Method for improving glutamic acid yield of corynebacterium glutamicum through metabolic engineering modification

Abstract

The invention discloses a method for improving the yield of glutamic acid of corynebacterium glutamicum through metabolic engineering transformation, and belongs to the field of metabolic engineering and synthetic biology. According to the corynebacterium glutamicum provided by the invention, the expression of glutamate dehydrogenase and glutamate synthase is enhanced, isocitrate lyase is knocked out, and the carbon flow of glyoxylic acid circulation is weakened; the expression of transcription factors RosR, NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase and pyruvate kinase is enhanced, the yield of glutamic acid is further increased, and finally the fermentation process is optimized. When the recombinant corynebacterium glutamicum provided by the invention is used for fed-batch fermentation in a 5L fermentation tank for 32 hours, the yield of glutamic acid reaches 230.57 g / L, and the sugar-acid conversion rate is 76.2%.

Description

Technical Field

[0001] The present invention belongs to the fields of metabolic engineering and synthetic biology, and particularly relates to a method for improving the glutamic acid production of Corynebacterium glutamicum by metabolic engineering transformation. Background Art

[0002] Glutamic acid is the world's largest amino acid product, which is widely used in seasonings such as monosodium glutamate. It is also widely used in the production of chemicals, pharmaceuticals, health foods, and is an important raw material for other amino acid products.

[0003] At present, the breeding research on glutamic acid-producing strains at home and abroad mainly focuses on: using technical means such as metabolic engineering theory, flux analysis in metabolic network models, and modern molecular biology to study the physiological characteristics of glutamic acid-producing strains and the key nodes of glutamic acid synthesis. At the same time, genomic sequencing comparison of high-glutamic acid-producing strains is carried out through genomics means and transcriptomics analysis techniques, and they are analyzed using molecular biology techniques to study the effects of genomic changes on glutamic acid production and the sugar-acid conversion rate of the strains, so as to breed excellent industrial production strains.

[0004] Li et al. increased the glutamic acid production by 9 times by constructing a gene deletion strain in the mycolic acid synthesis pathway of the cell outer layer components of Corynebacterium glutamicum. Ogata et al. induced the production of glutamic acid by studying the stress effect of copper ions on Corynebacterium glutamicum, and the production increased by 1.3 times. Chen Ning et al. achieved a change in certain cell membrane structures through temperature control, and realized the conversion from glutamic acid non-accumulating cells to glutamic acid accumulating cells after temperature conversion, with the highest glutamic acid production of 181 g / L. Li Deheng et al. based on pH feedback feeding regulation, the glutamic acid production reached 180 - 200 g / L, and the sugar-acid conversion rate was 68% - 74%. In the early stage of the laboratory, a recombinant Corynebacterium glutamicum was obtained through a series of metabolic engineering transformations, with a glutamic acid production of 136.33 g / L and a sugar-acid conversion rate of 55.80%. The current production still cannot meet industrial production, so it is necessary to further improve the glutamic acid production of Corynebacterium glutamicum. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to improve the glutamic acid production of Corynebacterium glutamicum through metabolic engineering transformation for better application in industrial production.

[0006] In this study, Corynebacterium glutamicum CG18 was used as the chassis cell. The isocitrate lyase encoding gene aceA was knocked out, and two copies of the Ptuf promoter were integrated at this locus to control the expression of glutamate dehydrogenase or its mutant. The PtacM promoter was used at the original glutamate synthase encoding gene gltB and gltD loci to enhance the expression of gltB and gltD (gltB and gltD share the PtacM promoter). The transcriptional regulator RosR controlled by the Ptuf promoter was integrated at the rph pseudogene locus. The expression of NAD kinase and phosphoenolpyruvate carboxylase was enhanced using the double-gene expression plasmid pXMJ19-RBS1-RBS2, and the expression of phosphofructokinase and pyruvate kinase was enhanced using pEC-XK99E-RBS1-RBS2, achieving high-efficient production of glutamate.

[0007] The nucleotide sequences of RBS1 and RBS2 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0008] In the early stage of this invention, glutamate dehydrogenases from different sources (Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum, Klebsiella pneumoniae, Aspergillus niger, Amphibacillus xylanus, Geotrichum candidum) were screened, and it was determined that the GDH from A. xylanus had the best enzyme activity, with an enzyme activity of 273.06±6.48 U / mg at the optimal temperature of 50°C and pH 8.5. However, its optimal pH was relatively high, being alkaline and not suitable for industrial production. Therefore, the optimal mutant AxGDH was obtained by rationally modifying it to reduce its optimal reaction pH. S150D / T188D / L257D / L302E , achieving a nearly 2.2-fold increase in the specific enzyme activity under neutral conditions. The specific enzyme activity was approximately 330 U / mg at pH 7.0, which was 2.2 times that of the wild enzyme. The fermentation results showed that overexpressing AxGDH S150DT188D / L257D / L302E (named AxGDH M increased the L-Glu production by 15% (see the paper "Engineering Corynebacterium glutamicum for High-Efficient Production of γ-Aminobutyric Acid").

[0009] The present invention provides a glutamate dehydrogenase mutant, which is obtained by having amino acid mutations at one or more sites at the 186th and 222nd positions on the basis of the amino acid sequence corresponding to the parental glutamate dehydrogenase (AxGDH S150DT188D / L257D / L302E ).

[0010] The amino acid sequence of the glutamate dehydrogenase has at least 90% identity with the amino acid shown in SEQ ID NO.12 and has glutamate dehydrogenase activity.

[0011] The mutant of the present invention is designed to mutate on the basis of AxGDH S150D / T188D / L257D / L302E . Therefore, the sequence of the parental enzyme should be the mutated AxGDH sequence, that is, serine at position 150 in AxGDH is mutated to aspartic acid, threonine at position 188 is mutated to aspartic acid, leucine at position 257 is mutated to aspartic acid, and leucine at position 302 is mutated to glutamic acid (S150D / T188D / L257D / L302E) at the same time; therefore, the wild-type enzyme of the present invention is AxGDH S150D / T188D / L257D / L302E whose amino acid sequence is shown in SEQ ID NO.12, specifically as follows:

[0012] SEQ ID NO.12

[0013] mtqdnynayqtaqeqfdhvadlinlnqsaremlrepsrefhftipvkmddgttkvfkgyriqhndargpskggirfdpnetvdtiralsmwmtwkcavvdiplgggkggivcdprqlsdaeqerlcrgyvrqlarnigevidvpapdvmdnaqhmlwmldeyetirgghypgaitgkpvgmggslgrdeatgfgviytlrealktqniditkttasiqgfgnvaeyaarlysemggkiiaistwdnqdkkaytyrndkginveelvlikdkfgtidkekavqmgyevldgdawleqevdilepcalenqitadkfplinqsvkvicegangpttpdadklikergiylvpdflcnaggvtcsyfeqvqsnmnyfwdkaevlekldskmtaafhavhelaeekelymrdaayviaiervanavklrgwi

[0014] The nucleotide sequence of the parental enzyme (AxGDH S150D / T188D / L257D / L302E ) is as follows:

[0015] SEQ ID NO.13

[0016] atgacacaagataattataatgcttatcaaacagcacaagaacaatttgatcatgttgcagacttaattaacttaaaccaatctgctcgtgaaat

[0017] gcttcgtgaaccaagtcgagaatttcattttactataccagtgaaaatggatgacggaacaacaaaagtctttaaaggatacagaattcagcataac

[0018] gatgcaagaggcccttctaaaggtgggattcgcttcgatccaaatgaaacagtcgatacaattcgtgctctatcaatgtggatgacttggaagtgt

[0019] gccgtcgttgatatccctctaggtggaggaaagggtggaattgtctgtgatccaagacaattatctgatgctgaacaagaacgactctgccgagg

[0020] atatgtcagacaattagcaagaaatatcggagaagtgattgatgttccagctccagatgtgatggataatgcacaacatatgttatggatgttagat

[0021] gaatatgaaacaattcgtggtggacattatccaggagcaattaccggtaaaccagtcggtatgggtggttcattaggtcgagatgaagctactgg

[0022] attcggtgttatttatacacttcgtgaagcactaaaaactcaaaatattgatattacaaaaacgacagcaagtattcaaggctttggtaatgtagcgga

[0023] atatgcagctcgcctatattctgaaatgggtggtaaaattatcgctatttctacatgggataatcaagataaaaaagcctatacttatcgcaatgataa

[0024] aggaattaatgttgaagaattggtgttgatcaaagataagtttggaacgatcgataaagaaaaagctgttcaaatgggctatgaagtattagatgga

