Protein mutants, recombinant bacteria, and methods of making and using the same

Abstract

The present application relates to the field of microbial technology, in particular to protein mutants, recombinant bacteria and preparation method and application thereof. The pyruvate kinase mutant provided by the present application has reduced enzyme activity, and the phosphoenolpyruvate carboxylase mutant provided by the present application has enhanced enzyme activity. The pyruvate kinase mutant and the phosphoenolpyruvate carboxylase mutant can promote the accumulation of phosphoenolpyruvic acid when used alone, thereby promoting the synthesis of products such as lysine and other products taking aspartic acid as a precursor and ensuring the good growth of the strain. The two mutants can further improve the yield and conversion rate of the above products when used in combination. The lysine yield and conversion rate of the recombinant microorganism expressing the pyruvate kinase mutant and the phosphoenolpyruvate carboxylase mutant provided by the present application are significantly improved compared with the original strain, and the present application provides advantageous gene and strain resources for the breeding of aspartic acid, its derivatives and aspartic acid family amino acid production strains.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to pyruvate kinase mutants, phosphoenolpyruvate carboxylase mutants, recombinant bacteria and preparation method and application thereof. BACKGROUND

[0002] Pyruvate kinase is a key enzyme in glycolysis pathway, which catalyzes the conversion of phosphoenolpyruvate to pyruvate, and the latter is decarboxylated and dehydrogenated to acetyl-CoA, which enters the TCA cycle. Phosphoenolpyruvate has another way, which is converted to aspartate through carboxylation, and the latter is the precursor of lysine and other amino acids. Therefore, weakening pyruvate kinase will be beneficial to the entry of phosphoenolpyruvate into the lysine synthesis pathway, thereby improving the yield of lysine. In the prior art, the regulation mode of pyruvate kinase is to inactivate the gene, but this modification will cause the growth of bacteria to be inhibited, which has a large negative effect and is not conducive to industrial production.

[0003] Escherichia coli is a gram-negative bacterium, which has the advantages of fast growth, clear background and mature metabolic engineering means. Therefore, Escherichia coli is widely used in industrial fermentation field and can be used for producing L-amino acid, nucleotide and other organic acids.

[0004] Aspartate and aspartate family amino acids have wide applications in the fields of feed, food, medicine and chemical industry. L-lysine belongs to aspartate family amino acids, which is the second largest amino acid product in the world and is widely used in animal feed, medicine and food industry. About 90% of the produced L-lysine is used in feed industry, and 10% is used in food and medicine industry. As an animal feed additive, L-lysine can help animals absorb other amino acids, thereby improving the quality of feed. The metabolic pathway of L-lysine synthesized by Escherichia coli starts from L-aspartate, and L-lysine is obtained through multiple enzyme-catalyzed reactions. The lysine synthesis ability and growth performance of the production strain are the key factors affecting the performance of lysine fermentation production, therefore, it is of great significance to develop strains with excellent performance. SUMMARY

[0005] The first object of the present application is to provide pyruvate kinase mutants and phosphoenolpyruvate carboxylase mutants.

[0006] The second object of the present application is to provide recombinant bacteria containing the above protein mutants and preparation method thereof.

[0007] The third object of the present application is to provide the application of the above protein mutants and recombinant bacteria.

[0008] The fourth object of the present application is to provide a method for producing aspartate, its derivative or aspartate family amino acid.

[0009] Specifically, the present invention provides the following technical solutions:

[0010] In a first aspect, the present invention provides protein mutants, which are pyruvate kinase mutants and / or phosphoenolpyruvate carboxylase mutants, using the amino acid sequence of wild-type Escherichia coli pyruvate kinase as a reference sequence, wherein the pyruvate kinase mutant contains a mutation in which glycine at position 168 is replaced by an amino acid other than glycine.

[0011] Using the amino acid sequence of wild-type phosphoenolpyruvate carboxylase from Escherichia coli as a reference sequence, the phosphoenolpyruvate carboxylase mutant contains a mutation in which glutamic acid at position 210 is replaced by an amino acid other than glutamic acid.

