Mosquito-borne virus multiplex fluorescent quantitative PCR detection kit and detection method thereof

Abstract

This application provides a multiplex quantitative PCR detection kit for mosquito-borne viruses and its detection method. The detection kit includes a multiplex PCR reaction solution, a positive control, and a negative control. The multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, respectively. The detection method includes sample extraction, preparation of the PCR mixture of reagents, PCR amplification, and fluorescence signal reading. Through the above methods, this application can specifically identify dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus. By combining a standard curve, it can quantitatively detect dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, with high detection efficiency, stable implementation, simple and rapid operation, high detection speed, and high detection accuracy and sensitivity.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic biology technology, specifically to a mosquito-borne virus multiplex real-time PCR detection kit and its detection method. Background Technology

[0002] Arboviruses are transmitted by arthropods and are widely distributed. Viruses transmitted by mosquitoes are called mosquito-borne viruses. They mainly belong to six RNA virus families, including Togaviridae, Flaviviridae, Bunyaviridae, Reoviridae, Rhabdoviridae, and Orthomyxoviridae, thus exhibiting high genetic variability. Mosquito-borne virus infection typically presents with fever, possibly accompanied by skin, joint, neurological, or hemorrhagic symptoms and signs. The prevalence of mosquito-borne viruses poses a threat to both humans and animals, making accurate detection essential.

[0003] Currently, the most harmful and prevalent mosquito-borne viruses include dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus. How to rapidly and accurately detect these viruses is a pressing issue. ELISA is highly sensitive and specific, but it requires a live host and live virus, posing high safety requirements and limiting its application in ordinary laboratories. Polymerase chain reaction (PCR) is a widely used molecular method for detecting and identifying pathogenic viruses. It is rapid, inexpensive, and simple, making it one of the most widely used techniques in molecular biology. However, existing quantitative fluorescence detection methods often struggle to detect multiple mosquito-borne viruses, and traditional detection probes generally suffer from insufficient sensitivity and accuracy when detecting specific mosquito-borne viruses.

[0004] In view of this, it is necessary to improve existing methods for detecting mosquito-borne viruses in order to increase the types of viruses that can be detected, as well as the sensitivity and accuracy of detection. Summary of the Invention

[0005] In view of the technical problems existing in the background art, this application provides a mosquito-borne virus multiplex fluorescent quantitative PCR detection kit and detection method, which aims to accurately quantify dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, and improve the detection sensitivity.

[0006] In one aspect, embodiments of this application provide a multiplex quantitative PCR detection kit for mosquito-borne viruses, comprising a multiplex PCR reaction solution, a positive control, and a negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, respectively.

[0007] In the technical solution of this application embodiment, corresponding primers and probes are designed for dengue fever virus, Japanese encephalitis virus, Zika virus and West Nile virus, respectively, as the main components of the multiplex PCR reaction solution. This enables accurate identification and quantitative detection of these four types of mosquito-borne viruses through multiplex fluorescent quantitative PCR detection, and improves detection efficiency and sensitivity.

[0008] In some embodiments, the four specific probes include:

[0009] Dengue virus probe as shown in SEQ ID NO:1:

[0010] SEQ ID NO: 1: AGCATATTGACGCTGGGARAGAC;

[0011] Japanese encephalitis virus probe as shown in SEQ ID NO:2:

[0012] SEQ ID NO:2: AGCWATGARGTTGTCRAATTTCCA;

[0013] Zika virus probe as shown in SEQ ID NO:3:

[0014] SEQ ID NO:3: CGCACCACYTGGGCTGARAACAT;

[0015] West Nile virus probe as shown in SEQ ID NO:4:

[0016] SEQ ID NO: 4: CTTGGGACTTTGGATCAGTTGGAGG.

[0017] In this embodiment, by performing sequence alignment of the genes of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, and screening conserved regions, and setting parameters such as temperature, length, and GC value, four specific probes targeting the genes of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were designed, which effectively improved specificity and detection sensitivity compared to conventional probes.

[0018] In some embodiments, the 5' fluorescent reporter group of the dengue virus probe is VIC, and the 3' fluorescent quencher group is MGB, as specifically represented below:

[0019] 5'-VIC-AGCATATTGACGCTGGGARAGAC-MGB-3';

[0020] The Japanese encephalitis virus probe has a 5' fluorescent reporter group (Cy5) and a 3' fluorescent quencher group (MGB), as specifically represented below:

[0021] 5'-Cy5-AGCWATGARGTTGTCRAATTTCCA-MGB-3';

[0022] The Zika virus probe has a 5' fluorescent reporter group (FAM) and a 3' fluorescent quencher group (MGB), as specifically represented below:

[0023] 5'-FAM-CGCACCACYTGGGCTGARAACAT-MGB-3';

[0024] The West Nile virus probe has a 5' fluorescent reporter group (ROX) and a 3' fluorescent quencher group (MGB), as specifically represented below:

[0025] 5'-ROX-CTTGGGACTTTGGATCAGTTGGAGG-MGB-3'.