[0025] gatgcttggttagaacaagaagtagacattttagaaccatgtgcacttgaaaatcaaattacagctgacaaattcccattaattaatcagtctgtaaa

[0026] agtaatttgtgaaggcgcgaacggtccaacaactcctgatgctgataaattaattaaagaacgaggaatttacttagttcctgatttcctttgtaacgc

[0027] aggtggagtaacgtgtagttactttgagcaagttcaatcaaatatgaactatttctgggataaggctgaagtacttgaaaagttagacagtaaaatg

[0028] acagctgcgtttcacgcagttcatgaattagcagaagaaaaggaattatatatgagagatgcagcatacgttatagcaattgaacgagttgcaaat

[0029] gcagtaaaacttcgtggctggatctaa

[0030] In one embodiment, the glutamate dehydrogenase mutant is based on the amino acid sequence of glutamate dehydrogenase shown in SEQ ID NO. 12,

[0031] wherein the amino acid at position 186 is mutated from G (glycine) to V (valine), and it is named AxGDH M G186V ;

[0032] or the amino acid at position 222 is mutated from N (asparagine) to D (aspartic acid), and it is named AxGDH M N222D ;

[0033] or the amino acid at position 186 is mutated from G (glycine) to V (valine), and at the same time the amino acid at position 222 is mutated from N (asparagine) to D (aspartic acid), and it is named AxGDHM G186V / N222D 。

[0034] The present invention also provides a polynucleotide encoding the above glutamate dehydrogenase mutant, a vector carrying the polynucleotide, or a cell expressing the above glutamate dehydrogenase mutant.

[0035] The present invention also provides a polynucleotide synthesis kit, which contains the above glutamate dehydrogenase mutant.

[0036] The present invention also provides a method for improving the enzyme activity of glutamate dehydrogenase. The method is based on the amino acid sequence of SEQ ID NO.12 corresponding to the parental glutamate dehydrogenase.

[0037] The amino acid at position 186 is mutated from G to V;

[0038] or the amino acid at position 222 is mutated from N to D;

[0039] or the amino acid at position 186 is mutated from G to V, and at the same time the amino acid at position 222 is mutated from N to D.

[0040] The present invention provides an engineered Corynebacterium glutamicum strain for the efficient production of L-glutamic acid. The recombinant Corynebacterium glutamicum uses Corynebacterium glutamicum CG18 as the chassis cell, knocks out the isocitrate lyase encoding gene aceA, and integrates two copies of the Ptuf promoter at this site to control the expression of glutamate dehydrogenase; the PtacM promoter is used at the original glutamate synthase encoding gene gltB and gltD sites to enhance the expression of gltB and gltD (gltB and gltD share the PtacM promoter); the transcriptional regulator RosR controlled by the Ptrc promoter is integrated at the rph pseudogene site. At the same time, NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase, and pyruvate kinase are overexpressed through a dual-gene plasmid.

[0041] In one embodiment, the glutamate dehydrogenase is the dominant mutant G186V / N222D from A. xylanus, and the transcriptional regulator RosR, NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase, and pyruvate kinase are from Corynebacterium glutamicum.

[0042] In one embodiment, the Corynebacterium glutamicum dual-gene expression plasmid is based on pXMJ19 and pEC-XK99E, and the RBS random sequence of (N)3GGAGG(N)6-10 is designed on the basis of the conventional RBS sequence "AAAGGAGGGAAATC", and is assembled after screening the optimal RBS sequence. Among them, the optimal two RBS nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0043] In one embodiment, the genes involved are as follows: (1) The nucleotide sequence of the isocitrate lyase encoding gene aceA is as shown in SEQ ID NO.3; (2) The nucleotide sequence of G186V / N222D is as shown in SEQ ID NO.4; (3) The nucleotide sequence of the transcriptional regulator RosR is as shown in SEQ ID NO.5; (5) The nucleotide sequences of the promoters PtacM and Ptuf are as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively. (6) The nucleotide sequence of the NAD kinase encoding gene ppnk is as shown in SEQ ID NO.8; (7) The nucleotide sequence of the phosphoenolpyruvate carboxylase encoding gene ppc is as shown in SEQ ID NO.9; (8) The nucleotide sequence of the phosphofructokinase encoding gene pfk is as shown in SEQ ID NO.10; (9) The nucleotide sequence of the pyruvate kinase encoding gene pyk is as shown in SEQ ID NO.11;

[0044] In one embodiment, the pXMJ19 double-gene plasmid is used to overexpress NAD kinase and phosphoenolpyruvate carboxylase, and the pEC-XK99E double-gene plasmid is used to overexpress phosphofructokinase and pyruvate kinase;

[0045] In one embodiment, RBS1 is used to enhance the expression of NAD kinase and phosphofructokinase, and RBS2 is used to enhance the expression of pyruvate kinase and phosphoenolpyruvate carboxylase; the sequences of RBS1 and RBS2 are as shown in SEQ ID NO.1-2 respectively.

[0046] The present invention also provides a method for modifying Corynebacterium glutamicum to improve the production of glutamic acid, and the method is as follows:

[0047] Using Corynebacterium glutamicum CG18 as the chassis cell, the expression levels of the gdh, gltB, gltD, and RosR genes are adjusted by metabolic engineering modification methods, and the NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase, and pyruvate kinase are overexpressed using a double-gene free plasmid, wherein: (1) The Ptuf promoter is used to control the overexpression of the G186V / N222D gene at the aceA locus; (2) The PtacM promoter is used to control the expression of gltB and gltD at the original glutamic acid synthase encoding gene gltB and gltD loci (gltB and gltD share the PtacM promoter); (3) ThePtrc promoter is used to control the overexpression of the RosR encoding gene at the rph pseudogene locus; (4) The pXMJ19 double-gene plasmid is used to overexpress ppnk and ppc; (5) The pEC-XK99E double-gene plasmid is used to overexpress pfk and pyk;

[0048] In one embodiment, the metabolic engineering genome editing method is the traditional gene editing technology of the pK18mobsacB suicide plasmid.

[0049] The present invention also provides a method for producing L-glutamic acid, which is to ferment and prepare L-glutamic acid by using the above-mentioned recombinant Corynebacterium glutamicum.

[0050] In one embodiment, a fed-batch fermentation method is adopted. The method is that the seed liquid of recombinant Corynebacterium glutamicum is inoculated into the fermentation medium at an inoculation amount of 15-20% for fermentation. The fermentation temperature adopts a sequential temperature increase mode: 30 °C for 0-6 h, 32 °C for 7-12 h, 34 °C for 13-18 h, 36 °C for 18-24 h, and 38 °C for 24-32 h; the dissolved oxygen level is controlled by a staged oxygen supply mode: 20% for 0-15 h and 8% for 16-32 h; the residual sugar concentration is controlled at 5-10 g / L by feeding an 80% glucose solution.

[0051] In one embodiment, the components of the seed medium (unit: g / L) include glucose 22-30, K2HPO4 1.0-2.0, MgSO4 0.3-0.8, corn steep liquor 20-40, FeSO4·7H2O 0.002-0.006, MnSO4·H2O 0.002-0.006, urea 2.0-3.0, and pH 6.8-7.0.

[0052] In one embodiment, the components of the seed medium (unit: g / L) include glucose 25, K2HPO4 1.5, MgSO4 0.6, corn steep liquor 30, FeSO4·7H2O 0.005, MnSO4·H2O 0.005, urea 2.5, and pH 7.0.

[0053] In one embodiment, the components of the fermentation medium (unit: g / L) include glucose 140, K2HPO4 1, MgSO4 0.6, corn steep liquor 5, FeSO4·7H2O 0.005, MnSO4·H2O 0.005, urea 7, and pH 7.0.

[0054] In one embodiment, the components of the fermentation medium (unit: g / L) include glucose 120-160, K2HPO4 0.8-1.5, MgSO4 0.5-0.8, corn steep liquor 4.0-6.0, FeSO4·7H2O 0.002-0.006, MnSO4·H2O 0.002-0.006, urea 5-8, and pH 6.8-7.0.

[0055] The present invention also provides the use of the above-mentioned recombinant Corynebacterium glutamicum in the production of L-glutamic acid or products containing L-glutamic acid.