[0012] The inventors of this invention, through years of research, discovered that amino acid substitution at the aforementioned specific position in pyruvate kinase can weaken enzyme activity, thereby increasing lysine yield without affecting bacterial growth. Amino acid substitution at the aforementioned specific position in phosphoenolpyruvate carboxylase can enhance enzyme activity, thereby increasing lysine yield. The inventors also found that the aforementioned weakening mutation of pyruvate kinase, when used in combination with the aforementioned mutation of phosphoenolpyruvate carboxylase, can synergistically increase lysine yield.

[0013] For the mutation mode of amino acid 168 of pyruvate kinase, preferably, the amino acid sequence of wild-type pyruvate kinase in *E. coli* is used as a reference sequence, and the pyruvate kinase mutant contains a mutation in which glycine at position 168 is replaced by aspartic acid or glutamic acid. Compared with mutation to other amino acids, mutating glycine at position 168 to aspartic acid or glutamic acid has a better enhancing effect on lysine synthesis.

[0014] For the mutation mode of amino acid 210 in phosphoenolpyruvate carboxylase, preferably, the amino acid sequence of wild-type phosphoenolpyruvate carboxylase from *Escherichia coli* is used as a reference sequence, and the phosphoenolpyruvate carboxylase mutant contains a mutation in which glutamic acid at position 210 is replaced by glycine. Compared with mutation to other amino acids, mutating glutamic acid at position 210 to glycine has a better enhancing effect on lysine synthesis.

[0015] For *Escherichia coli*, the amino acid sequence of wild-type pyruvate kinase is shown in SEQ ID NO.4. The amino acid sequence of wild-type phosphoenolpyruvate carboxylase is shown in SEQ ID NO.5.

[0016] Specifically, the pyruvate kinase mutant has an amino acid sequence as shown in SEQ ID NO.1 or 2.

[0017] The phosphoenolpyruvate carboxylase mutant has the amino acid sequence shown in SEQ ID NO.3.

[0018] Those skilled in the art should understand that adding a tagged protein to the N-terminus or C-terminus of the above-mentioned protein mutant sequence or fusing it with other proteins to form a fusion protein, without changing the activity of the above-mentioned mutant protein itself, the tagged protein or fusion protein is also within the scope of protection of this invention.

[0019] The present invention also provides a nucleic acid molecule encoding the mutant of the said protein.

[0020] Based on the amino acid sequence of the protein mutant provided above, those skilled in the art can obtain the sequence of the nucleic acid it encodes. Due to the degeneracy of codons, there is more than one nucleic acid sequence encoding the above amino acid sequence, and all nucleic acids capable of encoding the above protein mutant are within the protection scope of this invention.

[0021] As one embodiment of the present invention, the nucleic acid molecule encoding the pyruvate kinase mutant has a nucleotide sequence as shown in SEQ ID NO. 6 or 7.

[0022] The nucleic acid molecule encoding the phosphoenolpyruvate carboxylase mutant has a nucleotide sequence as shown in SEQ ID NO.8.

[0023] The present invention also provides biological materials containing the nucleic acid molecules, wherein the biological materials are recombinant DNA, vectors or host cells.

[0024] The recombinant DNA includes, but is not limited to, expression cassettes. The expression cassette is a recombinant nucleic acid molecule obtained by linking elements upstream or downstream of the nucleic acid molecule to drive its transcription and translation.

[0025] The vector may be an expression vector or a cloning vector, including but not limited to plasmid vectors, phage vectors, transposons, etc.

[0026] The host cell includes microbial cells.

[0027] Based on the above-mentioned protein mutants, the present invention also provides a recombinant microorganism that expresses the above-mentioned protein mutants.

[0028] Specifically, this invention provides any one of the following recombinant microorganisms:

[0029] (1) The recombinant microorganism expresses the pyruvate kinase mutant and does not express the pyruvate kinase present in its originating strain;

[0030] (2) The recombinant microorganism expresses the phosphoenolpyruvate carboxylase mutant;

[0031] (3) The recombinant microorganism expresses the pyruvate kinase mutant and does not express the pyruvate kinase present in its originating strain, and the recombinant microorganism expresses the phosphoenolpyruvate carboxylase mutant.