[0026] In this embodiment, by specifically designing the 5' fluorescent reporter group and the 3' fluorescent quencher group of each probe, the 5' fluorescent reporter group of each virus probe is designed as VIC, Cy5, FAM, and ROX, respectively, and the 3' fluorescent quencher group is designed as MGB, which can further improve the detection efficiency and detection sensitivity.

[0027] In some embodiments, the four pairs of specific primers include:

[0028] For example, the upstream primer for dengue virus shown in SEQ ID NO:5 and the downstream primer for dengue virus shown in SEQ ID NO:6:

[0029] SEQ ID NO: 5: AAGGACTAGAGGTTAGAGGAGAC;

[0030] SEQ ID NO:6: GCGTTCTGTGCCTGGAATGATG;

[0031] For example, the upstream primer for Japanese encephalitis virus shown in SEQ ID NO:7 and the downstream primer for Japanese encephalitis virus shown in SEQ ID NO:8:

[0032] SEQ ID NO:7: CAAAAGAGGAGGAAATGAAGGC;

[0033] SEQ ID NO:8:AATGTCCGTGTTGTTGATGGTC;

[0034] Zika virus upstream primer as shown in SEQ ID NO:9 and Zika virus downstream primer as shown in SEQ ID NO:10:

[0035] SEQ ID NO:9: ATGGACAGACATTCCCTATTTGG;

[0036] SEQ ID NO:10:TGTAGACCCTTCTTCACCCAAG;

[0037] For example, the West Nile virus upstream primer shown in SEQ ID NO:11 and the West Nile virus downstream primer shown in SEQ ID NO:12:

[0038] SEQ ID NO: 11: GGCAAAGCCTTTACAACCAC;

[0039] SEQ ID NO:12: CTCCTCCGAACACTTGATGG;

[0040] The above sequences are all labeled in a 5'-3' format.

[0041] In this embodiment, based on the combined effect of the four pairs of specific primers and four specific probes, dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus can be specifically identified and quantitatively detected, thereby improving detection efficiency, accuracy and sensitivity.

[0042] In some embodiments, the positive control includes a dengue virus positive control, a Japanese encephalitis virus positive control, a Zika virus positive control, and a West Nile virus positive control; the dengue virus positive control is a plasmid solution carrying a dengue virus gene fragment; the Japanese encephalitis virus positive control is a plasmid solution carrying a Japanese encephalitis virus gene fragment; the Zika virus positive control is a plasmid solution carrying a Zika virus gene fragment; and the West Nile virus positive control is a plasmid solution carrying a West Nile virus gene fragment.

[0043] In some embodiments, the negative control is nuclease-free water.

[0044] In some embodiments, the multiplex PCR reaction solution further includes 2×PerfeCT qPCR ToughMix UNG.

[0045] Secondly, embodiments of this application provide a method for quantitative detection of mosquito-borne viruses using multiplex real-time PCR, comprising the following steps:

[0046] S1. Extract the RNA template from the sample to be tested, reverse it to a DNA template, and use it as the sample to be tested;

[0047] S2. Add the multiplex PCR reaction solution from the above kit to the sample to be tested to prepare the PCR mixture of the drug to be tested;

[0048] S3. Perform PCR amplification on the PCR mixture of the drugs to be tested;

[0049] S4. After completing the PCR amplification, read the fluorescence signal and calculate the copy number of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus.

[0050] In the technical solution of this application embodiment, by using the above method, combined with external standards and standard curves, dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus can be quantitatively detected. The detection efficiency is high, it can be stably implemented, and it is simple and fast to operate. The detection time is only 4 hours, which is suitable for rapid detection of a large number of samples.

[0051] In some embodiments, the volume concentration of the test sample in the PCR mixture of the test drug is 20%; the concentration of the dengue virus probe is 0.2 μM, and the concentrations of both the upstream and downstream primers for dengue virus are 0.2 μM; the concentration of the Japanese encephalitis virus probe is 0.3 μM, and the concentrations of both the upstream and downstream primers for Japanese encephalitis virus are 0.1 μM; the concentration of the Zika virus probe is 0.2 μM, and the concentrations of both the upstream and downstream primers for Zika virus are 0.1 μM; the concentration of the West Nile virus probe is 0.3 μM, and the concentrations of both the upstream and downstream primers for West Nile virus are 0.1 μM.