[0056] Beneficial effects

[0057] For the Corynebacterium glutamicum provided by the present invention, the expression of glutamate dehydrogenase and glutamate synthase is enhanced, isocitrate lyase is knocked out, and the carbon flux of the glyoxylate cycle is weakened; the intracellular NADP(H) level is strengthened; the expression of the transcription factor RosR, phosphoenolpyruvate carboxylase, phosphofructokinase, and pyruvate kinase is enhanced. Using the recombinant Corynebacterium glutamicum provided by the present invention for fed-batch fermentation in a 5 L fermenter for 32 h, the glutamate yield reaches 230.57 g / L, and the sugar-acid conversion rate is 76.2%. Description of the drawings

[0058] Figure 1 : Effects of different copy numbers of the glutamate dehydrogenase mutant G186V / N222D gene on glutamate synthesis.

[0059] Figure 2 : Fed-batch fermentation of the recombinant strains CG22 and CG23 in a 5 L fermenter.

[0060] Figure 3 : Schematic diagram of RBS construction and fluorescence intensities of different strains.

[0061] Figure 4 : Schematic diagram of the double-gene expression plasmid.

[0062] Figure 5 : Fed-batch fermentation of the recombinant strains CG24 and CG25 in a 5 L fermenter.

[0063] Figure 6 : Fed-batch fermentation of the CG25 strain in a 5 L fermenter after fermentation process optimization. Detailed implementation manners

[0064] Technical terms:

[0065] Expression: As used herein, the term "expression" refers to any step involved in the production of a variant, including but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0066] Expression vector: As used herein, the term "expression vector" refers to a linear or circular DNA molecule that contains a polynucleotide encoding a variant and is operably linked to control sequences providing for its expression.

[0067] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parental cell that are different from the parental cell due to mutations that occur during replication, together with recombinant host cells, isolated host cells (e.g., isolated recombinant host cells), and heterologous host cells.

[0068] Recombinant: When used in reference to a cell, nucleic acid, protein, or vector, the term "recombinant" means that it has been modified from its natural state. Thus, for example, a recombinant cell expresses a gene that is not found in a cell in its natural (non-recombinant) form, or expresses a native gene at a different level or under different conditions compared to that found in nature. A recombinant nucleic acid differs from a native sequence by one or more nucleotides and / or is operably linked to a heterologous sequence (e.g., a heterologous promoter in an expression vector). A recombinant protein differs from a native sequence by one or more amino acids and / or is fused to a heterologous sequence. A vector comprising a nucleic acid encoding a polypeptide is a recombinant vector. The terms "recombinant" and "genetically modified" and "transgenic" are synonymous.

[0069] Mutant: As used herein, when referring to the use of variants of the present invention, the term "mutant" means a polypeptide having glutamate dehydrogenase activity that contains alterations (i.e., substitutions, insertions, and / or deletions) at one or more (e.g., several) positions relative to a "parental" glutamate dehydrogenase. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. In describing the variants of the present invention, the following nomenclature has been adapted for ease of reference. The accepted IUPAC single-letter or three-letter amino acid abbreviations are used. Substitution: For amino acid substitutions, the following nomenclature is used: original amino acid, position, amino acid being substituted. Thus, the substitution of the amino acid at position 186 from G to V is designated "G186V". Multiple mutations are separated by the symbol (" / "), G186V / N222D.

[0070] Wild-type enzyme: The term "wild-type" when referring to an amino acid sequence or nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a natural or naturally occurring sequence. As used herein, the term "naturally occurring" refers to any substance found in nature (e.g., a protein, amino acid, or nucleic acid sequence). In contrast, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in the laboratory, or modifications of wild-type sequences). When the parental enzyme is not a variant enzyme, the terms "wild-type enzyme" and "parental enzyme" can be used interchangeably.

[0071] The wild-type enzyme of the present invention is: in AxGDH S150D / T188D / L257D / L302E Based on this, mutations were designed. Therefore, the sequence of the parental enzyme should be the mutated AxGDH sequence, that is, serine at position 150 in AxGDH was mutated to aspartic acid, threonine at position 188 was mutated to aspartic acid, leucine at position 257 was mutated to aspartic acid, and at the same time, leucine at position 302 was mutated to glutamic acid (S150D / T188D / L257D / L302E).

[0072] The following are preferred examples of the present invention. It should be understood that the examples are for better explaining the present invention and are not used to limit the present invention.

[0073] It will be recognized from the foregoing that the present disclosure can be embodied in various ways, including but not limited to the following:

[0074] Example 1: A glutamate dehydrogenase mutant; the glutamate dehydrogenase mutant is obtained by having amino acid mutations at one or more sites corresponding to the amino acid sequence of the parental glutamate dehydrogenase at positions 186 and 222;

[0075] The amino acid sequence of the glutamate dehydrogenase has at least 90% identity with the amino acid shown in SEQ ID NO. 12 and has glutamate dehydrogenase activity.

[0076] Example 2: A glutamate dehydrogenase mutant; the glutamate dehydrogenase mutant is based on the amino acid sequence of the glutamate dehydrogenase shown in SEQ ID NO. 12

[0077] The amino acid at position 186 is mutated from G to V;

[0078] Or the amino acid at position 222 is mutated from N to D;

[0079] Or the amino acid at position 186 is mutated from G to V, and at the same time, the amino acid at position 222 is mutated from N to D.

[0080] Example 3: A polynucleotide encoding the glutamate dehydrogenase mutant described in Example 1 or Example 2 above.

[0081] Example 4: A vector carrying the polynucleotide described in Example 3.

[0082] Example 5: A cell carrying the vector described in Example 4 or expressing the glutamate dehydrogenase mutant described in Example 1 or Example 2.

[0083] Example 6: The cell according to Example 5, wherein the cell uses bacteria or fungi as an expression host.

[0084] Example 7: A polynucleotide synthesis kit, which contains the above-mentioned glutamate dehydrogenase mutant.

[0085] Example 8: A method for improving the enzyme activity of glutamate dehydrogenase. The method is based on the amino acid sequence of SEQ ID NO.12 corresponding to the parental glutamate dehydrogenase,

[0086] the 186th amino acid is mutated from G to V;

[0087] or the 222nd amino acid is mutated from N to D;

[0088] or the 186th amino acid is mutated from G to V and at the same time the 222nd amino acid is mutated from N to D.

[0089] Example 9: A recombinant Corynebacterium glutamicum, which expresses the glutamate dehydrogenase mutant described in Example 1 or Example 2.

[0090] Example 10: A recombinant Corynebacterium glutamicum, which uses Corynebacterium glutamicum CG18 as the chassis cell, knocks out the isocitrate lyase-encoding gene aceA, and integrates the glutamate dehydrogenase mutant described in Example 1 or Example 2 controlled by the Ptuf promoter at this site; uses the PtacM promoter to overexpress the original glutamate synthase-encoding genes gltB and gltD on the genome, and integrates the transcriptional regulator RosR derived from Corynebacterium glutamicum controlled by the Ptuf promoter at the rph pseudogene locus; at the same time, overexpresses the NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase and pyruvate kinase derived from Corynebacterium glutamicum;

[0091] Example 11: The recombinant Corynebacterium glutamicum according to Example 10, wherein the nucleotide sequence of the isocitrate lyase-encoding gene aceA is as shown in SEQ ID NO.3; the glutamate dehydrogenase mutant is G186V / N222D, and its nucleotide sequence is as shown in SEQ ID NO.4; the nucleotide sequence of the transcriptional regulator RosR-encoding gene is as shown in SEQ ID NO.5; the nucleotide sequences of the promoters PtacM and Ptuf are as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively; the nucleotide sequence of the NAD kinase-encoding gene ppnk is as shown in SEQ ID NO.8; the nucleotide sequence of the phosphoenolpyruvate carboxylase-encoding gene ppc is as shown in SEQ ID NO.9; the nucleotide sequence of the phosphofructokinase-encoding gene pfk is as shown in SEQ ID NO.10; the nucleotide sequence of the pyruvate kinase-encoding gene pyk is as shown in SEQ ID NO.11;

[0092] Overexpress NAD kinase and phosphoenolpyruvate carboxylase using the pXMJ19 double-gene plasmid, and overexpress phosphofructokinase and pyruvate kinase using the pEC-XK99E double-gene plasmid;

[0093] Moreover, NAD kinase and phosphofructokinase were strongly expressed using RBS1, and pyruvate kinase and phosphoenolpyruvate carboxylase were strongly expressed using RBS2; the sequences of RBS1 and RBS2 are shown in SEQ ID NO.1 - 2 respectively.

[0094] The recombinant Corynebacterium glutamicum is:

[0095] CG18 / ΔaceA::Ptuf-G186V / N222D-G186V / N222DΔrph::Ptuf-RosR / PtacM-gltB-gltD

[0096] / pEC-XK99E-RBS1-pfk-RBS2-pyk / pXMJ19-RBS1-ppnk-RBS2-ppc.

