Novel phosphoenolpyruvate carboxylase variants and method for producing 5 '-inosinic acid using same

Abstract

The present invention relates to a novel phosphoenolpyruvate carboxylase variant and a method for producing 5 '-inosinic acid using the same. The phosphoenolpyruvate carboxylase variant has modified protein activity due to the substitution of one or more amino acids in the amino acid sequence constituting the phosphoenolpyruvate carboxylase, and thus the recombinant microorganism comprising the phosphoenolpyruvate carboxylase variant can efficiently produce 5 '-inosinic acid.

Description

Technical Field

[0001] The present invention relates to novel phosphoenolpyruvate carboxylase variants and methods for producing 5'-inosinic acid using the same. Background Art

[0002] 5'-inosinic acid (or inosine monophosphate (IMP)) is an intermediate in the nucleic acid biosynthesis metabolic system, and it not only plays an important physiological role in plants and animals, but is also used in a variety of applications, including food, drugs, and various medical applications. In particular, 5'-inosinic acid is a nucleic acid-based condiment that has attracted much attention as a salty condiment due to its significant synergistic effect on taste when used with monosodium glutamate (MSG).

[0003] Methods for producing 5'-inosinic acid include enzymatic degradation of ribonucleic acid extracted from yeast cells, chemical phosphorylation of inosine produced by fermentation, etc. Recently, a method of culturing a microorganism producing 5'-inosinic acid and recovering the 5'-inosinic acid accumulated in the culture medium is mainly used.

[0004] For the production of 5'-inosinic acid using microorganisms, in order to improve the efficiency of producing 5'-inosinic acid, by applying genetic recombination technology to microorganisms (e.g., Escherichia coli and Corynebacterium) widely used to produce useful substances such as nucleic acids or L-amino acids, a variety of recombinant strains or mutant strains with excellent 5'-inosinic acid productivity have been developed, as well as methods for producing 5'-inosinic acid using them. In particular, attempts have been made to increase the production of 5'-inosinic acid by targeting genes such as enzymes, transcription factors, and transporters involved in the 5'-inosinic acid biosynthetic pathway, or by inducing promoter mutations that regulate the expression of these genes. However, there are tens to hundreds of types of proteins (e.g., enzymes, transcription factors, and transporters) that are directly or indirectly involved in the production of 5'-inosinic acid, and therefore a large amount of research is still needed to increase the productivity of 5'-inosinic acid by changing the activity of these proteins.

[0005] [Prior art literature]

[0006] [Patent Document]

[0007] Korean Patent No.10-116602 Summary of the invention

[0008] Technical issues

[0009] One object of the present invention is to provide novel phosphoenolpyruvate carboxylase variants.

[0010] Another object of the present invention is to provide a polynucleotide encoding the variant.

[0011] Another object of the present invention is to provide a transformant comprising the variant or polynucleotide.

[0012] Another object of the present invention is to provide a method for producing 5'-inosinic acid using the transformant.

[0013] Technical Solution

[0014] One aspect of the present invention provides a phosphoenolpyruvate carboxylase variant, wherein one or more amino acids at positions 472 and 673 in the amino acid sequence of SEQ ID NO: 4 are replaced by other amino acids.

[0015] The term "phosphoenolpyruvate carboxylase" used in the present invention catalyzes the reaction of removing carbon dioxide from phosphoenolpyruvate, and may be a polypeptide or protein consisting of the amino acid sequence of SEQ ID NO: 4 and having phosphoenolpyruvate carboxylase activity.

[0016] Information on the nucleic acid and protein sequences of phosphoenolpyruvate carboxylase can be obtained from known sequence databases (eg, GenBank, UniProt).

[0017] According to one embodiment of the present invention, the phosphoenolpyruvate carboxylase may be encoded by the nucleotide sequence of SEQ ID NO:3.

[0018] The amino acid sequence of phosphoenolpyruvate carboxylase according to the present invention or the nucleotide sequence encoding it can include an amino acid sequence or nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity to the amino acid sequence of SEQ ID NO:4 or the nucleotide sequence of SEQ ID NO:3. The term "homology" or "identity" as used herein means the percentage of identity between two sequences, which is determined by comparing a reference nucleotide sequence or amino acid sequence with any other nucleotide sequence or amino acid sequence to correspond to each other as much as possible and analyzing the compared sequences.