[0052] In some embodiments, the annealing temperature is set to 63–64°C during the PCR amplification.

[0053] In the above embodiments, by controlling the primer concentration, probe concentration, and annealing temperature during the detection process, the sensitivity of the detection results can be improved.

[0054] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and to implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the following are specific embodiments of this application. Attached Figure Description

[0055] To more clearly illustrate the technical solutions of this application, the accompanying drawings used in this application will be briefly described below. Obviously, the drawings described below are merely some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without any creative effort.

[0056] Figure 1 Results of primer concentration optimization for four mosquito-borne viruses;

[0057] Figure 2 Results of probe concentration optimization for four mosquito-borne viruses;

[0058] Figure 3 Results of optimized annealing temperatures for four mosquito-borne viruses;

[0059] Figure 4 Standard curves for quantitative real-time PCR of four mosquito-borne viruses;

[0060] Figure 5 The results of quantitative real-time PCR amplification curves and PCR gel images for four mosquito-borne viruses are shown.

[0061] Figure 6 The bar chart shows the specific results for four mosquito-borne viruses. Detailed Implementation

[0062] The embodiments of the technical solution of this application will now be described in detail with reference to the accompanying drawings. These embodiments are only used to more clearly illustrate the technical solution of this application and are therefore merely examples, and should not be used to limit the scope of protection of this application.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the application; the terms “comprising” and “having”, and any variations thereof, in the specification, claims, and foregoing description of the drawings are intended to cover non-exclusive inclusion.

[0064] In this document, the term "embodiment" means that a particular feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places throughout the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.

[0065] To address the limitations of existing mosquito-borne virus detection methods in detecting multiple mosquito-borne viruses, and the fact that traditional detection probes often suffer from insufficient sensitivity and low accuracy when detecting specific mosquito-borne viruses, this application designs four non-interfering specific probes and four pairs of specific primers for dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, respectively. These are used for accurate and absolute quantitative detection of these four mosquito-borne viruses, improving detection efficiency, sensitivity, and accuracy. Specific embodiments are described below. It should be noted that the embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0066] Example 1

[0067] This embodiment provides a mosquito-borne virus multiplex real-time PCR detection kit, including multiplex PCR reaction solution, positive control, and negative control. The multiplex PCR reaction solution includes 2×PerfeCT qPCR ToughMix UNG, upstream and downstream primers for dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, as well as dengue virus probes, Japanese encephalitis virus probes, Zika virus probes, and West Nile virus probes, as detailed below:

[0068] Upstream primer for dengue virus: 5'-AAGGACTAGAGGTTAGAGGAGAC-3';

[0069] Downstream primer for dengue virus: 5'-GCGTTCTGTGCCTGGAATGATG-3';

[0070] Japanese encephalitis virus upstream primer: 5'-CAAAAGAGGAGGAAATGAAGGC-3';

[0071] Japanese encephalitis virus downstream primer: 5'-AATGTCCGTGTTGTTGATGGTC-3';

[0072] Zika virus upstream primer: 5'-ATGGACAGACATTCCCTATTTGG-3';

[0073] Zika virus downstream primer: 5'-TGTAGACCCTTCTTCACCCAAG-3';

[0074] West Nile virus upstream primer: 5'-GGCAAAGCCTTTACAACCAC-3';

[0075] West Nile virus downstream primer: 5'-CTCCTCCGAACACTTGATGG-3';

[0076] Dengue virus probe: 5'-VIC-AGCATATTGACGCTGGGARAGAC-MGB-3';

[0077] Japanese encephalitis virus probe:

[0078] 5'-Cy5-AGCWATGARGTTGTCRAATTTCCA-MGB-3';

[0079] Zika virus probe: 5'-FAM-CGCACCACYTGGGCTGARAACAT-MGB-3';

[0080] West Nile virus probe:

[0081] 5'-ROX-CTTGGGACTTTGGATCAGTTGGAGG-MGB-3'.

[0082] The positive controls include dengue virus positive controls, Japanese encephalitis virus positive controls, Zika virus positive controls, and West Nile virus positive controls. The dengue virus positive control is a plasmid solution carrying a dengue virus gene fragment; the Japanese encephalitis virus positive control is a plasmid solution carrying a Japanese encephalitis virus gene fragment; the Zika virus positive control is a plasmid solution carrying a Zika virus gene fragment; and the West Nile virus positive control is a plasmid solution carrying a West Nile virus gene fragment. The negative control is nuclease-free water.

[0083] Example 2

[0084] This embodiment provides the operating procedure and detection condition optimization method for the multiplex fluorescence quantitative detection of mosquito-borne viruses, in order to obtain the optimal detection conditions and further improve the accuracy and sensitivity of the detection results.

