Application of KLF15 as action target to reduction of toxic and side effects of colorectal cancer drug 5-FU

Abstract

The invention discloses application of KLF15 as an action target to reduction of toxic and side effects of a colorectal cancer drug 5-FU, and belongs to the field of biological medicine, the nucleotide sequence of the KLF15 is as shown in SEQ ID NO.2, the colorectal cancer drug comprises 5-fluorouracil, and the toxic and side effects comprise toxic and side effects on the heart. Experiments prove that the overexpressed liver KLF15 can resist heart failure and myocardial cell apoptosis caused by 5-fluorouracil; in the aspect of cell experiments, KLF15 in liver WRL68 cells is overexpressed, so that myocardial cell survival rate reduction caused by 5-fluorouracil can be effectively resisted, and tumor cells can be better killed. Experiments prove that cardiotoxicity caused by 5-fluorouracil can be effectively resisted through overexpression of the KLF15, and an important theoretical basis and an effective target are provided for further optimization of treatment of related diseases by the 5-fluorouracil.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the application of KLF15 as a target in reducing the toxic and side effects of colorectal cancer drug 5-FU. Background Art

[0002] Colorectal cancer (CRC) is a common malignant tumor of the digestive system. It is the third most common cancer in recent years and the second leading cause of cancer death worldwide. According to statistics from the cancer database GLOBOCAN2020, there were more than 1.9 million new cases of colorectal cancer and more than 930,000 deaths worldwide in 2020. Among them, there were more than 550,000 new cases of colorectal cancer in China in 2020, and the number of new cases of colorectal cancer in China is gradually increasing. The occurrence and development of colorectal cancer are regulated by multiple factors such as diet, lifestyle, environment, and family inheritance. The cause is complex and difficult to detect early. At the same time, colorectal cancer also has the characteristics of rapid progression, difficult to control metastasis, high recurrence rate, and poor prognosis. At present, the treatments for colorectal cancer mainly include surgery, radiotherapy, chemotherapy, and targeted therapy.

[0003] 5-Fluorouracil (5-FU) is a widely used cancer chemotherapy drug in clinical practice. It achieves the effect of treating cancer by blocking cell DNA synthesis and histone deacetylation, and has a good clinical effect on digestive tract cancer. However, long-term administration of 5-FU will cause cardiac toxicity and side effects such as angina pectoris, palpitations, heart failure, cardiac arrest and pericarditis, which greatly reduces the clinical application value of 5-FU. It is currently recognized that the cardiac toxicity caused by 5-FU is mainly caused by the cardiotoxic substance α-fluoro-β-alanine (FBAL) produced by the metabolic pathway dominated by dihydropyrimidine dehydrogenase (DPYD) and dihydropyrimidinase (DPYS) in hepatocytes. This metabolic pathway starts with DPYD, which metabolizes more than 80% of 5-FU into 5,6-dihydro-5-fluorouracil (DHFU) without anticancer effect, greatly weakening the efficacy of 5-FU. Therefore, the expression level of DPYD is crucial to the efficacy of 5-FU. DPYS further hydrolyzes DHFU into α-fluoro-β-uridylic acid (FUPA), which is metabolized into the metabolite α-fluoro-β-alanine (FBAL) by β-urea propionase 1 (UPB1), and FBAL is finally converted into fluorocitrate (FCA). FCA is the wrong substrate of aconitase (Ac) in the Krebs cycle. The resulting strong and irreversible enzyme inhibition leads to the accumulation of intracellular citrate and seriously impairs the production of cardiac adenosine triphosphate (ATP) in the energy pathway of myocardial cells, making it impossible for myocardial cells to obtain energy in a timely manner, resulting in serious cardiac toxicity.

