] This invention discovered a sequence, CsTGY12G0001995, homologous to the Arabidopsis thaliana AtCIP1 gene in tea plants, and named it CsCIP1. Overexpression of this gene in Arabidopsis resulted in later flowering in the transgenic plants compared to the wild type, demonstrating that the gene has a function in delaying flowering and providing a candidate gene for the targeted breeding of tea varieties with delayed flowering. Functional analysis of the tea plant gene CsCIP1 and its delayed flowering mechanism provides important genetic resources and strong theoretical support for improving tea varieties in agricultural production, and has broad application value. Attached Figure Description

[0014] Figure 1 Homology comparison between tea plant CsTGY14G0000594 and Arabidopsis gene;

[0015] Figure 2 To identify 35S:CsCIP1:GFP transgenic positive plants by PCR (lanes 1-10 are 10 different 35S:CsCIP1:GFP overexpression positive plants);

[0016] Figure 3 To detect the expression level of CsCIP1 in Arabidopsis thaliana 35S:CsCIP1:GFP overexpression transgenic positive plants (only the lines with high CsCIP1 expression levels, OX-CsCIP1-3 and OX-CsCIP-4, are listed);

[0017] Figure 4 Flowering inhibition phenotype of tea plantlets that are positive for 35S:CsCIP1:GFP transgenic: (A) Flowering time statistics; (B) Flowering phenotype observation. Detailed Implementation

[0018] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0019] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0020] Example: Isolation, identification, and flowering regulation function of the tea plant gene CsCIP1

[0021] 1.1 Origin and Identification of Genes:

[0022] We commissioned Biomarker Biotechnology Co., Ltd. to conduct transcriptome differential analysis on two tea varieties with different flowering times using RNA-Seq technology. Using the published tea genome (Zhang X, Chen S, Shi L, et al. Haplotype-resolved genome assembly provides insights into evolutionary history of the tea plant[J]. Nature Genetics[2024-09-24].DOI:10.1038 / s41588-021-00895-y.) as a reference genome, we screened for the important differentially expressed gene CsTGY12G0001995 (SEQ ID NO.1). Using specific primers (F1: ATGGATCAGCAAGTTGTTTTTTC, SEQ ID NO.2; R1: TTAGAACACTTTGCTATTGATAG, SEQ ID NO.2), we further analyzed the differentially expressed gene CsTGY12G0001995 (SEQ ID NO.1). The coding sequence of this gene was cloned using IDNO.3. The reaction system was 20 μL (F1: 0.5 μL, R1: 0.5 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH2O: 8 μL). The reaction conditions were: 98℃ for 30 s, 58℃ for 1.5 min, 72℃ for 5 min, 30 cycles, and extension at 72℃ for 10 min. Then, homology comparison was performed between the tea plant CsTGY12G0001995 gene and the Arabidopsis gene (AT5G41790) using NCBI-BLAST. Figure 1 We found that CsTGY12G0001995 is homologous to Arabidopsis thaliana AtCIP1, so we named it CsCIP1.

[0023] The sequence of CsCIP1-CsTGY12G0001995 (SEQ ID NO.1):

[0024]

[0025] 1.2 Cloning the CsCIP1 gene in tea plants:

[0026] RNA was extracted from the flowers of the Yinghong No. 9 tea tree at different stages using the Tiangen RNA Extraction Kit (DP452). The RNA was then reverse transcribed into cDNA using the Takara Reverse Transcription Kit (RR047A). Using this cDNA as a template, specific primers with sticky ends (F2: ggccgcccccttcacc ATGGATCAGCAAGTTGTTTTTTC, SEQ ID NO. 4; R2: cggcgcgcccaccctt TTAGAACACTTTGCTATTGATAG, SEQ ID NO. 5, where lowercase letters represent sticky ends) were designed based on the target gene sequence for PCR amplification, and the CsCIP1 gene was cloned. The PCR reaction system consisted of 20 μL (F2: 0.5 μL, R2: 0.5 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH2O: 8 μL), and the reaction conditions were: 98℃ for 30 s, 58℃ for 1.5 min, 72℃ for 5 min, 30 cycles, and a final extension at 72℃ for 10 min.

[0027] 1.3 Connection Transformation:

[0028] The linear target gene fragment with sticky ends was ligated to the linearized entry vector pENTR using the Influsion ligase (Takara, 638949). The vector construction method was described in the reference "Zhang M, Liu Y, Li Z, et al. ThebZIP transcription factor GmbZIP15 facilitates resistance against Sclerotinias clerotiorum and Phytophthora sojae infection in..." Soybean.[J].iScience,2021,24(6):102642. A circular entry vector containing the target gene was obtained. The ligation product was added to 100 μL of E. coli DH5α competent cells, placed on ice for 30 min, incubated in a 42℃ water bath for 45 s, and immediately placed back on ice for 2 min. Then, 600 μL of blank LB liquid medium was added to a clean bench and cultured in a shaker at 37℃ for 0.5-1 h. The cells were collected, centrifuged at 3000g for 1 min, and the supernatant was removed in a clean bench. The collected precipitate was spread on LB solid medium containing the corresponding resistance, sealed, and inverted in an incubator at 37℃ for overnight culture.

[0029] 1.4 Screening and identification of transformants:

[0030] In a clean bench, a single colony was picked from the culture medium with a sterile pipette tip and inoculated into LB liquid medium. The culture was carried out at 37°C in a shaker for 5 hours. Then, PCR identification was performed (the identification system, procedure and primers are the same as in Part 1.1). The colonies were sent to Sangon Biotech Co., Ltd. for sequencing, and the correct transformants were selected as the next recombinant plasmids.