[0032] In this invention, the recombinant microorganism is preferably an Enterobacterium, more preferably an Escherichia spp., and most preferably Escherichia coli.

[0033] In this invention, the starting strain is a strain capable of accumulating aspartic acid, its derivatives, or aspartic acid family amino acids.

[0034] Preferably, the starting strain is an Escherichia coli capable of accumulating lysine.

[0035] In a preferred embodiment of the present invention, the starting strain is a high-lysine-producing mutagenized strain MHZ-0914, which was deposited on June 1, 2021, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 22648, and classified as Escherichia coli.

[0036] This invention also provides any of the following applications of the protein mutant, the nucleic acid molecule, the biological material, or the recombinant microorganism:

[0037] (1) Application in increasing the yield and / or conversion rate of aspartic acid, its derivatives or aspartic amino acids in microorganisms.

[0038] (2) Application in the construction of microorganisms for the production of aspartic acid, its derivatives or aspartic amino acids;

[0039] (3) Application in the fermentation production of aspartic acid, its derivatives or aspartic acid family amino acids.

[0040] In this invention, the aspartic acid derivative is a compound obtained by modifying aspartic acid, or a compound synthesized using aspartic acid as a precursor. The aspartic acid family of amino acids includes lysine, threonine, methionine, homoserine, and isoleucine.

[0041] Preferably, the aspartic acid family amino acid is lysine.

[0042] The present invention also provides a method for constructing the recombinant microorganism. For the recombinant microorganism in (1) above, the method includes: mutating the coding gene of pyruvate kinase in the starting strain to the coding gene of the pyruvate kinase mutant.

[0043] For the recombinant microorganism in (2) above, the method includes: expressing the phosphoenolpyruvate carboxylase mutant using any one or more of the following methods:

[0044] a. Mutate the coding gene for phosphoenolpyruvate carboxylase in the starting strain to the coding gene for the phosphoenolpyruvate carboxylase mutant.

[0045] b. Integrate the coding gene of the phosphoenolpyruvate carboxylase mutant at a location on the chromosome of the starting strain other than the location of the original phosphoenolpyruvate carboxylase coding gene.

[0046] c. Introduce an expression plasmid containing the coding gene of the phosphoenolpyruvate carboxylase mutant into the starting strain.

[0047] For the recombinant microorganisms in (3) above, the method includes: mutating the coding gene of pyruvate kinase in the starting strain to the coding gene of the pyruvate kinase mutant;

[0048] And, the phosphoenolpyruvate carboxylase mutant is expressed in any one or more of the following ways:

[0049] a. Mutate the coding gene for phosphoenolpyruvate carboxylase in the starting strain to the coding gene for the phosphoenolpyruvate carboxylase mutant.

[0050] b. Integrate the coding gene of the phosphoenolpyruvate carboxylase mutant at a location on the chromosome of the starting strain other than the location of the original phosphoenolpyruvate carboxylase coding gene.

[0051] c. Introduce an expression plasmid containing the coding gene of the phosphoenolpyruvate carboxylase mutant into the starting strain.

[0052] In this invention, the introduction of amino acid mutations can be achieved through the CRISPR recombination system or other conventional amino acid mutation techniques.

[0053] Based on the above-mentioned recombinant microorganisms, the present invention provides a method for producing aspartic acid, its derivatives or aspartic acid family amino acids, the method comprising: culturing the recombinant microorganisms.

[0054] Specifically, the method for producing aspartic acid, its derivatives, or aspartic acid family amino acids includes: inoculating the recombinant microorganisms into an activation culture medium for cultivation, selecting activated strains and inoculating them into a seed culture medium for seed culture, and then transferring the seed culture into a fermentation culture medium for fermentation.