[0004] There are many methods reported to reduce the cardiac toxicity of 5-FU, such as DPYD-guided individualized dose, down-regulation of DPYD expression, drug-induced cardiac function damage, and nano-drug delivery. Although DPYD-guided individualized dose can significantly reduce the incidence of severe cardiac toxicity, the individualized dosing strategy of fluoropyrimidines first requires preliminary genotyping of the DPYD gene through the detection of DPYD enzyme activity. This test is time-consuming and expensive, and cannot be widely implemented in clinical practice. In addition, the test sensitivity is limited and the accuracy is only 40%, and it is easy to cause damage to other organs in patients. There are two main ways to downregulate the expression of DPYD. One is to downregulate the expression of DPYD in colorectal cancer (CRC) by sphingosine 1-phosphate receptor 2 (S1PR2) inhibitors to reduce the cardiotoxicity of 5-FU, but the effect is very weak. The other is that H3K27 trimethylation (H3K27me3) on the DPYD promoter regulated by methyltransferase Ezh2 and demethylase UTX can inhibit DPYD expression by inhibiting the binding of transcription factor PU.1, thereby reducing the cardiotoxicity of 5-FU. However, the inhibitory effects of Ezh2 and UTX are limited and only work on a very small number of people. In addition, the clinical method of using β-blockers, calcium channel blockers or long-acting nitrates to alleviate cardiac function damage can significantly reduce cardiac toxicity, but these drugs will produce other side effects such as hypotension, palpitations, and bronchospasm during clinical use. Recently, it has been reported that the use of colchicine and kaempferol-based nanoparticle delivery methods can improve 5-FU-induced cardiac toxicity in rats, but will produce liver and kidney damage and neurotoxicity and other toxic side effects. Therefore, there is currently no effective method to prevent and treat 5-FU-induced cardiac toxicity, and the existing methods and research only focus on regulating the expression of a single enzyme, DPYD, and do not involve DPYS. It is well known that drug metabolism in the body is a complex process, and it is often necessary to simultaneously and intelligently regulate multiple metabolic enzymes to reduce drug toxicity.

[0005] Krüppel-like factor (KLF) is the largest and most important basal transcription factor in eukaryotes. It is a subfamily of zinc finger transcription factors. In mammals, KLF genes contain at least 18 family members, which are named KLF1-KLF18 in the order of discovery. The C-termini of all KLF family members contain three conserved Cys2 / His2 zinc finger structures, which can regulate the expression of genes rich in GC and CACCC promoters. Different KLF family members have different biological functions in cells and play a role in the development of different diseases.

[0006] KLF15 has been shown to regulate the metabolic systems of endogenous substances (such as steroid hormones and bile acids) and exogenous substances (such as drugs) through direct and indirect pathways. Experimental results obtained by RNA-seq, molecular and biochemical methods indicate that KLF15 widely regulates the expression of enzymes and membrane channel genes of the EXM (Endobiotic and Xenobiotic Metabolism) biochemical system. As the central organ of detoxification metabolism in the body, the liver is enriched with a large number of metabolic biochemical enzymes and membrane channels, and plays an important regulatory role in the toxic side effects caused by exogenous drugs, including cardiotoxicity. More than 80% of 5-FU is metabolized in the liver to DHFU, which has no anti-cancer effect. Therefore, it is urgent to find the "intelligent" central regulatory node of the 5-FU metabolic biochemical system, so that the 5-FU detoxification system can be better optimized by regulating this node, thereby effectively resisting cardiotoxic side effects.

[0007] So far, there are no reports on reducing the cardiotoxic side effects caused by 5-FU by increasing the expression level of KLF15 in the liver. Summary of the invention

[0008] The purpose of the present invention is to provide an application of KLF15 as a target in reducing the toxic side effects of the colorectal cancer drug 5-FU, so as to solve the problems existing in the above-mentioned prior art. By overexpressing KLF15, the cardiotoxicity caused by 5-fluorouracil can be effectively resisted, providing an important theoretical basis and effective target for further optimizing 5-fluorouracil in the treatment of related diseases.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] The present invention provides the use of KLF15 as a target in the preparation of a drug for reducing the toxic and side effects of a colorectal cancer drug. The nucleotide sequence of KLF15 is shown in SEQ ID NO.2, and the colorectal cancer drug includes 5-fluorouracil.

[0011] Furthermore, the side effects of colorectal cancer drugs can be reduced by overexpressing KLF15.

[0012] Furthermore, the toxic and side effects include toxic and side effects on the heart.