[0019] According to one embodiment of the present invention, the phosphoenolpyruvate carboxylase may be derived from wild-type Corynebacterium stationis.

[0020] The term "variant" used in the present invention refers to a protein having an amino acid sequence different from the amino acid sequence before the mutation, but retaining the function or characteristics of the protein before the mutation, and the mutation is caused by a mutation in the nucleotide sequence of the gene encoding the protein by conservative replacement and / or modification of one or more amino acids at the N-terminus, C-terminus and / or inside the amino acid sequence. The term "conservative replacement" used herein means replacing an amino acid with another amino acid having similar structure and / or chemical properties. Conservative replacement may have little or no effect on the activity of a protein or polypeptide. In addition, the term "modification" refers to the replacement, insertion, deletion, etc. of one or more amino acids. The amino acids are selected from alanine (Ala, A), isoleucine (Ile, I), valine (Val, V), leucine (Leu, L), methionine (Met, M), asparagine (Asn, N), cysteine ​​(Cys, C), glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), glutamic acid (Glu, E), arginine (Arg, R), histidine (His, H), lysine (Lys, K), glycine (Gly, G) and proline (Pro, P).

[0021] Additionally, some variants include those in which one or more portions (eg, an N-terminal leader sequence or a transmembrane region) have been removed, or those in which a portion has been removed from the N-terminus and / or C-terminus of the mature protein.

[0022] Compared to the protein before mutation, the variant may have an improved (enhanced), unchanged or reduced (weakened) ability. Here, the term "increase or enhance" includes: a situation in which the activity of the protein itself is improved compared to the activity of the protein before mutation; a situation in which the overall activity of the protein in the cell is higher than those in the wild-type strain or the strain expressing the protein before mutation due to increased expression or translation of the gene encoding the protein; and combinations of these. In addition, the term "reduced or weakened" includes: a situation in which the activity of the protein itself is reduced compared to the activity of the protein before mutation; a situation in which the overall activity of the protein in the cell is lower than those in the wild-type strain or the strain expressing the protein before mutation due to reduced expression or translation of the gene encoding the protein; and combinations of these. In the present invention, the term "variant" can be used interchangeably with terms such as variant type, modification, variant polypeptide, mutated protein, mutant, etc.

[0023] According to one embodiment of the present invention, the variant may consist of the amino acid sequence of SEQ ID NO: 2, wherein the proline at position 472 in the amino acid sequence of SEQ ID NO: 4 is replaced by serine, and the glycine at position 673 is replaced by aspartic acid.

[0024] More specifically, the phosphoenolpyruvate carboxylase variant may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the amino acid sequence of SEQ ID NO:2.

[0025] Another aspect of the present invention provides a polynucleotide encoding a phosphoenolpyruvate carboxylase variant.

[0026] The term "polynucleotide" used in the present invention refers to a DNA or RNA chain of a certain length or longer, which is a long-chain polymer of nucleotides formed by connecting nucleotide monomers by covalent bonds. More specifically, the term "polynucleotide" refers to a polynucleotide fragment encoding a variant.

[0027] According to one embodiment of the present invention, the polynucleotide may comprise a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2.

[0028] More specifically, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide "c" at position 1414 in the nucleotide sequence of SEQ ID NO: 3 encoding phosphoenolpyruvate carboxylase is replaced by a nucleotide "t", and the nucleotide "g" at position 2018 is replaced by a nucleotide "a".

[0029] Yet another aspect of the present invention provides a vector comprising a polynucleotide encoding a phosphoenolpyruvate carboxylase variant.

[0030] Still another aspect of the present invention provides a transformant comprising the phosphoenolpyruvate carboxylase variant or polynucleotide.