[0055] Preferably, the fermentation medium comprises the following components: glucose 50-80 g / L, ammonium sulfate 35-45 g / L, yeast extract 3.0-5.0 g / L, potassium dihydrogen phosphate 1.0-2.0 g / L, magnesium sulfate heptahydrate 0.5-1.5 g / L, ferrous sulfate 0.02-0.04 g / L, manganese sulfate 0.02-0.04 g / L, calcium carbonate 0-30 g / L, pH 6.8-7.2.

[0056] Preferably, the seed culture medium comprises the following components: glucose 5-20 g / L, ammonium sulfate 2.0-6.0 g / L, yeast extract 1.5-2.5 g / L, potassium dihydrogen phosphate 2.0-4.0 g / L, magnesium sulfate heptahydrate 0.3-0.5 g / L, ferrous sulfate 0.005-0.02 g / L, manganese sulfate 0.005-0.02 g / L, pH 6.8-7.2.

[0057] The beneficial effects of the present invention are as follows: the pyruvate kinase mutant provided by the present invention has reduced enzyme activity, which can promote the accumulation of phosphoenolpyruvate, thereby promoting the synthesis of products such as lysine with aspartic acid as a precursor and ensuring good growth of the strain.

[0058] The phosphoenolpyruvate carboxylase mutant provided by this invention has enhanced enzyme activity, which can promote the accumulation of phosphoenolpyruvate and thus promote the synthesis of products such as lysine with aspartic acid as a precursor.

[0059] The pyruvate kinase mutant and the phosphoenolpyruvate carboxylase mutant provided by this invention can significantly improve the yield and conversion rate of lysine when used alone. The combined use of the two mutants has a synergistic effect, which can further improve the yield and conversion rate of the above products.

[0060] The recombinant microorganisms expressing pyruvate kinase mutants and phosphoenolpyruvate carboxylase mutants provided by this invention have significantly improved lysine production and conversion rates compared to the starting strains. These mutants and recombinant microorganisms provide favorable gene and strain resources for the breeding of aspartic acid, its derivatives, and aspartic acid family amino acids. Detailed Implementation

[0061] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0062] The primer sequence information used in the following examples is shown in Table 1.

[0063] Table 1 Primer sequence information

[0064] Primer name Sequence (5'-3') pTF-pykA-sgRNA-F tcctaggtataatactagtctcgacgccaacctgggtaagttttagagctagaaatagc pTF-pykA-sgRNA-R actagtattatacctaggactgagctagctgtcaag pykA-G168D-UF gagattgccgcaaaactggg pykA-G168D-UR atcgccgccaagtttgttga pykA-G168D-DF caacaaacttggcggcgatttgtcggctgaagcgctgacc pykA-G168D-DR cgctttctgaatgccgacca pykA-G168D-F1 tcaacaaacttggcggcgat pykA-G168D-R cgataataatcttgaaaaag pykA-G168D-F tttgctacgtccatgacttc pykA-G168E-DF tcaacaaacttggcggcgaattgtcggctgaagcgctgac pykA-G168E-F1 tcaacaaacttggcggcgaa pTF-ppc-sgRNA-F tcctaggtataatactagtcaaatggggctttgccgtaggttttagagctagaaatagc pTF-ppc-sgRNA-R actagtattatacctaggactgagctagctgtcaag ppc-UF aaggcgaagctgccagcaac ppc-UR cactacggcaaagccccatt ppc-DF aaatggggctttgccgtagtgggcaacagcctgtggcaag ppc-DR gtttttcatcagatagcgat ppc-F1 ggggctttgccgtagtgggc ppc-F tgaacgcgtagaaactatcc ppc-R cgttggcgataatacccatg

[0065] The gene names used in the following examples are explained below:

[0066] pykA: gene encoding pyruvate kinase;

[0067] ppc: gene encoding phosphoenolpyruvate carboxylase.

[0068] The starting strain used in the following examples is a high-lysine-producing mutagenized strain MHZ-0914, which was deposited on June 1, 2021, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 22648, and classified as Escherichia coli.