[0013] The present invention also provides the use of a substance that overexpresses KLF15 in the preparation of a drug for reducing the toxic and side effects of a colorectal cancer drug.

[0014] Furthermore, the colorectal cancer drug includes 5-fluorouracil.

[0015] The present invention also provides the use of a substance for detecting the level of KLF15 in preparing a reagent or a kit for detecting the toxic and side effects of colorectal cancer drugs.

[0016] Furthermore, the colorectal cancer drug includes 5-fluorouracil.

[0017] The present invention also provides a reagent or kit for screening drugs that can reduce the toxic side effects of colorectal cancer drugs, comprising primers for detecting the expression of KLF15, the nucleotide sequence of the primers being shown in SEQ ID NO.3-4.

[0018] Furthermore, the colorectal cancer drug includes 5-fluorouracil.

[0019] The present invention discloses the following technical effects:

[0020] The present invention has been verified by experiments that overexpression of liver KLF15 can resist heart failure and myocardial cell apoptosis caused by 5-FU; while knocking out liver KLF15 can increase the cardiac toxicity caused by 5-FU; in terms of cell experiments, overexpression of KLF15 in primary liver cells and WRL68 cells can effectively resist the decrease in myocardial cell survival rate caused by 5-FU and better kill tumor cells;

[0021] The experiments of the present invention confirm that overexpression of KLF15 can effectively resist the cardiotoxicity caused by 5-FU, providing an important theoretical basis and effective target for further optimizing 5-FU treatment of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The map of KLF15 overexpression AAV adeno-associated virus;

[0024] Figure 2 AAV adeno-associated virus map for KLF15 knockdown;

[0025] Figure 3 is the map of KLF15 control AAV adeno-associated virus;

[0026] Figure 4 Specific expression diagram of each group of viruses; A: RT-qPCR verification results; B: Western Blotting verification results; C: Fluorescence diagram of virus targeting efficiency in each group;

[0027] Figure 5 The results of detecting the activities of ALT (A), CK-MB (B) and BUN (C) in each group of mice;

[0028] Figure 6 HE staining (A) and TUNEL staining (B) of the hearts of mice in each group;

[0029] Figure 7 Heart test images of mice in the overexpression group and the control group; A: echocardiography, B: ejection fraction; C: electrocardiogram;

[0030] Figure 8 The expression of DPYD (A), DPYS (B) and TK (C) in the liver of KLF15 knockout mice;

[0031] Fig. 9 Effects of KLF15 on cells; A: Effect of overexpression of KLF15 on the viability of AC16 cells; B: Effect of KLF15 expression level on the viability of colorectal cancer cells induced by 5-FU;

[0032] Fig.10 Effect of KLF15 on 5-FU treatment of colorectal cancer; A: Flowchart; B: Virus effect detection of each group of mice; C: Tumor size results of each group of mice; D: Ki-67 staining. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Eight-week-old male C57 wild-type mice were purchased from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd.;

[0039] The AAV8 adeno-associated virus pAAV[Exp]-Alb>mKlf15[NM_023184.4]:WPRE (overexpression virus, ID number: VB211010-1148jte) inserted with the liver-specific promoter Alb (nucleotide sequence as shown in SEQ ID NO.1) and the structural gene of KLF15 (nucleotide sequence as shown in SEQ ID NO.2) was constructed by Yunzhou Biotechnology (Guangzhou) Co., Ltd. (see the map) Figure 1 );

[0040] Control virus pAAV[Exp]-CMV>EGFP:WPRE (ID number: VB010000-9394npt, map see Figure 2 ) and liver KLF15 knockdown virus pAAV[miR30]-Alb>EGFP:{mKlf15[shRNA#1]}:WPRE (KLF15 knockdown virus, ID number: VB211011-1118bxg, map see Figure 3 )) Designed on Yunzhou vector personalized design platform, detailed vector customization information can be queried according to the ID number: https: / / www.vectorbuilder.cn / design / retrieve.html.