[0085] First, this embodiment demonstrates the construction and validation of standard plasmids, with the specific steps as follows:

[0086] 1. Virus culture and target gene amplification

[0087] Virus culture: Culture virus-susceptible cells at 25 cm⁻¹ 2 After the cells form a dense monolayer in the culture flask, they are inoculated with the virus, cultured until the virus proliferates, and then cell samples are collected.

[0088] RNA extraction: Cells were lysed in each 6-well plate using 1 ml of Trizol reagent. The Trizol lysate was transferred to an EP tube and incubated at room temperature for 5 min. 0.2 ml of chloroform was added, and the cells were vortexed for 15 sec. After incubation at room temperature for 2–3 min, the cells were centrifuged at 12000 rpm (2℃–8℃) for 15 min. The supernatant was transferred to a new EP tube, 0.5 ml of isopropanol was added, and the cells were incubated for 10 min. After centrifugation at 12000 rpm (2℃–8℃) for 10 min, the supernatant was discarded. The cells were washed with 1 ml of 75% ethanol, vortexed, and centrifuged at 12000 rpm (2℃–8℃) for 5 min. The supernatant was discarded. The precipitated RNA was allowed to air dry at room temperature, and RNase-free water was added to dissolve the RNA precipitate.

[0089] Reverse transcription assay: The concentration of extracted RNA was determined, and the following were added sequentially to a PCR tube: 2 μL ABScript II Enzyme Mix (10X), 10 μL ABScript II Reaction Mix (2X), 1 μL 10 mM dNTPs, 2 μL Primer, and 1 μg RNA template. Water was then added to a final volume of 20 μL. The tube was incubated at 25°C for 5 min, then at 42°C for 1 h. The cDNA was collected and stored at 20°C for later use.

[0090] Target gene amplification: Using the Phanta reagent kit, PCR amplification was performed on the reversed DNA of RNA extracted with plasmid primers (the amounts of each reagent are shown in Table 1). PCR reaction conditions: 95℃ for 5 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 1 min (35 cycles); extension at 72℃ for 5 min; and final storage at 4℃. The corresponding target fragments were amplified according to different reaction systems and conditions.

[0091] Table 1. Dosage of each reagent used during target gene amplification.

[0092]

[0093]

[0094] 2. Detection, purification, and recovery of PCR amplification products

[0095] (1) Mix 50 μL of PCR product with 5 μL of Loading Buffer and perform 1% agarose gel electrophoresis to detect the product.

[0096] (2) Under UV light irradiation, according to the DL 2000 marker, cut the desired target fragment from the agarose gel, place it in a 1.5mL EP tube, and weigh the gel block;

[0097] (3) Add 300 μL Binding Buffer and mix in a metal bath at 55°C until completely melted.

[0098] (4) Take 700 μL of the melted liquid into a HiBind DNA column, centrifuge at 12000 r / min for 1 min, and then transfer the remaining liquid to the column. Repeat this step with the remaining liquid.

[0099] (5) Discard the filtrate, add 300 μL Binding Buffer to the HiBind DNA column, let stand for 1 min, and centrifuge at 12000 r / min for 1 min.

[0100] (6) Discard the filtrate and add 700 μL Wash Buffer to the HiBind DNA column. Centrifuge at 12000 r / min for 1 min.

[0101] (7) Discard the filtrate and repeat step 6.

[0102] (8) Discard the filtrate, centrifuge at 12000r / min for 2min, and completely dry the liquid.

[0103] (9) Place the HiBind DNA column into a 1.5 mL EP tube, add 30 μL of solution buffer to the center of the membrane, incubate at 37 °C for 3 min, centrifuge at 12000 r / min for 1 min to elute the DNA, and repeat once. Determine its concentration and purity using a NanoDrop 2000 micro-nucleic acid protein analyzer.

[0104] 3. Connection and Transformation

[0105] (1) Connection

[0106] The purified PCR product was ligated into the PMD-19T vector system, gently pipetted to ensure homogeneity, and incubated at 16°C for 30 min. The system is shown in Table 2.

[0107] Table 2 Reaction system during connection

[0108]

[0109] (2) Transformation

[0110] A. Take 50 μL of DH5α competent cells (-80℃) and place them in an ice bath until they melt (about 5 min). Gently shake to mix them.

[0111] B. Add 10 μL of the ligation reaction product and place in an ice bath for 30 min, then immediately heat shock in a 42°C water bath for 45 s, then quickly transfer to an ice bath and cool for 2 min.

[0112] C. Under aseptic conditions, add 800 μL of LB culture medium (without ampicillin antibiotic) and incubate at 37°C with shaking (150 rpm) for 1 h.