[0097] Example 12: A method for producing L-glutamic acid, which is to ferment and prepare L-glutamic acid using the above recombinant Corynebacterium glutamicum.

[0098] Example 13: According to the method described in Example 12, specifically: first inoculate the recombinant Corynebacterium glutamicum seed liquid into the fermentation medium at an inoculation amount of 15 - 20% for fermentation; the fermentation temperature adopts a sequential temperature increase mode, 30 °C for 0 - 6 h, 32 °C for 7 - 12 h, 34 °C for 13 - 18 h, 36 °C for 18 - 24 h, 38 °C for 24 - 32 h; control the dissolved oxygen level using a staged oxygen supply mode, 20% for 0 - 15 h, 8% for 16 - 32 h; control the residual sugar concentration at 5 - 10 g / L by feeding an 80% glucose solution.

[0099] The fermentation time is: at least 12 h; it can be 12 - 24 h, it can be 12 - 36 h, it can be 32 - 36 h.

[0100] Method for preparing the seed liquid:

[0101] Inoculate the recombinant Corynebacterium glutamicum into BHI liquid medium, and after culturing for 18 - 24 h, transfer it to the seed medium at an inoculation amount of 1 - 2% (v / v), and culture it at 20 - 35 °C and 180 - 200 rpm for 20 - 30 h to obtain the primary seed liquid.

[0102] Inoculate all the primary seeds into the seed medium, and culture it at 20 - 35 °C and 180 - 200 rpm for 18 - 25 h to obtain the secondary seed liquid;

[0103] Example 14: Application of a recombinant Corynebacterium glutamicum in the production of L-glutamic acid or products containing glutamic acid.

[0104] Next, the technical solutions in the present invention will be clearly and completely described in conjunction with the embodiments in the present invention.

[0105] Escherichia coli JM109 involved in the following examples was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the pK18mobsacB plasmid and pDXW10 plasmid involved in the following examples were both purchased from BioVector China Plasmid Vector Strain Cell Gene Preservation Center; Corynebacterium glutamicum CG18 involved in the following examples was described in the master's thesis of the 2023 class in our laboratory, "Rational Metabolic Engineering of Corynebacterium glutamicum for Efficient Synthesis of L-Glutamic Acid".

[0106] Corynebacterium glutamicum G01 was described in the literature "Efficient one-step preparation of γ-aminobutyric acid from glucose without an exogenous cofactor by the designed Corynebacterium glutamicum", and the preservation number was CCTCC No: M2013418 (Corynebacterium glutamicum G01 has been preserved and there is no need to conduct preservation procedures for patents again).

[0107] Specifically, Corynebacterium glutamicum CG18 is:

[0108] Knock out the alat gene (NCBI number: AGN23380.1) on the genome of Corynebacterium glutamicum G01 strain, replace the RBS sequence (sequence: AAGAAGCAAGGAAAAGAGGCGAGTACCTGCC) of the odhA gene (NCBI number: AGN21899.1) on the genome with RBS4 (sequence: CTCCTCTTCTTACAGCTAGTTTTAAC), integrate the gdh gene (NCBI number: XM_025599538.1) from A. niger at the same time, and achieve MscCG on the genome A100VMutation (i.e., mutate alanine at position 100 of the sequence with NCBI accession number BAB98663.1 on the genome to valine).

[0109] The media involved in the following examples are as follows:

[0110] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0111] LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0112] LBG liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose 5 g / L.

[0113] LBG solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose 5 g / L, agar powder 15 g / L.

[0114] Corynebacterium glutamicum competent medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose 5 g / L, Tween-80 1 g / L, glycine 3 g / L.

[0115] Seed medium: glucose 25 g / L, K2HPO4·3H2O 1.5 g / L, MgSO4 0.6 g / L, corn steep liquor 30 g / L, urea 2.5 g / L, FeSO4·7H2O 0.005 g / L, MnSO4·4H2O 0.005 g / L, pH 7.0.

[0116] Fermentation medium: glucose 140 g / L, dipotassium hydrogen phosphate trihydrate 1.5 g / L, magnesium sulfate heptahydrate 0.6 g / L, corn steep liquor 5.0 g / L, ferrous sulfate heptahydrate 0.005 g / L, manganese sulfate monohydrate 0.005 g / L, urea 7.0 g / L, pH 7.0.

[0117] The detection methods involved in the following examples are as follows:

[0118] Detection of glutamate dehydrogenase enzyme activity:

[0119] The reaction system (1.5 mL) contains 0.1 mol·L -1 of buffer, 100 mmol·L -1 ammonium chloride, 50 mmol·L -1 substrate α-ketoglutaric acid, 0.1 mmol·L -1NAD(P)H. Add 50 μL of enzyme solution to initiate the reaction, and record the change in absorbance at 340 nm within the first 1 min at room temperature using a timer. Since NAD(P)H is oxidized to NAD(P) during the reaction + , the enzyme activity can be determined by monitoring the change in absorbance at 340 nm (extinction coefficient is 6.22×10 3 mol -1 ·cm -1 ).

[0120] One unit (U) of glutamate dehydrogenase activity is defined as the amount of product produced per minute to generate 1 μmol of product.

[0121] Determination of glucose content, L-glutamate content, and sugar-acid conversion rate: The glucose and L-glutamate contents in the fermentation broth were analyzed using a Bio-SBA bioanalyzer. Pipette 25 μL of the standard solution SBA for calibration. After calibration, take 1 mL of the fermentation broth for dilution, and then pipette 25 μL of the diluted fermentation broth for measurement and record the data;

[0122] The calculation formula for the sugar-acid conversion rate is as follows:

[0123]

[0124] In the formula: η: sugar-acid conversion rate; CL-glutamate: concentration of L-glutamate in the fermenter after fermentation, g / L; C0: initial sugar concentration, g / L; Cglucose: concentration of glucose in the fermenter after fermentation, g / L; V1: volume of 80% glucose solution consumed, L; V: volume of the fermentation broth before discharging from the tank, L.

[0125] Determination of cell concentration:

[0126] Measure the absorbance at 600 nm using a UV-2000Z ultraviolet-visible spectrophotometer.

[0127] The genotypes of the strains involved in the following examples are shown in Table 1 below:

[0128] Table 1: List of genetic modifications of strains

[0129]

[0130] Example 1: Preparation of glutamate dehydrogenase mutants

[0131] 1. Determination of wild-type glutamate dehydrogenase

[0132] Previously, glutamate dehydrogenases from different sources (Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum, Klebsiella pneumoniae, Aspergillus niger, Amphibacillus xylanus, Geotrichum candidum) were screened, and it was determined that the GDH from A. xylanus had the best enzyme activity. The enzyme activity was 273.06 ± 6.48 U / mg under the optimal temperature of 50 °C and pH 8.5.

[0133] However, the optimal pH of the GDH from A. xylanus is relatively high (the optimal pH of the GDH from A. xylanus is 8.5 at 50 °C, and under the optimal conditions, the specific enzyme activity of the GDH from A. xylanus can reach 273.06 U / mg). It is alkaline and not suitable for industrial production. Therefore, the optimal mutant AxGDH was obtained by rationally modifying it to lower its optimal reaction pH. S150D / T188D / L257D / L302E The specific enzyme activity under neutral conditions was increased by nearly 2.2 times. The specific enzyme activity was approximately 330 U / mg at pH 7.0, which is 2.2 times that of the wild enzyme at pH 7.0.

[0134] The fermentation results showed that overexpressing AxGDH S150DT188D / L257D / L302E (named AxGDH M ) resulted in an L-Glu production of 115 g / L, which was 15% higher than that before mutation (see the paper "Study on the Efficient Production of γ-Aminobutyric Acid by Engineering Corynebacterium glutamicum").

[0135] Therefore, the glutamate dehydrogenase mutant AxGDH S150D / T188D / L257D / L302E was selected as the wild-type enzyme for mutation in this invention.

[0136] 2. Construction of Glutamate Dehydrogenase Mutants

[0137] To further improve the specific enzyme activity of the glutamate dehydrogenase mutant AxGDH S150D / T188D / L257D / L302E at pH 7.0, site-directed mutagenesis was carried out based on AxGDH S150D / T188D / L257D / L302E . First, five mutants K71Q, P146G, G186V, N222D, and C361V were constructed.