[0041] Example 1 Animal Experiment

[0042] 1. Construction of mice with different KLF15 expression levels

[0043] Eight-week-old male C57 wild-type mice were randomly divided into three groups: overexpression group, knockdown group, and control group. KLF15 overexpression virus, KLF15 knockdown virus, and control virus were injected into the tail vein of mice using a disposable syringe according to the group. The virus titer was diluted to 1×10 12 GC / mL, injection dose was 200 μL / mouse, 5 mice per group (liver-specific promoter Alb mediated targeting to the liver).

[0044] The virus targeting efficiency was verified by using a laser confocal microscope to photograph the green fluorescent protein carried by the virus in frozen liver sections. The results showed that the virus had excellent targeting effect on the liver ( Figure 4 Middle C).

[0045] The expression level of KLF15 was verified by RT-qPCR and Western Blotting. The verification steps were as follows: 20 mg of frozen liver was ground in 500 μL of lysis buffer provided in the RNA extraction kit (Shanghai Yishan Biotechnology Co., Ltd., RN002plus), centrifuged to obtain the supernatant, RNA was extracted from the liver tissue using an RNA extraction kit (Shanghai Yishan Biotechnology Co., Ltd., ES, RN002plus), and then cDNA was obtained using a reverse transcription kit (Baori Medical Biotechnology (Beijing) Co., Ltd., Takara, RR037A) and stored at -20°C. One-Step TB PrimeScript TM RT-qPCR was performed using RT-PCR Kit II (Perfect Real Time) (Baori Medical Biotechnology (Beijing) Co., Ltd., Takara, RR086B) to verify the expression level of KLF15, and 18S was used for normalization.

[0046] Primer sequences: KLF15-F: ACAGGCGAGAAGCCCTTT (SEQ ID NO.3); KLF15-R: ATCTGAGCGGGAAAACCTC (SEQ ID NO.4); 18S-F: AAACGGCTACCACATCCAAG (SEQ ID NO.5); 18S-R: TACAGGGCCTCGAAAGAGTC (SEQ ID NO.6). The reaction program of RT-qPCR was as follows: insulation stage: 95°C, 10 min; cycling stage: 40 cycles, 95°C, 10 s, 65°C, 30 s; melting curve stage: 95°C, 15 s, 60°C, 1 min, 95°C, 15 s; insulation stage: 95°C, 10 min.

[0047] RT-qPCR results showed that the overexpression virus effectively enhanced the expression of KLF15 mRNA in the liver, while the knockdown virus effectively reduced the expression of KLF15 mRNA in the liver ( Figure 4 (A).

[0048] 50 mg of frozen liver tissue from each group of mice was ground in RIPA lysis buffer (strong) (Shanghai Biotech Biotechnology Co., Ltd., P0013B) supplemented with PMSF, protease inhibitors, and phosphatase inhibitors. After being fully lysed on ice for 30 minutes, the supernatant was centrifuged to obtain total protein. After protein quantification using the BCA kit (Shanghai Biotech Co., Ltd., P0012), protein loading buffer (Shanghai Yazyme Biotechnology Co., Ltd., LT103) was added and boiled at 99°C for 15 minutes to denature the protein. A 10% SDS-PAGE gel (Shanghai Yazyme Biotechnology Co., Ltd., PG112) was used for electrophoresis. After transfer, a 1:1000 KLF15 antibody (Abcam (Shanghai) Trading Co., Ltd., AB167192) was used for incubation at 4°C overnight. After washing the membrane with TBST, a 1:2000 anti-goat secondary antibody (Jiangsu Qinke Biological Research Center Co., Ltd., Affinity, S0010) was used for incubation for 1 hour. After washing with TBST, a high-sensitivity ECL chemiluminescence kit (Suzhou Xinsaimei Biotechnology Co., Ltd., P2300) was used for development. Western Blotting results showed that the overexpression virus effectively enhanced the KLF15 protein level in the liver, while the knockdown virus effectively reduced the KLF15 protein level in the liver ( Figure 4 (middle B).