[0031] The term "vector" used in the present invention refers to any type of nucleic acid sequence transfer structure used as a means for transferring and expressing a target gene in a host cell. Unless otherwise indicated, the term "vector" may mean a vector allowing the nucleic acid sequence contained therein to be expressed after being inserted into the host cell genome and / or a vector allowing the nucleic acid sequence to be expressed independently. The vector comprises the necessary regulatory elements operably connected so that the inserted gene can be expressed. The term "operably connected" used herein means that the target gene and its regulatory sequence are functionally connected together in a manner that enables the gene to be expressed, and "regulatory elements" include a promoter for initiating transcription, any operon sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0032] The vector in the present invention is not particularly limited as long as it can be replicated in a host cell, and any vector known in the art can be used. Some examples of vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. Some examples of phage vectors or cosmid vectors include but are not limited to pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A and Charon21A, and some examples of plasmid vectors include but are not limited to pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series and pET series.

[0033] Vectors can be constructed as vectors for cloning or for expression. The vectors for expression can be conventional vectors used in the art for expressing foreign genes or proteins in plants, animals or microorganisms, and can be constructed by various methods known in the art.

[0034] The term "recombinant vector" used in the present invention can be transformed into a suitable host cell and can then be replicated without being affected by the host cell genome, or can be integrated into the genome itself. In this case, the "suitable host cell" may contain a replication origin, which is a specific nucleotide sequence that enables the vector to replicate in a suitable host cell and to start replication from it. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, the vector generally contains a strong promoter (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) that can promote transcription; a ribosome binding site for initiating translation and a transcription / translation termination sequence. When a eukaryotic cell is used as a host, the vector contains a replication origin that is manipulated in the eukaryotic cell, and some examples of the replication origin include, but are not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the glandular replication origin, the AAV replication origin, and the BBV replication origin. In addition, the recombinant vector may contain a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV-tk promoter, etc.), and usually has a polyadenylation sequence as a transcription termination sequence.

[0035] Recombinant vectors may include a selection marker. The selection marker is used to select a transformant (host cell) transformed with the vector, and since only cells expressing the selection marker can survive in a culture medium treated with the selection marker, the transformed cells can be selected. Some representative examples of selection markers include, but are not limited to, kanamycin, streptomycin and chloramphenicol.

[0036] Transformants can be produced by inserting a recombinant vector into a host cell, and transformants can be obtained by introducing a recombinant vector into an appropriate host cell. A host cell is a cell capable of stably and continuously cloning or expressing an expression vector, and any host cell known in the art can be used.

[0037] In the case where the vector is transformed into a prokaryotic cell to produce a recombinant microorganism, some examples of host cells that can be used include, but are not limited to: E. coli sp. strains, such as E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, and E. coli XL1-Blue; Bacillus sp. strains, such as Bacillus subtilis and Bacillus thuringiensis; Corynebacterium sp. strains, such as Corynebacterium glutamicum and Corynebacterium stagnantum; and various Enterobacteriaceae strains, such as Salmonella typhimurium, Serratia marcescens, and Salmonella typhimurium. marcescens and Pseudomonas species.

[0038] In the case where the vector is transformed into a eukaryotic cell to produce a recombinant microorganism, some examples of host cells that can be used include, but are not limited to, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines.

[0039] The term "transformation" used in the present invention refers to a phenomenon in which foreign DNA is introduced into a host cell, thereby artificially causing genetic changes, and the term "transformant" refers to a host cell into which foreign DNA has been introduced and in which expression of a target gene is stably maintained.

[0040] The transformation can be carried out using a suitable vector introduction technique selected according to the host cell, so that the target gene or the recombinant vector containing it can be expressed in the host cell. For example, the introduction of the vector can be carried out by the following: electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method or any combination thereof, but not limited to this. As long as the transformed gene can be expressed in the host cell, it can be inserted into the chromosome of the host cell, or can be present outside the chromosome, but not limited to this.

[0041] The transformant may include a cell transfected, transformed or infected with the recombinant vector of the present invention in vivo or in vitro, and may be used in the same meaning as a recombinant host cell, a recombinant cell or a recombinant microorganism.

[0042] The gene inserted into the recombinant vector of the present invention can be cross-introduced into a host cell, such as a Corynebacterium strain, by homologous recombination.

[0043] According to one embodiment of the present invention, the transformant may be a microorganism of the genus Corynebacterium.

[0044] The microorganism of the genus Corynebacterium may be, but is not limited to, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficientens, Corynebacterium uterequi, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freundii, Corynebacterium spheniscorum ... freiburgense), Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, or Corynebacterium flavescens.