[0113] D. Centrifuge at 5000 r / min for 5 min, discard the supernatant, add 100 μL of the mixed precipitate, and spread it evenly on an LB (containing ampicillin) plate.

[0114] After E and LB plates are left to stand for 30 minutes to fully absorb the nutrients, invert the plates and incubate overnight at 37°C. Use a pipette tip to pick out white single seedlings for expansion culture.

[0115] F. Place a single colony in a centrifuge tube containing 5 mL of LB culture medium (containing ammonia) and shake at 37°C and 230 r / min for 12 hours.

[0116] 4. Plasmid extraction

[0117] A. Place the bacterial culture mixture in a high-speed centrifuge and centrifuge at 5000 rpm for 15 min, then discard the supernatant. Add 250 μL of SoLution I to the precipitate to suspend the cells.

[0118] B. Add 250 μL of SoLution II, gently invert and mix 4-6 times, and incubate at room temperature for 2 min.

[0119] C. Add 350 μL of SoLutionⅢ and invert the liquid repeatedly until white flocculent sediment is suspended in the liquid.

[0120] D. Transfer the above mixture to a 1.5 mL EP tube and centrifuge at 12000 r / min for 10 min.

[0121] E. Transfer the supernatant to the DNA binding column, centrifuge at 12000 r / min for 12 min, and discard the filtrate.

[0122] F. Add 500 μL HBC Buffer, centrifuge at 12000 r / min for 1 min, and discard the filtrate.

[0123] G. Add 700 μL Wash Buffer, centrifuge at 12000 r / min for 1 min, discard the filtrate, and repeat this operation once.

[0124] H, 12000r / min, air-free for 2min, then open the lid and evaporate at room temperature for 3min.

[0125] 1. Place the DNA binding column in a new EP tube, add 50 μL of EB (Elution Buffer), incubate at 37°C for 5 min, centrifuge at 12000 r / min for 1 min, and elute the DNA.

[0126] J. Use Nano Drop 2000 to test the quality and concentration of the constructed recombinant plasmid. The quality and concentration of the plasmid are determined by the A260 / A280 and A260 / A230 ratios. Finally, store at -20℃ for later use.

[0127] 5. Sequencing and analysis of standard plasmids

[0128] Plasmids with positive identification results were reactivated and sent to Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The sequencing results were entered into NCBI for BLAST analysis and compared with the corresponding reference sequence in GenBank to analyze homology.

[0129] After constructing and validating the standard plasmids, sample preparation was performed: the product concentration of the plasmid standard was determined, and its copy number was calculated; after calculating the copy number, 2 μL was taken as the test sample, and a negative control was set up for each test. The formula for calculating the copy number is as follows:

[0130] Product RNA copy number (copies / μL) = (6.02 × 10⁻⁶) 23 )×(purified product concentration ng / μL×10 -9 (RNALength × 340 Daltons / base)

[0131] Product DNA copy number (copies / μL) = (6.02 × 10⁻⁶) 23 )×(plasmid concentration ng / μL×10 -9 (DNALength × 660 Daltons / bases)

[0132] Among them, 6.02×10 23 is Avogadro's constant, DNA Length is the number of bases remaining in the target fragment after enzyme digestion, and 660 Daltons / base is the average molecular weight of each DNA base.

[0133] Next, the annealing temperature, primer working concentration, and probe working concentration were initially determined. The working concentrations of primers and probes for singleton fluorescence quantitative quantification were optimized according to the reaction array method. Singleton primers and probes were selected and diluted with nuclease-free water to an initial concentration of 20 μM. The amounts used are shown in Table 3. Sterile water was used as a negative control.

[0134] Table 3. Amounts of each reagent in the reaction system

[0135]

[0136]

[0137] To investigate the effects of different annealing temperatures and primer and probe concentrations on PCR reactions, these two conditions were optimized to obtain the best reaction conditions and provide guidance for various reaction conditions in multiplex PCR. Specific optimization items are as follows:

[0138] (1) Adjust the annealing temperature and optimize it in 8 gradients (53.6℃~63.6℃).

[0139] (2) Adjust the primer concentration by adding (0.05μL to 0.2μL) to a 10μL system in four gradients for optimization.

[0140] (3) Adjust the probe concentration by adding (0.05μL~0.2μL) to a 10μL system in four gradients for optimization.

[0141] The experimental results are shown in Tables 4-1 to 4-5. The optimal temperatures for dengue virus (61.9℃, primer concentration 0.3μM, probe concentration 0.2μM), Japanese encephalitis virus (0.3μM, probe concentration 0.3μM), Zika virus (0.1μM, probe concentration 0.1μM), and West Nile virus (0.3μM, primer concentration 0.1μM, probe concentration 0.1μM) were determined using reaction arrays. The optimal temperatures for West Nile virus were 55.6℃, primer concentration 0.1μM, and probe concentration 0.3μM. These values ​​differed significantly from neighboring values, necessitating further optimization.