[0049] 2. Overexpression of liver KLF15 can protect against the cardiotoxic side effects caused by 5-FU

[0050] The mice in the above groups were intraperitoneally injected with 300 mg / kg 5-FU (MedChemExpress, HY-B0579) to construct a 5-FU cardiac toxicity model, and an equal volume of dimethyl sulfoxide was used as a control. On the fourth day, the mice were euthanized and peripheral blood and liver, heart and other tissues were taken for subsequent testing. The blood was centrifuged at 3000 rpm for 10 minutes in a coagulant tube, and the upper serum was taken and stored in a -20°C refrigerator. The tissue was quickly frozen in liquid nitrogen and stored in a -80°C refrigerator or fixed in 4% paraformaldehyde for 48 hours and stored in the dark.

[0051] The activities of liver injury marker ALT, kidney injury marker BUN and heart injury marker CK-MB were detected using the GPT / ALT activity detection kit (Beijing Solebow Technology Co., Ltd., BC1555), urea nitrogen (BUN) activity detection kit (Beijing Solebow Technology Co., Ltd., BC1535) and CK-MB ELISA kit (Jining Biology, JN19949). The data were statistically analyzed using mean ± SEM (n = 3). Figure 5As shown, there was no significant change in ALT and BUN of the three groups of mice, while CK-MB of the overexpression group mice was lower than that of the other two groups, and CK-MB of the knockout group mice was higher than that of the control group. It can be seen that ALT, a marker of liver and kidney damage, did not change significantly in the three groups of mice, while CK-MB was significantly increased in the knockout mice, and the CK-MB of the control group was higher than that of the overexpression group, indicating that overexpression of KLF15 can resist the cardiotoxic side effects caused by 5-FU, while knockout of liver KLF15 can increase the cardiotoxic side effects caused by 5-FU.

[0052] like Figure 6 As shown, both HE staining and TUNEL staining showed that the heart tissue of the overexpression group mice was healthier after 5-FU modeling, the cardiomyocyte shape was more regular, and there was less cell apoptosis (the fluorescence number decreased by 50-60%), indicating that overexpression of liver KLF15 can resist the cardiotoxic side effects caused by 5-FU; while the cardiomyocyte morphology in the heart tissue of the knockout group mice changed after 5-FU modeling, and there were more cell apoptosis in the cardiomyocytes, indicating that liver KLF15 knockout can increase the cardiotoxic side effects caused by 5-FU.

[0053] At the same time, the hearts of mice in the overexpression group and the control group were tested.

[0054] First, the mice are depilated in advance, and then the gel is applied to the ultrasound probe (transducer). The ultrasound probe with this gel can provide better images. The probe is pressed tightly against the mouse's chest skin and moved around. The sound waves emitted by the probe pass through the chest to the heart. The probe records the sound waves reflected from the heart, and the computer then converts the information into dynamic images. These images can be immediately displayed on the monitor, so that an echocardiogram appears, and the mouse's ejection fraction will also be displayed in numbers.

[0055] ECG device installation: Anesthetize the mouse, first use surgical scissors to make a subcutaneous channel in the neck and armpit of the upper limb, be careful not to cut the peritoneum, pass the forceps from the armpit to the neck, pull the mesh electrode to the armpit and fix it, connect the positive pole (red) of the bioelectric cable to the left lower limb, and the negative pole (black) to the right upper limb. After the electrode is fixed, suture the mouse skin and place it on a heating pad to help the mouse recover after surgery.

[0056] ECG monitoring: Turn on the signal transmitter (ECG backpack) and connect it to the electrode on the back of the mouse. Turn on the signal receiver and connect it to the computer. Next, use the computer to open the multi-channel physiological signal acquisition and processing system. After selecting the corresponding channel, set the acquisition frequency to 8kHz, the scanning speed to 25ms / div, the sensitivity to 1mV, the time constant to 0.2s, and the filter constant to 30Hz. After the parameters are set, you can start monitoring.

[0057] Test results see Figure 7It can be seen that the echocardiogram and ejection fraction of the overexpression group were healthier than those of the control group, and the ejection fraction was also higher than that of the control group. In addition, KLF15 overexpression did not cause electrocardiogram abnormalities, indicating that KLF15 can resist heart failure caused by 5-FU.