[0138] The specific method is as follows:

[0139] (1) Using pET28a-AxGDH S150DT188D / L257D / L302E (pET28a-AxGDH M)Using [template], site-directed mutagenesis was performed to separately prepare recombinant vectors pET28a-AxGDH containing mutants M -K71Q, pET28a-AxGDH M -P146G, pET28a-AxGDH M -G186V, pET28a-AxGDH M -N222D, pET28a-AxGDH M -C361V;

[0140] The primer sequences involved are as follows:

[0141] K71Q-F: gcaagaggcccttctCAAggtgggattcgcttc

[0142] K71Q-R: gaagcgaatcccaccTTGagaagggcctcttgc

[0143] P146G-F: attgatgttccagctGGAgatgtgatggataat

[0144] P146G-R: attatccatcacatcTCCagctggaacatcaat

[0145] G186V-F: atgggtggttcattaGTCcgagatgaagctact

[0146] G186V-R: agtagcttcatctcgGACtaatgaaccacccat

[0147] N222D-F: attcaaggctttggtGATgtagcggaatatgca

[0148] N222D-R: tgcatattccgctacATCaccaaagccttgaat

[0149] C361V-F: gcaggtggagtaacgGTAagttactttgagcaa

[0150] C361V-R: ttgctcaaagtaactTACcgttactccacctgc

[0151] (2) The separately prepared recombinant vectors were separately introduced into Escherichia coli E. coli BL21(DE3) to prepare recombinant Escherichia coli containing mutants;

[0152] The recombinant Escherichia coli mutant strain was activated on a plate, inoculated into a 10 mL vial of LB medium, and cultured in a shaker at 37 °C and 180 rpm for 10 - 12 h to obtain a seed solution. The prepared seed solution was transferred to 50 mL of LB medium at an inoculation amount of 1% (v / v), cultured in a shaker at 37 °C and 180 rpm for 2 h, then IPTG inducer (final concentration 0.4 mM) was added, and induced culture was carried out at 25 °C and 180 rpm for 8 - 12 h.

[0153] The cells were collected for cell disruption. After the crude enzyme solution was purified, the enzyme activity was measured at pH 7.0. The results are shown in Table 2:

[0154] Table 2: Specific enzyme activities of different mutants at pH 7.0

[0155] Strain <![CDATA[AxGDH M > K71Q P146G G186V N222D C361V Specific enzyme activity (U / mg) 330.15 324.31 310.55 382.64 378.25 319.33

[0156] The results showed that:

[0157] The enzyme activities of mutants G186V and N222D at pH 7.0 were respectively M 15.9% and 14.57% higher than that of AxGDH.

[0158] (3) Preparation of double mutants:

[0159] The mutants G186V and N222D with improved enzyme activity were subjected to combinatorial mutagenesis: Using pET28a - AxGDH M -G186V as a template and the primer sequences of N222D involved in step (2), according to the method of step (2), a recombinant vector containing pET28a - AxGDH M -G186V / N222D was prepared;

[0160] After the recombinant vector was introduced into Escherichia coli, according to the method of step (2), the double mutant G186V / N222D was obtained after culture and purification; the enzyme activity was measured at pH 7.0;

[0161] The results showed that its specific enzyme activity at pH 7.0 was further increased to 410.23 U / mg, which was 24.26% higher than that of AxGDHM.

[0162] Example 2: Effect of overexpression of glutamate dehydrogenase mutant G186V / N222D gene on glutamate synthesis

[0163] The specific steps are as follows:

[0164] 1. Construction of strains:

[0165] (1) Construction of CG19 strain:

[0166] Integrate one copy of the coding gene of the dominant mutant G186V / N222D of glutamate dehydrogenase at the aceA gene locus of strain CG18 using the Ptuf promoter. The specific steps are as follows:

[0167] Using the genome of strain CG18 as a template, perform PCR with pK18-aceA-LF / LR and pK18-aceA-RF / RR as primers to amplify a 500-bp homologous arm upstream and a 500-bp homologous arm downstream of the aceA gene (SEQ ID NO.3);

[0168] Using the genome of C.g ATCC 13032 as a template, perform PCR with Ptuf-F / R as primers to amplify the promoter P tuf fragment (SEQ ID NO.7); using the pET28a-G186V / N222D plasmid as a template, perform PCR with Axgdh-F / R as primers to amplify the G186V / N222D gene (SEQ ID NO.4) fragment. After gel extraction of the amplified 500-bp homologous arm fragment upstream of the aceA gene, the promoter P tuf , the G186V / N222D gene fragment, and the 500-bp homologous arm fragment downstream of the aceA gene, perform fusion PCR in sequence. The fragments obtained by gel extraction of the fusion PCR are respectively ligated with the pK18mobsacB linearized vector obtained by digestion with EcoRI and HindIII under the action of homologous recombinase to obtain ligation products;

[0169] Transform each ligation product into Escherichia coli E.coli JM109 to obtain transformation products; spread the transformation products on LB solid medium (containing 50 μg / mL kanamycin) and incubate them upside down in a 37°C constant temperature incubator for 8 - 12 h to obtain transformants; pick the transformants and inoculate them into LB liquid medium, shake flask culture at 37°C and 120 - 180 rpm for 8 - 12 h, then extract the plasmid for bacterial liquid verification and sequencing verification. The correctly verified recombinant plasmid is then electrotransformed into CG18 competent cells to obtain CG18 / ΔaceA::Ptuf-G186V / N222D;

[0170] The strain (CG18 / ΔaceA::Ptuf-G186V / N222D) that is correctly identified by PCR amplification and sequencing using the pK18-aceA-LF / RR primer pair is the strain CG18::G186V / N222D (CG18 / ΔaceA::Ptuf-G186V / N222D, named CG19) that has integrated one copy of G186V / N222D;

[0171] (2) Construction of strains CG20 and CG21

[0172] Construction of strain CG20:

[0173] Using the same method as in step (1), integrate 2 copies of the dominant mutant G186V / N222D of glutamate dehydrogenase at the aceA gene locus of strain CG18 with the Ptuf promoter to obtain: CG18 / ΔaceA::Ptuf-G186V / N222D-G186V / N222D;

[0174] Construction of strain CG21:

[0175] Using the same method as in step (1), integrate 2 copies of the dominant mutant G186V / N222D of glutamate dehydrogenase at the aceA gene locus of strain CG18 with the Ptuf promoter to obtain: CG18 / ΔaceA::Ptuf-G186V / N222D-G186V / N222D-G186V / N222D;

[0176] Successively construct strains CG18::2G186V / N222D (CG18 / ΔaceA::Ptuf-G186V / N222D-G186V / N222D, named CG20) and CG18::3G186V / N222D (named CG18 / ΔaceA::Ptuf-G186V / N222D-G186V / N222D-G186V / N222D, CG21) that integrate two copies and three copies of G186V / N222D respectively.

[0177] The primers required for the above steps are shown in Table 3.

[0178] Table 3: Primers and sequences

[0179] Primer name Primer sequence pK18-aceA-LF ctatgacatgattacgaattcgatcaccatcaccagcaaaagg pK18-aceA-LR gcagggtaacggccaggtctgcggtgtagt Ptuf-F actacaccgcagacctggccgttaccctgc Ptuf-R attatcttgtgtcattcctcctggacttcg Axgdh-F cgaagtccaggaggaatgacacaagataat Axgdh-R aagtagcctgcgccattagatccagccacg pK18-aceA-RF cgtggctggatctaatggcgcaggctactt pK18-aceA-RR acgacggccagtgccaagctttcgttgcggaagaggttgaggt

[0180] 2. Fermentation for the preparation of glutamic acid( Figure 1 ), and the specific steps are as follows:

[0181] Streak-activate strains CG18, CG19, CG20, and CG21 on antibiotic-free BHI plates respectively, and incubate them upside down in a 30 °C incubator for 18 - 24 h. Then, pick larger single colonies from the plates and inoculate them into 500 mL baffled flasks containing 30 mL of seed medium, and culture them at 30 °C and 220 rpm for 24 h to obtain primary seed solutions respectively; afterwards, transfer them to 1 L baffled flasks containing 200 mL of seed medium according to an inoculation amount of 10% (v / v), and culture them at 30 °C and 220 rpm for 18 h to obtain secondary seed solutions respectively.

[0182] The prepared seed solutions were respectively inoculated into a 5 L fermenter containing 1.8 L of fermentation medium at an inoculation amount of 10% (v / v) and fermented for 32 h. The parameters of the fermenter were controlled as follows: initial rotation speed 300 rpm, temperature 30 °C, aeration rate 4 vvm, pH 7.0, dissolved oxygen controlled at 20 - 30%, and residual sugar 20 - 30 g / L.

[0183] The fed-batch fermentation results in a 5 L fermenter showed that for the strains CG18, CG19, CG20, and CG21 fermented for 32 h, the L-glutamic acid yields were 130.68, 137.49, 148.35, and 142.52 g / L respectively, and the sugar-acid conversion rates were 56.8%, 61.1%, 62.3%, and 61.7% respectively.