[0142] Table 4-1 Optimization of Annealing Temperatures for DENV, JEV, ZIKV, and WNV

[0143]

[0144] Table 4-2 Optimization of DENV primer and probe concentrations

[0145]

[0146] Table 4-3 Optimization of JEV primer and probe concentrations

[0147]

[0148] Table 4-4 Optimization of ZIKV primer and probe concentrations

[0149]

[0150] Table 4-5 Optimization of WNV primer and probe concentrations

[0151]

[0152] Based on the results in Tables 4-1 to 4-5, primer concentration ranges (0.1-0.2 μM) and probe concentration ranges (0.2-0.3 μM) with lower CT values ​​for four viral genotypes were selected. A single-factor analysis was performed, establishing 81 concentration combinations, and the optimal concentration ratio was selected. Six annealing temperature gradients (55.6℃–63.6℃) were then used for optimization. The optimized primer concentration, probe concentration, and annealing temperature results are shown below. Figures 1 to 3 As shown.

[0153] according to Figures 1 to 3 The results showed that the primer concentration for dengue virus was 0.2 μM and the probe concentration was 0.2 μM; the primer concentration for Japanese encephalitis virus was 0.1 μM and the probe concentration was 0.3 μM; the primer concentration for Zika virus was 0.1 μM and the probe concentration was 0.2 μM; and the primer concentration for West Nile virus was 0.1 μM and the probe concentration was 0.3 μM. The annealing temperature was 63.1℃.

[0154] Based on the above optimization conditions, a concentration of 1×10⁻⁶ was selected. 0 ~1×10 10 Using standard plasmids of copies / μL as templates, a standard curve for real-time PCR was established, and the results are as follows: Figure 4 As shown in the figure. The X-axis represents the copy number logarithm of the plasmid standard, and the Y-axis represents the CT value detected by the plasmid standard.

[0155] Figure 4 In the DENV standard curve, Y = -2.8756X + 35.312, R0 2 =0.9933; JEV standard curve Y = -3.1503X + 35.610, R 2 =0.9909; ZIKV standard curve Y = -3.3412X + 37.603, R 2 =0.9908; WNV standard curve Y = -2.8049X + 33.544, R 2 =0.9911.

[0156] Example 3

[0157] This embodiment uses the kit provided in Example 1 to quantitatively detect dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus samples, including the following steps:

[0158] I. Materials and Methods

[0159] 1. Sample preparation and viral DNA acquisition

[0160] Sample preparation: Plasmid standards for dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were all constructed in our laboratory, and the plasmids were successfully bidirectionally sequenced by Qingke Biotechnology Co., Ltd. The method for preparing virus samples was as follows: Virus-susceptible cells were cultured at 25 cm⁻¹. 2 After the cells form a dense monolayer in the culture flask, they are inoculated with the virus, cultured until the virus proliferates, and then cell samples are collected.

[0161] Viral DNA Acquisition: RNA template was extracted using the Trizol method: Cells in each 6-well plate were lysed with 1 ml of Trizol reagent to extract RNA. The concentration of the extracted RNA was determined, and the following were added sequentially to a PCR tube: 2 μL of ABScript II Enzyme Mix (10X), 10 μL of ABScript II Reaction Mix (2X), 1 μL of 10 mM dNTPs, 2 μL of Primer, and 1 μg of RNA template. Water was then added to a final volume of 20 μL. The tube was incubated at 25°C for 5 min and then at 42°C for 1 h. The cDNA was collected and stored at 20°C for later use. 2 μL of cDNA was used as template DNA for the test samples. Positive and negative controls were included in each test.

[0162] 2. Prepare the PCR reaction system: Prepare the PCR reaction system according to the dosage shown in Table 5. The total volume of the reaction system is 10 μL.

[0163] Table 5 PCR reaction system

[0164]

[0165]

[0166] Add the PCR reaction mixture prepared using the above ratio to a 384-well plate and centrifuge briefly.

[0167] 3. Quantitative Real-Time PCR Amplification

[0168] Place the sealed PCR reaction plate in QuantStudio TM PCR amplification was performed using the Real-Time PCR Software amplification system. The quantitative PCR amplification reaction conditions were: incubation at 50℃ for 2 min, denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing at 63.1℃ for 1 min, for a total of 40 cycles.