[0058] 3. Knockout of liver KLF15 can increase the cardiotoxic side effects caused by 5-FU

[0059] The levels of DPYD, DPYS and TK in the liver of KLF15 knockout mice were detected.

[0060] The expression levels of DPYD / DPYD / TK were detected by RT-qPCR, using the same method as described in “1. Construction of mice with different KLF15 expression levels”.

[0061] Primer sequences: DPYD-F: GGGTATGGCTAACACCACAGTG (SEQ ID NO. 7); DPYD-R: GCATTGTAGGCTGAGAAGGCAC (SEQ ID NO. 8);

[0062] DPYS-F: CTGGAGTGAAGAATGGAGCCATG (SEQ ID NO.9); DPYS-F R: CTCCCTGTTGTGGTCAAATCGC (SEQ ID NO.10);

[0063] TK-F: TGAAGTCACCGCTGTGTGCAT (SEQ ID NO. 11); TK-R: ACACGGAGTGATACTTGTCGGC (SEQ ID NO. 12).

[0064] The results are as follows Figure 8 As shown, DPYD and DPYS were increased and TK was decreased in KLF15 knockdown mice, indicating that liver KLF15 can inhibit the expression of 5-FU metabolic enzymes DPYD and DPYS.

[0065] Example 2 Cell experiment

[0066] Overexpression of KLF15 in cells can effectively resist the decrease in cardiomyocyte survival rate caused by 5-FU and better kill tumor cells

[0067] Liver WRL68 cells, human cardiomyocytes AC16, and human colorectal cancer cells HCT116 (purchased from the Cell Bank of the Chinese Academy of Sciences, SCSP-550).

[0068] 1. Detection of the effect of KLF15 expression changes in WRL68 on 5-FU killing of cardiomyocytes

[0069] Plate the cells in advance and prepare for transfection after the cell confluence reaches 70% to 80%. Transfect the extracted KLF15 expression plasmid and the control empty plasmid using liposome Lipo-2000. Prepare the transfection solution at a ratio of Lipo2000: plasmid = 2:1, add it to the cells after incubation in a CO2 incubator for 30 minutes, change the solution after 3 hours, and continue to culture in the incubator. Treat the cells with 5-FU the next day, transfer the supernatant to the pre-plated AC16 cells after 24 hours, and use cck-8 to detect cell activity after 36 hours.

[0070] It was found that AC16 cells cultured in cell culture medium overexpressing KLF15 had a higher survival rate. The results showed that increasing the expression level of KLF15 in liver cells can effectively increase the ability of cardiomyocytes to resist cell death caused by 5-FU ( Fig. 9 (A).

[0071] 2. Effect of changes in KLF15 expression levels on the viability of colorectal cancer cells induced by 5-FU

[0072] WRL68 cells were evenly plated in a 48-well plate at 35,000 cells / well and cultured in DMEM medium (Vicente Biotechnology (Nanjing) Co., Ltd., 319-005) containing 10% FBS (Vicente Biotechnology (Nanjing) Co., Ltd., 087-150) for 24 h. After the cells adhered to the wall, 1×10 8 KLF15 overexpression virus and KLF15 knockdown virus with a titer of GC / mL were transfected at 500 μL / well for 36 hours to specifically increase or decrease the expression of KLF15 in cells, and the control virus was used as the reference group. RT-qPCR was used to verify the expression level of KLF15: RNA was extracted from cells using an RNA extraction kit (Shanghai Yishan Biotechnology Co., Ltd., RN002plus) 36 hours after viral transfection, and then cDNA was obtained using a reverse transcription kit (Takara, RR037A) and stored at -20°C. One-Step TB PrimeScript TM RT-qPCR was performed using RT-PCR Kit II (Perfect Real Time) (Takara, RR086B) to verify the expression level of KLF15, and 18S was used for normalization. The primers and RT-qPCR reaction procedures were referred to Example 1. The results showed that each group of viruses could effectively induce an increase or decrease in the expression level of KLF15.