[0045] The transformant in the present invention can be: a strain comprising the above-mentioned phosphoenolpyruvate carboxylase variant or a polynucleotide encoding it or a vector containing a phosphoenolpyruvate carboxylase variant; a strain expressing a phosphoenolpyruvate carboxylase variant or a polynucleotide; or a strain having phosphoenolpyruvate carboxylase variant activity, but is not limited thereto.

[0046] In addition to the phosphoenolpyruvate carboxylase variant, the transformant of the present invention may also contain other protein variants or genetic mutants.

[0047] According to one embodiment of the present invention, the transformant may have the ability to produce 5'-inosinic acid.

[0048] 5'-Inosinic acid is a nucleic acid-based compound that imparts flavor to foods, especially an umami (salty) taste, and it is used in the same sense as inosine monophosphate (IMP).

[0049] The transformant may naturally have the ability to produce 5'-inosinic acid, or may be a transformant to which the ability to produce 5'-inosinic acid has been artificially imparted.

[0050] According to one embodiment of the present invention, the transformant may have an improved ability to produce 5'-inosinic acid due to a change in the activity of phosphoenolpyruvate carboxylase.

[0051] The term "increased production capacity" used in the present invention means that the 5'-inosinic acid productivity is improved compared to the 5'-inosinic acid productivity of the parent strain. The term "parent strain" used herein refers to a wild-type strain or a mutant strain to be mutated, and includes strains to be directly mutated or transformed with a recombinant vector, etc. In the present invention, the parent strain can be a wild-type Corynebacterium strain or a Corynebacterium strain mutated from a wild-type microorganism.

[0052] The transformant according to the present invention exhibits an improved ability to produce 5'-inosinic acid due to the change in phosphoenolpyruvate carboxylase activity caused by the introduction of the phosphoenolpyruvate carboxylase variant therein, compared to the parent strain. More specifically, the amount of 5'-inosinic acid produced by the transformant may be at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% higher than the amount of 5'-inosinic acid produced by the parent strain, or may be 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, or 10 times higher than the amount of 5'-inosinic acid produced by the parent strain, but is not limited thereto. For example, the amount of 5'-inosinic acid produced by the transformant comprising the phosphoenolpyruvate carboxylase variant may be at least 5%, specifically 5% to 50% (preferably 10% to 40%) higher than that produced by the parent strain.

[0053] Still another aspect of the present invention provides a method for producing 5'-inosinic acid, comprising the steps of: culturing a transformant in a culture medium; and recovering 5'-inosinic acid from the transformant or from the culture medium in which the transformant was cultured.

[0054] Suitable culture media and culture conditions known in the art can be used for cultivation, and those skilled in the art can easily adjust and use culture media and culture conditions. Specifically, the culture medium can be a liquid culture medium, but is not limited thereto. Some examples of culture methods include, but are not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0055] According to one embodiment of the present invention, the culture medium should meet the requirements of the specific strain in an appropriate manner, and can be appropriately modified by those skilled in the art. For the culture medium of Escherichia sp. strains, reference can be made to known literature (Manual of Methods for General Bacteriology, American Society for Bacteriology, Washington DC, USA, 1981), but it is not limited thereto.

[0056] According to one embodiment of the present invention, the culture medium may include a variety of carbon sources, nitrogen sources and trace element components. Some examples of usable carbon sources include: sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose; oils and fats, such as soybean oil, sunflower oil, castor oil and coconut oil; fatty acids, such as palmitic acid, stearic acid and linoleic acid; alcohols, such as glycerol and ethanol; and organic acids, such as acetic acid. These substances can be used alone or as a mixture, but are not limited to this. Some examples of usable nitrogen sources include peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal, urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used alone or as a mixture, but are not limited to this. Some examples of usable phosphorus sources include but are not limited to potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or corresponding sodium-containing salts. In addition, the culture medium may include but is not limited to metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, the culture medium may include necessary growth substances, such as amino acids and vitamins. In addition, a suitable precursor may be used in the culture medium.The culture medium or individual components may be added to the culture medium in batches or in a continuous manner by a suitable method during the culture, but is not limited thereto.