[0169] 4. Read the fluorescence signal

[0170] After the PCR amplification reaction, in QuantStudio TMIn the Real-Time PCR Software reading and analysis system, dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were detected in the VIC, Cy5, FAM, and ROX channels, respectively, using the instrument's accompanying QuantStudio. TM Real-Time PCR Software was used for quantitative analysis to calculate the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus.

[0171] II. Judgment of Results

[0172] 1. Quality control standards

[0173] Negative control: The negative control is defined as having no signal or a CT value ≥35 in the VIC, FAM, Cy5 and ROX channels.

[0174] Positive controls: Dengue virus positive control was detected in the VIC channel (meaning dengue virus was detected in the VIC channel); Japanese encephalitis virus positive control was detected in the Cy5 channel (meaning Japanese encephalitis virus was detected in the Cy5 channel); Zika virus positive control was detected in the FAM channel (meaning Zika virus was detected in the FAM channel); West Nile virus positive control was detected in the ROX channel (meaning West Nile virus was detected in the ROX channel). Based on a quantitative fluorescence CT value <35, the results were verified using the instrument's QuantStudio... TM Real-Time PCR Software was used to construct standard curves and calculate the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus.

[0175] If either the positive or negative control fails to meet the standard, the test is invalid.

[0176] 2. Judgment Results

[0177] Standard curve:

[0178] A standard curve was plotted with the measured CT value of the standard sample on the ordinate and the logarithm of the copy number of the standard sample on the abscissa. Linear regression was then performed to obtain the regression equation.

[0179] Calculation of viral copy number in sample:

[0180] The CT value of the sample was measured and substituted into the regression equation of the standard curve to calculate the viral copy number in the sample. The results are shown in Table 6.

[0181] Table 6. Detection of DENV, JEV, ZIKV, and WNV viruses.

[0182]

[0183] Example 4

[0184] This embodiment tests the sensitivity, specificity, and repeatability of the kit provided in Example 1. The specific methods are as follows:

[0185] 1. Sensitivity test of the reagent kit

[0186] Based on the previously optimized conditions, a concentration of 1×10⁻⁶ was selected. 0 ~1×10 10 Using standard plasmids of copies / μL as templates, the sensitivity of each virus to quantitative real-time PCR was detected. Quantitative real-time PCR and conventional PCR experiments were performed simultaneously. Copy number results are shown in Table 7, and amplification curves and PCR gel images are shown below. Figure 5 As shown.

[0187] Table 7 Sensitivity of DENV\JEV\ZIKV\WNV Quantitative PCR and PCR

[0188]

[0189] As shown in Table 7, using the standard plasmid as a template, the limit of detection for DENV quantitative PCR is 1×10⁻⁶. 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 4 copies / μL; the limit of detection for JEV quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 2 copies / μL; the limit of detection for ZIKV quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 0 copies / μL; the limit of detection for WNV quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 2 The copies / μL indicates that the detection method provided in this application has a significantly lower limit of detection than conventional PCR, and thus exhibits higher sensitivity.

[0190] 2. Specificity test of the kit

[0191] Plasmid standards for dengue virus, Japanese encephalitis virus, Zika virus, West Nile virus, yellow fever virus, vesicular stomatitis virus, Rift Valley fever virus, Chikungunya virus, Banna virus, and Geita virus were diluted to appropriate concentrations. DNA templates for dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were obtained. The specificity of quantitative real-time PCR for the plasmid standards and viruses was detected. The average Ct values ​​and copy numbers are shown in Table 8. The specificity results are illustrated in the bar chart below. Figure 6 As shown.

[0192] Table 8 Results of mosquito-borne virus specificity tests

[0193]

[0194]

[0195] From Table 8 and Figure 6 It can be seen that, except for the target gene which has a low CT value, the other templates have high CT values ​​or are not detected, indicating that the probe has good specificity.

[0196] 3. Repeatability test of the kit

[0197] Take a concentration of 1×10 8 copies / μL, 1×10 6 copies / μL, 1×10 4 Using the standard sample of copies / μL as a template, repeatability tests were conducted, and the coefficients of variation within and between plates were calculated. The results are shown in Table 9.

[0198] Table 9 Repeatability Tests for Multiplex Quantitative PCR

[0199]

[0200] As shown in Table 9, the coefficient of variation within groups is between 0.30% and 2.01%, and the coefficient of variation between groups is between 0.38% and 1.55%, both less than 3%, indicating that the detection method provided in this application has good repeatability.

[0201] In summary, this application provides a multiplex quantitative PCR detection kit for mosquito-borne viruses and its detection method. The detection kit includes a multiplex PCR reaction solution, a positive control, and a negative control. The multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, respectively. The detection method includes sample extraction, preparation of the PCR mixture of reagents, PCR amplification, and fluorescence signal reading. Through the above methods, this application can specifically identify dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus. By combining a standard curve, it can quantitatively detect dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, with high detection efficiency, stable implementation, simple and rapid operation, high detection speed, and high detection accuracy and sensitivity.