[0069] Unless otherwise specified, the techniques or conditions described in the following examples shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0070] Example 1: Construction of engineered bacteria containing the mutant gene pykA (G168D)

[0071] 1. Construction of pTargetF-N20(pykA-G168D) plasmid and Donor DNA

[0072] Step 1: Using pTF-pykA-sgRNA-F / pTF-pykA-sgRNA-R as primers and plasmid pTargetT as a template (see Multigene Editing in the Escherichiacoli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al. Appl. Environ Microbiol, 2015), amplified the pTF linear plasmid containing N20. The linear plasmid was assembled at 37°C using the Clone Express Seamless Assembly Kit, and then transformed into Trans1-T1 competent cells to obtain pTargetF-N20-pykA (G168D), which was then identified by PCR and sequenced for verification.

[0073] Step 2: Using the MG1655 genome as a template, amplify the upstream homologous arm ① using the pykA-G168D-UF / pykAG168D-UR primer pair, and amplify the downstream homologous arm ② using the pykAG168D-DF / pykA-G168D-DR primer pair. Using ① and ② as templates, amplify the Donor DNA using the pykA-G168D-UF / pykA-G168D-DR primer pair.

[0074] 2. Preparation and electroporation of competent cells

[0075] Step 1: Electrotransform the pCas plasmid (see Multigene Editing in the Escherichiacoli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al. Appl. Environ Microbiol, 2015) into competent cells of an Escherichia coli lysine-producing bacterium (this strain is deposited at the China Microbial Culture Collection Center, strain number CGMCC No. 22648) (the transformation method and competent cell preparation method are both based on Molecular Cloning III).

[0076] Step 2: Pick a single colony and place it in 5 mL of LB medium containing kanamycin and a final concentration of 10 mM arabinose. Incubate at 30°C and 200 rpm until OD500. 650 Electrocompetent cells were prepared after 0.4% concentration (the method for preparing competent cells is described in Molecular Cloning III).

[0077] Step 3: Electroporate the pTargetF-N20-pykA(G168D) plasmid and Donor DNA obtained in step 1 into competent cells with pCas (electroplation conditions: 2.5kV, 200Ω, 25μF), spread them on LB plates containing spectinomycin and kanamycin, and incubate at 30°C until single colonies are visible.

[0078] 3. Recombination Verification

[0079] Step 1: Use primer pair pykA-G168D-F1 / pykA-G168D-R to perform colony PCR verification on the above single colonies;

[0080] Step 2: Amplify the PCR-identified strain using primer pair pykA-G168D-F / pykA-G168D-R, and send the amplification product for sequencing to verify the integrity of the sequence.

[0081] 4. Plasmid elimination

[0082] Step 1: Select a single colony that has been correctly sequenced and inoculate it into 5 mL of LB medium containing kanamycin and a final concentration of 0.5 mM IPTG. After incubating overnight at 30°C, streak it onto an LB agar plate containing kanamycin.

[0083] Step 2: Pick a single colony and spot it onto LB agar plates containing kanamycin, spectinomycin and kanamycin alone, and incubate overnight at 30°C. If it cannot grow on LB agar plates containing kanamycin or spectinomycin, but grows on LB agar plates containing kanamycin, it indicates that the pTargetF-N20 plasmid has been lost.

[0084] Step 3: Pick positive colonies that have lost the pTargetF-N20 plasmid, inoculate them into antibiotic-free LB tubes, incubate at 42°C for 8 hours, then streak them onto LB plates and incubate overnight at 37°C.

[0085] Step 4: Pick a single colony and spot it onto LB agar plates containing kanamycin and LB agar plates without antibiotics. If it cannot grow on LB agar plates containing kanamycin but grows on LB agar plates without antibiotics, it indicates that the pCas plasmid is lost. The resulting strain is named MHZ-0915-1.

[0086] Example 2: Construction of engineered bacteria containing the mutant gene pykA (G168E)

[0087] The construction principle and method are the same as in Example 1. A strain containing the target mutation was obtained, in which the 168th amino acid of pyruvate kinase was mutated to glutamic acid. The obtained strain was named MHZ-0915-2.