[0031] 1.5 Construction of recombinant expression vectors:

[0032] The recombinant plasmid was extracted and ligated into the final vector 35S:605:GFP using Gateway technology, i.e., the phage site recombination system (attB*attP-attL*attR), with LR enzyme (Thermo Fisher Scientific, 11791020). (The vector construction method is based on the literature "Zhang M, Liu Y, Li Z, et al. The bZIP transcription factor GmbZIP15 facilitates resistance against Sclerotinia sclerotiorum and Phytophthorasojae infection in soybean.[J].iScience,2021,24(6):102642."). The vector was then transformed a second time into E. coli DH5α competent cells for transformant screening and identification (vector primer and gene primer atB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT, SEQ ID NO.6; R1: TTAGAACACTTTGCTATTGATAG, SEQ ID NO.6). IDNO.3, PCR procedure and system are the same as 1.1), then extract the plasmid.

[0033] 1.6. Transduction and Identification:

[0034] Add 3 μL of the plasmid to be transformed into competent GV3101 strain for chemical transformation. The competent cells with the plasmid added were sequentially incubated on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Then, 600 μL of blank LB medium was added, and the mixture was incubated on a shaker at 28°C for 2-3 hours. The bacteria were collected, centrifuged at 3000g for 1 minute, and the supernatant was removed in a clean bench. The collected precipitate was spread onto LB solid medium containing the corresponding antibiotic, sealed, and incubated upside down in a 28°C incubator for 2-3 days. Single colonies were picked and inoculated into LB liquid medium, incubated overnight on a shaker at 28°C, and then subjected to PCR identification (identification system, procedure, and primers are the same as in 1.5) to select correctly transformed Agrobacterium.

[0035] 1.7 Infection of Arabidopsis thaliana:

[0036] Wild-type Arabidopsis thaliana buds were immersed in an Agrobacterium tumefaciens (GV3101) infection solution containing 35S:CsCIP1:GFP (OD=0.8) for 1 minute, and then placed in a greenhouse for cultivation (22℃, 16h light / 8h dark).

[0037] 1.8 Screening for transgenic plants:

[0038] One-week-old Arabidopsis seedlings were sprayed with BASTA herbicide (10% glufosinate, CB2471, Coolab) diluted 1:500. Positive plants (herbicide-resistant plants) were screened and further identified by PCR (identification system, procedure, and primers were the same as in 1.5). Leaf DNA was extracted using the CTAB method and subjected to polymerase chain reaction. Agarose gel electrophoresis was used to analyze whether the CsCIP1 gene had been transferred. Figure 2 It can be seen that the 35S:CsCIP1:GFP overexpression transgenic positive plantlets have bands, while the wild type (WT) does not have bands, confirming that transgenic plants have been successfully obtained.

[0039] 1.9 Expression level detection:

[0040] Leaves from positive plants were collected, and RNA was extracted from each leaf using the Tiangen RNA Extraction Kit (DP452). The RNA was then reverse transcribed into cDNA using the Takara Reverse Transcription Kit (RR047A). qPCR primers were designed (q-CsCIP1-F: GAGGAAGACTACGGCTACTTTG, SEQ ID NO.7; q-CsCIP1-R: CCACCTGCTCTTCCAATTCT, SEQ ID NO.8). The relative expression level of CsCIP1 in each positive plant was detected by qPCR (reaction system: F: 0.4 μL, R: 0.4 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH2O: 8.2 μL, reaction conditions: 95℃ 30s, (95℃ 10s, 68℃ 10s) × 40 cycles). Figure 3 It was found that, compared with the wild type (WT), the expression level of CsCIP1 in the 35S:CsCIP1:GFP overexpression transgenic positive plants was significantly increased. Finally, lines with high expression levels (OX-CsCIP1-3, OX-CsCIP-4) were randomly selected for subsequent phenotypic observation.

[0041] 1.10. Phenotypic observation:

[0042] Wild-type (WT) and 35S:CsCIP1:GFP-positive plants were grown under the same greenhouse culture conditions (22℃, 16h light / 8h darkness), and the flowering time of the plants was observed. Figure 4By analyzing the flowering time of the plants, it was found that the flowering time of the 35S:CsCIP1:GFP overexpression transgenic positive plants was about one week later than that of the wild type, indicating that overexpression of CsCIP1 can delay flowering.

[0043] In summary, the CsCIP1 gene has the function of delaying flowering, providing a candidate gene for the targeted breeding of tea varieties with delayed flowering, providing important genetic resources and strong theoretical support for the improvement of tea varieties, and has broad application value.

[0044] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. Use of a CsCIP1 gene for delaying flowering in plants, characterized in that, The CsCIP1 gene has the nucleotide sequence shown in SEQ ID NO:1, and the plant is Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, Primers for cloning the CsCIP1 gene from tea plants are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. The application of biomaterials containing the CsCIP1 gene in delaying plant flowering, characterized in that, The CsCIP1 gene has the nucleotide sequence shown in SEQ ID NO:1; the biological material containing the CsCIP1 gene includes a recombinant plasmid containing the CsCIP1 gene; the plant is Arabidopsis thaliana.

4. A method for delaying plant flowering, characterized in that, First, a recombinant expression vector for the CsCIP1 gene driven by the 35S promoter was constructed using a gateway system. After transformation and plasmid extraction, the vector was transduced into Agrobacterium competent cells, and finally transgenic plants were obtained through infection. The CsCIP1 gene has the nucleotide sequence shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • Plant-origin regulator protein and nucleic acid encoding the same

    US6605704B1