[0184] It can be seen that for the CG20 strain with 2 copies of G186V / N222D, the L-glutamic acid yield and the sugar-acid conversion rate were significantly improved.

[0185] Example 3: Enhancing Glutamate Synthase Expression to Promote Glutamate Synthesis

[0186] To further enhance the glutamate synthesis metabolic flux, the PtacM promoter was used at the original glutamate synthase encoding gene gltB and gltD loci on the genome of the CG20 strain to strengthen the expression of gltB (BAB97577.1) and gltD (BAB97578.1) (gltB and gltD share the PtacM promoter); an additional PtacM promoter (SEQ ID NO.6) was added in front of the gltB gene on the genome. The specific steps are as follows:

[0187] 1. Construction of the CG22 Strain

[0188] (1) Using the CG18 genome as a template, PCR was performed with pK18-LF / LR and gltB-F / R as primers to amplify a partial gltB gene fragment (500 bp) containing 500 bp in front of the gltB gene and the PtacM homologous arm; using the pDXW10 plasmid as a template, PCR was performed with PtacM-F / R as primers to amplify the PtacM fragment containing the fused partial gltB homologous arm; after gel extraction of the amplified 500 bp in front of the gltB gene, the PtacM fragment, and the partial gltB fragment (500 bp), fusion PCR was carried out in sequence. The fragments obtained by gel extraction of the fusion PCR were respectively ligated with the pK18mobsacB linearized vector digested with EcoRI and HindIII under the action of homologous recombinase to obtain the ligation product;

[0189] (2) Transform each ligation product into Escherichia coli JM109 to obtain transformed products; spread the transformed products on LB solid medium (containing 50 μg / mL kanamycin), and culture them inverted in a constant temperature incubator at 37 °C for 8 - 12 h to obtain transformants; pick the transformants and inoculate them into LB liquid medium, culture them in a shaker flask at 37 °C and 120 - 180 rpm for 8 - 12 h, then extract the plasmid for verification of the bacterial solution and sequencing verification. The correctly verified recombinant plasmid is then electrotransformed into CG20 competent cells. The strain that is correctly identified by PCR amplification and sequencing using the pK18-LF / gltB-R primer pair is the CG20::PtacM-gltB-gltD strain (named CG22); among them, the primers are shown in Table 4 below:

[0190] Table 4: Primers and Sequences

[0191] Primer name Primer sequence pK18-LF ctatgacatgattacgaattcgagaattccaaagacattttgg pK18-LR cagtcgataagctccgcgggatacctcact PtacM-F agtgaggtatcccgcggagcttatcgactg PtacM-R tccttgtggtttcatttctgtttcctgtgt gltB-F acacaggaaacagaaatgaaaccacaagga gltB-R acgacggccagtgccaagctttcacaacgcttacggataaaga

[0192] 2. Fermentation for Glutamic Acid Production( Figure 2 )

[0193] To verify the glutamic acid synthesis ability of the CG22 strain, fed-batch fermentation in a 5 L fermenter was carried out, and glutamic acid was prepared according to the method of Step 2 in Example 2;

[0194] The results showed that after 32 h of fermentation, the glutamic acid yield was as high as 160.21 g / L, and the sugar-acid conversion rate was 64.5%, indicating that enhancing the expression of glutamine synthase is beneficial to the synthesis of glutamic acid.

[0195] Example 4: Promoting Glutamic Acid Synthesis by Strengthening the Expression of Transcription Regulator RosR with the Ptuf Promoter

[0196] Previously in the laboratory, relatively good glutamic acid levels were obtained by expressing the transcription factor RosR (SEQ ID NO.5) with a free plasmid. Therefore, it was integrated into the pseudogene locus rph (NCBI accession number: AGN23056.1) in order to further promote the efficient and stable synthesis of glutamic acid. The specific steps are as follows:

[0197] 1. Construction of the CG23 Strain

[0198] (1) Using the CG18 genome as a template, PCR was performed with pK18-rph-LF / LR, pK18-rph-RF / RR, and RosR-F / R as primers to amplify a 500 bp fragment before and after the rph gene locus and the RosR gene fragment; using the C.g ATCC 13032 genome as a template, PCR was performed with Ptuf-F / R as primers to obtain the Ptuf fragment; after gel extraction of the 500 bp fragment before the rph gene, Ptuf (SEQ ID NO.7), RosR (SEQ ID NO.5), and the 500 bp fragment after the rph gene, fusion PCR was carried out in sequence. The fragments obtained by gel extraction of the fusion PCR were respectively ligated with the pK18mobsacB linearized vector digested with EcoRI and HindIII under the action of homologous recombinase to obtain the ligation products;

[0199] (2) Each ligation product was transformed into Escherichia coli E.coli JM109 to obtain the transformation products; the transformation products were spread on LB solid medium (containing 50 μg / mL kanamycin) and incubated inverted in a 37°C constant temperature incubator for 8 - 12 h to obtain the transformants; the transformants were picked and inoculated into LB liquid medium, and after shaking flask culture at 37°C and 120 - 180 rpm for 8 - 12 h, the plasmids were extracted for bacterial liquid verification and sequencing verification. The correct recombinant plasmid was then electrotransformed into CG22 competent cells, and the strain that was correctly identified by PCR amplification and sequencing using the pK18-rph-LF and pK18-rph-RR primer pairs was the CG22::Ptuf-RosR strain (CG22 / Δrph::Ptuf-RosR, named CG23); among them, the primers are shown in Table 5 below:

[0200] Table 5: Primer sequences

[0201] Primer name Primer sequence pK18-rph-LF ctatgacatgattacgaattcgacacggtaactatcactgttc pK18-rph-LR gcagggtaacggccatgcctgcagggttgg Ptuf-F ccaaccctgcaggcatggccgttaccctgc Ptuf-R tcgtggtgttgtcattcctcctggacttcg RosR-F cgaagtccaggaggaatgacaacaccacga RosR-R cgggtgaaggtagttttacagctctgccgc pK18-rph-RF gcggcagagctgtaaaactaccttcacccg pK18-rph-RR acgacggccagtgccaagcttcatacggacacgaaggctgcgt

[0202] 2. Fermentation preparation of glutamic acid

[0203] Fed-batch fermentation of the CG23 strain in a 5 L fermenter; glutamic acid was prepared according to the method in step 2 of Example 2;

[0204] The results showed that after 32 h of fermentation, the glutamic acid yield was as high as 178.36 g / L, and the sugar-acid conversion rate was 68.2%, indicating that enhancing the expression of the transcriptional regulator RosR is beneficial to the synthesis of glutamic acid.

[0205] Example 5: Screening of RBS sequences and construction of a dual-gene expression plasmid

[0206] The specific steps are as follows:

[0207] 1. Screening of RBS sequences (Figure 3 )

[0208] First, primers containing the RBS sequence were designed to amplify the gfp gene, which was then ligated into plasmids pEC-XK99E and pXMJ19 and transformed into competent Escherichia coli DH5α cells. The cells were spread on LB plates containing kanamycin and chloramphenicol antibiotics respectively. After overnight culture, the colonies on the plates were collected and plasmids pEC-XK99E-RBSn-gfp and pXMJ19-RBSn-gfp were extracted and electroporated into Corynebacterium glutamicum C.g ATCC 13032.

[0209] After overnight culture, all the single colonies with green fluorescence markers on the BHI plates were transferred to 96-well plates. After culturing for about 4 h, IPTG was added for induction. After incubation at 16 °C for about 16 h, the fluorescence intensity was measured using a microplate reader. To avoid the contingency of the experiment, strains with different fluorescence intensities after primary screening were selected and streaked on BHI plates. Then, induction and culture were carried out again, and the fluorescence values were measured. After two rounds of screening, an RBS library with different strengths was constructed. Among them, the relative fluorescence intensities of 3 RBS sequences were 2.45, 1.83, and 1.39 times higher than that of the control containing the original RBS sequence.