[0202] It should be noted that this application is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments with the same structure and effect as the technical concept within the scope of this application are included in the technical scope of this application. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of this application, are also included in the scope of this application.

Claims

1. A mosquito-borne virus multiplex real-time PCR detection kit, characterized in that, The kit comprises a multiplex PCR reaction solution, positive quality control and negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus, respectively; The four specific probes comprise: a dengue virus probe as shown in SEQ ID NO: 1; a Japanese encephalitis virus probe as shown in SEQ ID NO: 2; a Zika virus probe as shown in SEQ ID NO: 3; a West Nile virus probe as shown in SEQ ID NO: 4; the 5' end fluorescent reporter group of the dengue virus probe is VIC, and the 3' end fluorescent quencher group is MGB; the 5' end fluorescent reporter group of the Japanese encephalitis virus probe is Cy5, and the 3' end fluorescent quencher group is MGB; the 5' end fluorescent reporter group of the Zika virus probe is FAM, and the 3' end fluorescent quencher group is MGB; the 5' end fluorescent reporter group of the West Nile virus probe is ROX, and the 3' end fluorescent quencher group is MGB; The four pairs of specific primers comprise: a dengue virus upstream primer as shown in SEQ ID NO: 5 and a dengue virus downstream primer as shown in SEQ ID NO: 6; a Japanese encephalitis virus upstream primer as shown in SEQ ID NO: 7 and a Japanese encephalitis virus downstream primer as shown in SEQ ID NO: 8; a Zika virus upstream primer as shown in SEQ ID NO: 9 and a Zika virus downstream primer as shown in SEQ ID NO: 10; a West Nile virus upstream primer as shown in SEQ ID NO: 11 and a West Nile virus downstream primer as shown in SEQ ID NO:

12.

2. The mosquito-borne virus multiplex real-time PCR assay kit according to claim 1, characterized by, The positive quality control comprises dengue virus positive quality control, Japanese encephalitis virus positive quality control, Zika virus positive quality control and West Nile virus positive quality control; the dengue virus positive quality control is a plasmid solution carrying a dengue virus gene fragment; the Japanese encephalitis virus positive quality control is a plasmid solution carrying a Japanese encephalitis virus gene fragment; the Zika virus positive quality control is a plasmid solution carrying a Zika virus gene fragment; and the West Nile virus positive quality control is a plasmid solution carrying a West Nile virus gene fragment.

3. The mosquito-borne virus multiplex real-time PCR assay kit according to claim 1, characterized by, The negative control is nuclease-free water.

4. The mosquito-borne virus multiplex real-time PCR assay kit according to claim 1, characterized by, The multiplex PCR reaction solution further comprises 2xPerfeCT qPCR ToughMix UNG.

5. A method for detecting mosquito-borne virus by multiplex real-time PCR, wherein the kit according to any one of claims 1 to 4 is used for detection. The detection method is used for non-diagnostic purposes, comprising the following steps: S1. Extracting the RNA template of the sample to be tested, and reversing it into a DNA template as the sample to be tested; S2. Adding the multiplex PCR reaction solution in the kit to the sample to be tested to prepare a PCR mixture for detection; S3. Performing PCR amplification on the PCR mixture for detection; S4. After completing the PCR amplification, reading the fluorescence signal and calculating the copy number of dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus.

6. The method according to claim 5, wherein the mosquito-borne virus is selected from the group consisting of dengue virus, Zika virus, chikungunya virus, and Japanese encephalitis virus. The volume concentration of the sample to be detected in the PCR mixture of the drug to be detected is 20%; the concentration of the dengue virus probe is 0.2 mu M, the concentrations of the upstream primer and the downstream primer of the dengue virus are both 0.2 mu M; the concentration of the Japanese B encephalitis virus probe is 0.3 mu M, the concentrations of the upstream primer and the downstream primer of the Japanese B encephalitis virus are both 0.1 mu M; the concentration of the Zika virus probe is 0.2 mu M, the concentrations of the upstream primer and the downstream primer of the Zika virus are both 0.1 mu M; and the concentration of the West Nile virus probe is 0.3 mu M, the concentrations of the upstream primer and the downstream primer of the West Nile virus are both 0.1 mu M.

7. The method according to claim 5, wherein the mosquito-borne virus is selected from the group consisting of dengue virus, Japanese encephalitis virus, West Nile virus, yellow fever virus, and Chikungunya virus. When the PCR amplification is performed, the annealing temperature is set to 63-64 DEG C.

Images