[0057] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microbial culture medium in an appropriate manner during the culture period. In addition, during the culture period, defoamers such as fatty acid polyethylene glycol esters can be used to suppress foaming. In addition, in order to maintain the culture medium under aerobic conditions, oxygen or oxygen-containing gas (for example, air) can be injected into the culture medium. The temperature of the culture medium can generally be 20 ℃ to 45 ℃, for example 25 ℃ to 40 ℃. Can continue to cultivate until the desired amount of useful substances is produced. For example, the culture time can be 10 hours to 160 hours.

[0058] According to one embodiment of the present invention, in the step of recovering 5'-inosinic acid from the cultured transformant or from the culture medium in which the transformant is cultured, the produced 5'-inosinic acid can be collected or recovered from the culture medium according to the culture method using a suitable method known in the art. Some examples of methods that can be used to recover the produced 5'-inosinic acid include, but are not limited to, centrifugation, filtration, extraction, spraying, Drying, evaporation, precipitation, crystallization, electrophoresis, fractionated solubility (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), and the like.

[0059] According to one embodiment of the present invention, the step of recovering 5'-inosinic acid may be performed by centrifuging the culture medium at a low speed to remove biomass and separating the obtained supernatant by ion exchange chromatography.

[0060] According to one embodiment of the present invention, the step of recovering 5'-inosinic acid may include a process of purifying 5'-inosinic acid.

[0061] Beneficial Effects

[0062] The phosphoenolpyruvate carboxylase variant according to the present invention is obtained by replacing one or more amino acids in the amino acid sequence constituting phosphoenolpyruvate carboxylase to change the activity of the protein, and a recombinant microorganism comprising the phosphoenolpyruvate carboxylase variant can efficiently produce 5'-inosinic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 The structure of the pK19msb plasmid according to one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0064] Hereinafter, the present invention will be described in more detail. However, this description is presented only by way of example to facilitate understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0065] Example 1. Construction of strains expressing phosphoenolpyruvate carboxylase variants

[0066] In order to evaluate the effect of a variant (SEQ ID NO: 2) in which proline (P) at position 472 was replaced by serine (S) and glycine (G) at position 673 was replaced by aspartic acid (D) in the amino acid sequence of phosphoenolpyruvate carboxylase (SEQ ID NO: 4) on the production of 5'-inosinic acid, the present inventors constructed a vector for expressing the phosphoenolpyruvate carboxylase variant and a strain introduced with the vector.

[0067] 1-1. Construction of vector for expressing phosphoenolpyruvate carboxylase variants

[0068] Using the genomic DNA of wild-type Corynebacterium stagnans ATCC6872 as a template, PCR was performed using a primer pair of primers 1 and 2. The PCR fragment and pK19msb plasmid (SEQ ID NO: 5) were treated with restriction enzyme smaI (NEB) and ligated together using T4 ligase. The resulting plasmid was named pK_PC.

[0069] PCR amplification was performed using Pfu PreMix (Bioneer) under the following conditions: denaturation at 95°C for 5 minutes, followed by 30 cycles, each cycle consisting of 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute and 30 seconds, followed by reaction at 72°C for 5 minutes.

[0070] The primer sequences used for plasmid construction are shown in Table 1 below.

[0071] [Table 1]

[0072] Primer name SEQ ID NO. Primer sequence (5′-3′) Primer 1 6 CTCTGCTCGCTCACTGGTCT Primer 2 7 TACTCGCTGTGTCGTAGCGGG

[0073] 1-2. Construction of a mutant strain into which a phosphoenolpyruvate carboxylase variant is introduced

[0074] The electrocompetent cell preparation method (a modified version of the method of van der Rest et al.) was used as the method for transforming Corynebacterium stasis KCCM13339P.