[0210] 2. Construction of double-gene expression plasmids( Figure 4 )

[0211] Two RBS sequences SEQ ID NO.1 (RBS1: aaaggagggagatc) and SEQ ID NO.2 (RBS2: aaaggaggtataac) with strong RBS strength and different sequences were selected and assembled onto plasmids pEC-XK99E and pXMJ19 respectively. The specific operations are as follows:

[0212] (1) Construction of pXMJ19-RBS1-RBS2 double-gene expression plasmid

[0213] Using the pXMJ19 plasmid as a template, reverse PCR was performed with primers pXMJ19-RBS1-R: tctagagtcgacctgcaggcatgcGATCTCCCTCCTTTaagcttaattaattctgtttcctgtgtgaa and pXMJ19-RBS2-F: gcatgcctgcaggtcgactctagaAAAGGAGGTATAACggatccccgggtaccgagctcgaattcagc (the bold part is the RBS sequence). The PCR product was transformed into competent Escherichia coli DH5α cells and spread on an LB plate containing chloramphenicol antibiotic. After overnight culture, the colonies on the plate were collected and the plasmid was extracted and sent to Genewiz for sequencing. When the sequencing was correct, the strain of E. coli DH5α / pXMJ19-RBS1-RBS2 double-gene expression plasmid was successfully constructed and could be used for double-gene co-expression subsequently. The pXMJ19-RBS1-RBS2 double-gene expression plasmid was constructed;

[0214] (2) Construction of pEC-XK99E-RBS1-RBS2 double-gene expression plasmid

[0215] Using the pEC-XK99E plasmid as a template, reverse PCR was performed with primers pEC-XK99E-RBS1-R: ggatccccgggtaccgagctcGATCTCCCTCCTTTgaattccatggtctgtttcctgtgtgaaat and pEC-XK99E-RBS2-F: gagctcggtacccggggatccAAAGGAGGTATAACtctagagtcgacctgcaggcatgcaagctt (the bold part is the RBS sequence). The PCR product was transformed into competent Escherichia coli DH5α cells and spread on an LB plate containing kanamycin antibiotic. After overnight culture, the colonies on the plate were collected and the plasmid was extracted and sent to Genewiz for sequencing. When the sequencing was correct, the strain of E. coli DH5α / pEC-XK99E-RBS1-RBS2 double-gene expression plasmid was successfully constructed and could be used for double-gene co-expression subsequently. The pEC-XK99E-RBS1-RBS2 double-gene expression plasmid was constructed.

[0216] Example 6: Enhancing the expression of NAD kinase and phosphoenolpyruvate carboxylase to promote glutamate synthesis

[0217] In Corynebacterium glutamicum, NAD kinase (encoded by the ppnk gene) is a key enzyme in the organism's energy metabolism pathway. Overexpressing the enzyme-encoding gene ppnk helps to increase the intracellular level of NADP(H), and thus may increase the yield of glutamate. The specific steps are as follows:

[0218] 1. Construction of Strain CG24

[0219] After inserting the ppnk gene into the RBS1 sequence on the pXMJ19 - RBS1 - RBS2 vector and the ppc gene into the RBS2 sequence on the pXMJ19 - RBS1 - RBS2 vector, the specific construction process is as follows:

[0220] (1) Using the CG18 genome as a template and P19 - ppnk - F / R as primers for PCR amplification to obtain a ppnk gene fragment with homologous arms (SEQ ID NO.8), which is ligated by homologous recombination with the linearized fragment obtained by reverse PCR amplification of the pXMJ19 - RBS1 - RBS2 plasmid using P19 - anti1 - F / R to obtain a ligation product.

[0221] The ligation product is transformed into Escherichia coli E.coli JM109, spread on LB solid medium (containing 20 μg / mL chloramphenicol), and cultured upside - down in a 37°C constant - temperature incubator for 8 - 12 h. Transformants are picked for verification. The correctly verified transformants are inoculated into LB liquid medium and cultured in a shaker flask at 37°C and 120 - 180 rpm for 8 - 12 h, and then the plasmid is extracted, namely pXMJ19 - RBS1 - ppnk - RBS2.

[0222] (2) Using P19 - ppc - F / R as primers for PCR amplification to obtain a ppc gene fragment with homologous arms (SEQ ID NO.9), which is ligated by homologous recombination with the linearized fragment obtained by reverse PCR amplification of the pXMJ19 - RBS1 - ppnk - RBS2 plasmid using P19 anti2 - F / R to obtain a ligation product;

[0223] The ligation product is transformed into Escherichia coli E.coli JM109, spread on LB solid medium (containing 20 μg / mL chloramphenicol), and cultured upside - down in a 37°C constant - temperature incubator for 8 - 12 h. Transformants are picked for verification. The correctly verified transformants are inoculated into LB liquid medium and cultured in a shaker flask at 37°C and 120 - 180 rpm for 8 - 12 h, and then the plasmid is extracted, namely pXMJ19 - RBS1 - ppnk - RBS2 - ppc. The primer sequences involved are shown in Table 6:

[0224] Table 6: Primer Sequences

[0225] Primer Name Primer Sequence P19-ppnk-F aagcttaaaggagggagatcatgactgcacccacgaacgc P19-ppnk-R ggatccgttatacctcctttttaccccgctgacctgggat P19-Rev1-F aaaggaggtataacggatcc P19-Rev1-R gatctccctcctttaagctt P19-ppc-F gggtaaaaaggaggtataacatgactgattttctacgcga P19-ppc-R agctcggtacccggggatccctagccggagttgcgcagtg P19-Rev2-F ggatccccgggtaccgagct P19-Rev2-R gttatacctcctttttaccc

[0226] (3) The recombinant plasmid pXMJ19-RBS1-ppnk-RBS2-ppc was electrotransformed into competent CG23 cells. After culturing in a shaker at 30 °C and 220 rpm for 3 - 4 h, the cells were centrifuged to collect the thalli, which were then spread on BHI solid medium containing 20 μg / mL chloramphenicol and further cultured at 30 °C for 24 - 48 h. The single colonies were examined under a microscope, and the transformants with correct morphology were selected for colony PCR verification. The strains with correct band sizes were the successfully constructed CG23 / pXMJ19-RBS1-ppnk-RBS2-ppc strains (named CG24).

[0227] 2. Fermentation preparation of glutamic acid ( Figure 5 )

[0228] The CG24 strain was used for fed-batch fermentation in a 5 L fermenter, and glutamic acid was prepared according to the method in step 2 of Example 2.

[0229] The results showed that after 32 h of fermentation, the glutamic acid yield was as high as 181.22 g / L, and the sugar-acid conversion rate was 71.4%, indicating that enhancing the expression of NAD kinase and phosphoenolpyruvate carboxylase was beneficial to the synthesis of glutamic acid.

[0230] Example 7: Enhancing the expression of phosphofructokinase and pyruvate kinase to promote glutamic acid synthesis

[0231] The specific steps are as follows:

[0232] 1. Construction of the CG25 strain

[0233] After inserting the pfk gene into the RBS1 sequence of the pEC-XK99E-RBS1-RBS2 vector and the pyk gene into the RBS2 sequence of the pEC-XK99E-RBS1-RBS2 vector, the specific construction process is as follows:

[0234] (1) Using the CG18 genome as a template and 99E-pfk-F / R as primers for PCR amplification, a pfk gene fragment containing homologous arms (SEQ ID NO.10) was obtained, which was ligated by homologous recombination with the linearized fragment obtained by inverse PCR amplification of the pEC-XK99E-RBS1-RBS2 plasmid with 99E reverse 1-F / R to obtain a ligation product.

[0235] The ligation product was transformed into Escherichia coli E.coli JM109 and spread on LB solid medium (containing 50 μg / mL kanamycin), and then cultured in an inverted manner in a constant temperature incubator at 37 °C for 8 - 12 h. The transformants were selected for verification, and the correctly verified transformants were inoculated into LB liquid medium and cultured in a shaker at 37 °C and 120 - 180 rpm for 8 - 12 h, after which the plasmid was extracted, namely pEC-XK99E-RBS1-pfk-RBS2.