[0073] CCK8 was used to detect the effect of changes in KLF15 expression levels in cells on the viability of colorectal cancer cells induced by 5-FU, as follows

[0074] After viral transfection, serum-free DMEM culture medium was used for purification for 4 hours. Then, serum-free DMEM culture medium containing 50μM and 100μM 5-FU (Vicente Biotechnology (Nanjing) Co., Ltd., 319-005) was used to stimulate for 24 hours, and then the supernatant was transferred to HCT116 cells and cultured for 24 hours. After that, 450μL of serum-free DMEM and 50μL of CCK8 reagent (Dongren Chemical Technology (Shanghai) Co., Ltd., ck04) were added to each well and mixed evenly. After incubation at 37°C for 3 hours, the OD value was detected at an absorbance of 450nm using an enzyme reader. The results showed that the overexpression virus can effectively enhance the expression level of KLF15, while the knockdown virus reduces the expression level of KLF15. Fig. 9 As shown in Figure B, the cancer cell viability in the overexpression group was significantly lower than that in the control group and the knockdown group, and the culture medium transfected with the KLF15 expression plasmid had a stronger killing effect on cancer cells. It can be seen that KLF15 has the effect of promoting 5-FU to kill intestinal tumor cells.

[0075] Example 3 Effects of different KLF15 expression levels on 5-FU treatment of colorectal cancer

[0076] Balb / c mice (purchased from Nanjing Mouse Born Biotechnology Co., Ltd.) were randomly divided into three groups: overexpression group, knockdown group and control group. On the first day, KLF15 overexpression virus, KLF15 knockdown virus and control virus (virus titer was 1×10 12 GC / mL, injection dose was 200 μL / mouse), 5 mice in each group; on the second day, CT26 mouse colorectal cancer cells (purchased from Edigene, catalog number: EDC2024037-W037, cell concentration was 1×10 7 cfu / mL, the injection dose is 100 μL / mouse). The expression level of KLF15 in each group of mice was detected according to the RT-qPCR method described in Example 1. After 14 days, the virus took effect and the mice were treated. The mice were injected intraperitoneally with 20 mg / kg of 5-FU once a day, and a blank control was set up at the same time. After 12 days of treatment, the mice were dissected, the mouse tumors were taken for photographing, and then the mouse tumor tissues were taken for KI-67 staining (GB111141-100), which is generally expressed as the proportion of positive cells. Cells with brown or brown precipitates in the nucleus are considered to be Ki-67 positive cells. The higher the positive ratio, the higher the proliferation activity of tumor cells.

[0077] Results Fig.10 Compared with the control group and the knockdown group, the overexpression group could better reduce the tumor size after injection of 5-FU, and the positive ratio of Ki-67 staining was lower, indicating that overexpression of KLF15 could better kill tumor cells.

[0078] SEQ ID NO.1 (Alb promoter sequence, derived from mouse):

[0079]

[0080] SEQ ID NO.2 (KLF15 structural gene sequence, derived from mouse):

[0081]

[0082] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The use of KLF15 as a target in the preparation of a drug for reducing the toxic and side effects of a colorectal cancer drug, characterized in that: The nucleotide sequence of KLF15 is shown in SEQ ID NO.2, and the colorectal cancer drug includes 5-fluorouracil.

2. The use according to claim 1, characterized in that Reducing the toxic side effects of colorectal cancer drugs by overexpressing KLF15.

3. The use according to claim 2, characterized in that The toxic and side effects include toxic and side effects on the heart.

4. Application of substances that overexpress KLF15 in the preparation of drugs for reducing the toxic side effects of colorectal cancer drugs.

5. The use according to claim 4, characterized in that The anti-colorectal cancer drugs include 5-fluorouracil.

6. Use of substances for detecting KLF15 levels in the preparation of reagents or kits for detecting the toxic and side effects of colorectal cancer drugs.

7. The use according to claim 6, characterized in that The colorectal cancer drugs include 5-fluorouracil.

8. A reagent or kit for screening drugs that can reduce the toxic side effects of colorectal cancer drugs, characterized in that: It includes primers for detecting the expression amount of KLF15, and the nucleotide sequence of the primers is shown in SEQ ID NO.3-4.

9. The reagent or kit according to claim 8, characterized in that The colorectal cancer drugs include 5-fluorouracil.

Images