[0075] First, the stagnant coryneform bacteria KCCM13339P was primary cultured in 10 mL 2YT medium (containing 16 g / l tryptone, 10 g / l yeast extract and 5 g / l sodium chloride) supplemented with 2% glucose to prepare a seed culture. Isonicotinic acid hydrazine and 2.5% glycine at a concentration of 1 mg / ml were added to 100 ml of 2YT medium without glucose. Then, the seed culture was inoculated into the 2YT medium to make the OD 610 The OD value reached 0.3, and then the culture was continued at 30°C and 180 rpm for 5 to 8 hours until the OD 610The competent cells of KCCM13339P of precipitate are washed 4 times with 10% glycerol solution, and finally be resuspended in the 10% glycerol solution of 0.5ml, thereby prepare competent cells.Bio-Rad electroporator is used to carry out electroporation.The competent cells of preparation and the pK_PC carrier of structure are placed in electroporation cup (0.2mm), and electroporation is carried out under the condition of 2.5kV, 200Ω and 12.5μF subsequently.After electroporation is completed, in cell, add 1ml regeneration (RG) culture medium (containing 18.5g / l brain heart infusion (brain heart infusion) and 0.5M sorbitol) immediately, then cell is heat-treated 6 minutes at 46 ℃. Then, the cells were cooled at room temperature, transferred to a 15 ml cap tube, incubated at 30°C for 2 hours, and plated on a selection medium (containing 5 g / l tryptone, 5 g / l NaCl, 2.5 g / l yeast extract, 18.5 g / l brain heart infusion powder, 15 g / l agar, 91 g / l sorbitol, and 20 μg / l kanamycin). The cells were cultured at 30°C for 72 hours, and the resulting colonies were cultured in the medium until the stationary phase to induce secondary recombination. Then, the cells were diluted to 10 -5 Up to 10 -7 , and plated onto antibiotic-free plate medium (containing 10% sucrose), and the strain that had no kanamycin resistance and could grow on the medium containing 10% sucrose was selected and named IPC-1.

[0076] Experimental Example 1. Evaluation of 5'-inosinic acid productivity of strains expressing phosphoenolpyruvate carboxylase variants

[0077] The 5'-inosinic acid productivity was compared between the parent strain KCCM13339P and the mutant strain IPC-1 into which the phosphoenolpyruvate carboxylase variant was introduced.

[0078] Each strain (parent strain or mutant strain) was inoculated into a 100 mL flask containing 10 mL of the medium for 5'-inosinic acid production shown in Table 2 below at 1% volume, and cultured at 34° C. with shaking at 200 rpm for 45 hours. After the culture was completed, the concentration of 5'-inosinic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0079] [Table 2]

[0080]

[0081]

[0082] [Table 3]

[0083] strain 5'-Inosinic acid production (g / L) KCCM13339P 20.0 IPC-1 23.2

[0084] As shown in Table 3 above, it was confirmed that the amount of 5'-inosinic acid produced by the mutant strain into which the phosphoenolpyruvate carboxylase variant was introduced was increased by about 16% compared to the amount of 5'-inosinic acid produced by the parent strain, due to the replacement of the amino acids at positions 472 and 673 with other amino acids. These results indicate that the introduction of point mutations in phosphoenolpyruvate carboxylase provides a significant effect on 5'-inosinic acid productivity.

[0085] So far, the present invention has been described with reference to some preferred embodiments. It will be appreciated by those skilled in the art that the present invention may be implemented in modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative perspective rather than a restrictive perspective. The scope of the present invention is defined by the claims rather than the above description, and all differences within the scope equivalent thereto should be interpreted as included in the present invention.

[0086] [Registration Number]

[0087] Depository: Korean Culture Center of Microorganisms (KCCM)

[0088] Registration number: KCCM13339P

[0089] Deposit date: March 29, 2023

[0090]

[0091]

Claims

1. A phosphoenolpyruvate carboxylase variant, wherein one or more amino acids at positions 472 and 673 in the amino acid sequence of SEQ ID NO: 4 are replaced by other amino acids.

2. The phosphoenolpyruvate carboxylase variant of claim 1, which consists of the amino acid sequence of SEQ ID NO: 2, wherein the proline at position 472 in the amino acid sequence of SEQ ID NO: 4 is replaced by serine, and the glycine at position 673 is replaced by aspartic acid.

3. A polynucleotide encoding the variant according to claim 1.

4. A transformant comprising the variant according to claim 1 or the polynucleotide according to claim 3. The transformant according to claim 4, which is a microorganism belonging to the genus Corynebacterium. The transformant according to claim 4 , which has the ability to produce 5′-inosinic acid.

7. A method for producing 5'-inosinic acid, comprising the following steps: Cultivating the transformant according to claim 4 in a culture medium; and 5'-inosinic acid is recovered from the transformant or from the medium in which the transformant is cultured.

Images