[0236] (2) Perform PCR amplification using 99E-pyk-F / R as primers to obtain the pyk gene fragment containing homologous arms (SEQ ID NO.11), and carry out homologous recombination ligation with the linearized fragment obtained by reverse PCR amplification of the pEC-XK99E-RBS1-pfk-RBS2 plasmid using 99E reverse 2-F / R to obtain the ligation product;

[0237] Transform the ligation product into Escherichia coli E. coli JM109, spread it on LB solid medium (containing 50 μg / mL kanamycin), and incubate it upside down in a constant temperature incubator at 37 °C for 8 - 12 h. Pick the transformants for verification, inoculate the correctly verified transformants into LB liquid medium, and culture them in a shaking flask at 37 °C and 120 - 180 rpm for 8 - 12 h, then extract the plasmid, namely pEC-XK99E-RBS1-pfk-RBS2-pyk. The primer sequences involved are shown in Table 7:

[0238] Table 7: Primer sequences

[0239] Primer Name Primer Sequence 99E-pfk-F gaattcaaaggagggagatcatggaagacatgcgaattgc 99E-pfk-R tctagagttatacctcctttctatccaaacattgcctggg 99E-Rev1-F aaaggaggtataactctaga 99E-Rev1-R gatctccctcctttgaattc 99E-pyk-F ggatagaaaggaggtataacatgggcgtggatagacgaac 99E-pyk-R gcctgcaggtcgactctagattagagctttgcaatccttg 99E-Rev2-F tctagagtcgacctgcaggc 99E-Rev2-R gttatacctcctttctatcc

[0240] Electroporate the pEC-XK99E-RBS1-pfk-RBS2-pyk and pXMJ19-RBS1-ppnk-RBS2-ppc recombinant plasmids into CG23 competent cells simultaneously. After culturing in a shaking incubator at 30 °C and 220 rpm for 3 - 4 h, centrifuge to collect the bacterial cells and then spread them on BHI solid medium containing 20 μg / mL chloramphenicol and 50 μg / mL kanamycin, and continue to culture at 30 °C for 24 - 48 h. Examine the single colonies under a microscope, pick the transformants with correct morphology for colony PCR verification, and the ones with correct band sizes are named as the successfully constructed strain CG23 / pEC-XK99E-RBS1-pfk-RBS2-pyk / pXMJ19-RBS1-ppnk-RBS2-ppc (CG25).

[0241] Prepare the strain CG25 according to the method in step 2 of Example 2, and the yield of glutamic acid is as Figure 5 shown.

[0242] 2. Batch-fed fermentation for the preparation of glutamic acid( Figure 6 )

[0243] After activating the strain CG25 by streaking on a plate, pick a single colony and inoculate it into a 10 mL BHI liquid vial. After culturing for 18 - 24 h, transfer it to 10 mL seed medium at an inoculation amount of 1% (v / v) and culture it at 30 °C and 180 rpm for 24 h as the primary seed liquid.

[0244] All the primary seeds were inoculated into a 1-L flask containing 300 mL of seed medium and cultured at the same conditions (30 °C, 180 rpm) for 18 h to obtain the secondary seed solution, which was then transferred entirely into a 5-L fermenter containing 1.7 L of fermentation medium.

[0245] The fermentation temperature was controlled in a sequential increasing mode: 30 °C for 0 - 6 h, 32 °C for 7 - 12 h, 34 °C for 13 - 18 h, 36 °C for 18 - 24 h, and 38 °C for 24 - 32 h. The dissolved oxygen level was controlled by a staged oxygen supply mode: 20% for 0 - 15 h and 8% for 16 - 32 h. When the glucose concentration dropped to about 10 g / L, an 80% glucose solution was fed to control the residual sugar concentration at 5 - 10 g / L. IPTG with a final concentration of 0.2 mM was added for induction when OD600 reached approximately 20.

[0246] The results showed that after 32 h of fermentation, the glutamic acid yield reached 230.57 g / L and the sugar-acid conversion rate was 76.2%.

[0247] The yields of the strains of the present invention after 32 h of fermentation in a 5-L fermenter are shown in the following table.

[0248] Table 8: Yields and sugar-acid conversion rates of the strains of the present invention for fermentative production of glutamic acid

[0249] Strain Yield (g / L) Sugar-acid conversion rate (%) CG18 130.68 56.8 CG19 137.49 61.1 CG20 148.35 62.3 CG21 142.52 61.7 CG22 160.21 64.5 CG23 178.36 68.2 CG24 181.22 71.4 CG25 230.57 76.2

[0250] The results showed that the strain prepared by the method of the present invention had the highest yield among the current strains and had good application value.

[0251] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A glutamate dehydrogenase mutant, characterized in that: The glutamate dehydrogenase mutant is obtained by having an amino acid mutation at one or more positions of position 186 and position 222 based on the amino acid sequence corresponding to the parent glutamate dehydrogenase; The amino acid sequence of the glutamate dehydrogenase has at least 98% identity with the amino acid shown in SEQ ID NO. 12 and has glutamate dehydrogenase activity.

2. The glutamate dehydrogenase mutant according to claim 1, characterized in that The glutamate dehydrogenase mutant is based on the amino acid sequence of the glutamate dehydrogenase shown in SEQ ID NO.

12. The amino acid at position 186 was obtained by mutation from G to V; or the 222nd amino acid is mutated from N to D; Or the 186th amino acid mutates from G to V, and the 222nd amino acid mutates from N to D.

3. A polynucleotide encoding the glutamate dehydrogenase mutant according to claim 1 or 2, or a vector carrying the polynucleotide, or a cell expressing the glutamate dehydrogenase mutant according to claim 1 or 2.

4. A polynucleotide synthesis kit, characterized in that: Comprising the glutamate dehydrogenase mutant according to claim 1 or 2.

5. A method for improving the enzymatic activity of glutamate dehydrogenase, characterized in that: The method comprises: based on the amino acid sequence of SEQ ID NO.12 corresponding to the parent glutamate dehydrogenase, The amino acid at position 186 mutated from G to V; or the amino acid at position 222 mutates from N to D; Or the 186th amino acid mutates from G to V, and the 222nd amino acid mutates from N to D.

6. A recombinant Corynebacterium glutamicum, characterized in that The recombinant Corynebacterium glutamicum expresses the mutant according to claim 1 or 2; Preferably, the recombinant Corynebacterium glutamicum is a glutamate dehydrogenase mutant according to claim 1, which uses Corynebacterium glutamicum CG18 as a chassis cell, knocks out the isocitrate lyase encoding gene aceA, and integrates the Ptuf promoter at the site to control the expression; uses the PtacM promoter to overexpress the original glutamate synthase encoding genes gltB and gltD on the genome, and integrates the Ptuf promoter at the rph pseudogene site to control the expression of the transcriptional regulatory factor RosR derived from Corynebacterium glutamicum; and simultaneously overexpresses NAD kinase, phosphoenolpyruvate carboxylase, phosphofructokinase and pyruvate kinase derived from Corynebacterium glutamicum; Preferably, the nucleotide sequence of the isocitrate lyase encoding gene aceA is shown in SEQ ID NO.3; the glutamate dehydrogenase mutant is G186V / N222D, and its nucleotide sequence is shown in SEQ ID NO.4; the nucleotide sequence of the transcriptional regulatory factor RosR encoding gene is shown in SEQ ID NO.5; the nucleotide sequences of the promoters PtacM and Ptuf are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively; the nucleotide sequence of the NAD kinase encoding gene ppnk is shown in SEQ ID NO.8; the nucleotide sequence of the phosphoenolpyruvate carboxylase encoding gene ppc is shown in SEQ ID NO.9; the nucleotide sequence of the phosphofructokinase encoding gene pfk is shown in SEQ ID NO.10; the nucleotide sequence of the pyruvate kinase encoding gene pyk is shown in SEQ ID NO.11; Preferably, two copies of the glutamate dehydrogenase mutant are integrated into the aceA site of the isocitrate lyase encoding gene.

7. The recombinant Corynebacterium glutamicum according to claim 6, characterized in that pXMJ19 double-gene plasmid was used to overexpress NAD kinase and phosphoenolpyruvate carboxylase, and pEC-XK99E double-gene plasmid was used to overexpress phosphofructokinase and pyruvate kinase; Preferably, RBS1 is used to enhance the expression of NAD kinase and phosphofructokinase, and RBS2 is used to enhance the expression of pyruvate kinase and phosphoenolpyruvate carboxylase; the sequences of RBS1 and RBS2 are shown in SEQ ID NO.1-2, respectively.

8. A method for producing L-glutamic acid, characterized in that: The method comprises the following steps: using the recombinant Corynebacterium glutamicum described in claim 6 or 7 to ferment and prepare L-glutamic acid.

9. The method according to claim 8, characterized in that The method comprises the following steps: inoculating the recombinant Corynebacterium glutamicum seed solution into a fermentation medium at an inoculation amount of 15-20% by volume for fermentation; the fermentation temperature adopts a sequential temperature raising mode, 0-6h 30°C, 7-12h 32°C, 13-18h 34°C, 18-24h 36°C, 24-32h 38°C; adopting a staged oxygen supply mode to control the dissolved oxygen level, 0-15h 20%, 16-32h 8%; and controlling the residual sugar concentration at 5-10 g / L by adding 80% glucose solution.

10. Use of the mutant according to claim 1 or 2, or the polynucleotide or vector or cell according to claim 3, or the recombinant Corynebacterium glutamicum according to claim 6 or 7 in the preparation of L-glutamic acid or a product containing L-glutamic acid.

Images