[0088] 1. Construction of pTargetF-N20(pykA-G168E) plasmid and Donor DNA

[0089] Step 1: Using pTF-pykA-sgRNA-F / pTF-pykA-sgRNA-R as primers and pTargetT as a template, amplify the pTF linear plasmid containing N20. Assemble this linear plasmid at 37°C using the Clone Express Seamless Assembly Kit, then transform it into Trans1-T1 competent cells to obtain pTargetF-N20-pykA(G168E), and perform PCR identification and sequencing verification. This plasmid is used to provide the target sequence and can be used in conjunction with the pTargetF-N20(pykA-G168D) plasmid.

[0090] Step 2: Using the MG1655 genome as a template, the upstream homologous arm ① was amplified using the pykA-G168D-UF / pykAG168D-UR primer pair. The downstream homologous arm ② was amplified using the pykAG168E-DF / pykAG168D-DR primer pair. Using ① and ② as templates, the Donor DNA was amplified using the pykA-G168D-UF / pykA-G168D-DR primer pair.

[0091] 2. Preparation and electroporation of competent cells

[0092] Step 1: Prepare competent cells of CGMCC No.22648 and electroporate the pCas plasmid into these competent cells (the transformation method and the method for preparing competent cells are both based on Molecular Cloning III).

[0093] Step 2: Pick a single colony and place it in 5 mL of LB medium containing kanamycin and a final concentration of 10 mM arabinose. Incubate at 30°C and 200 rpm until OD500. 650 Electrocompetent cells were prepared after 0.4% concentration (the method for preparing competent cells is described in Molecular Cloning III).

[0094] Step 3: Electroporate the pTargetF-N20-pykA(G168E) plasmid and Donor DNA obtained in (1) into competent cells with pCas (electroplation conditions: 2.5kV, 200Ω, 25μF), spread them on LB plates containing spectinomycin and kanamycin, and incubate at 30°C until single colonies are visible.

[0095] 3. Recombination Verification

[0096] Step 1: Use primer pair pykA-G168E-F1 / pykA-G168D-R to perform colony PCR verification on the above single colonies;

[0097] Step 2: Amplify the PCR-identified strain using primer pair pykAG168D-F / pykAG168D-R, and send the amplification product for sequencing to verify the integrity of the sequence.

[0098] 4. Plasmid elimination

[0099] Step 1: Select a single colony that has been correctly sequenced and inoculate it into 5 mL of LB medium containing kanamycin and a final concentration of 0.5 mM IPTG. After incubating overnight at 30°C, streak it onto an LB agar plate containing kanamycin.

[0100] Step 2: Pick a single colony and spot it onto LB agar plates containing kanamycin, spectinomycin and kanamycin alone, and incubate overnight at 30°C. If it cannot grow on LB agar plates containing kanamycin or spectinomycin, but grows on LB agar plates containing kanamycin, it indicates that the pTargetF-N20 plasmid has been lost.

[0101] Step 3: Pick positive colonies that have lost the pTargetF-N20 plasmid, inoculate them into antibiotic-free LB tubes, incubate at 42°C for 8 hours, then streak them onto LB plates and incubate overnight at 37°C.

[0102] Step 4: Pick a single colony and spot it onto LB agar plates containing kanamycin and LB agar plates without antibiotics. If it cannot grow on LB agar plates containing kanamycin but grows on LB agar plates without antibiotics, it indicates that the pCas plasmid is lost. The resulting strain is named MHZ-0915-2.

[0103] Example 3: Construction of engineered bacteria containing the mutant gene ppc (E210G)

[0104] The construction principle and method are the same as in Example 1. The starting strain is CGMCC No. 22648, and the primers used are shown in Table 1 (pTF-ppc-sgRNA-F, pTF-ppc-sgRNA-R, ppc-UF, ppc-UR, ppc-DF, ppc-DR, ppc-F1, ppc-F, ppc-R). A strain containing the target mutation was obtained, in which the 210th amino acid of its phosphoenolpyruvate carboxylase was mutated from glutamic acid to glycine. The obtained strain was named MHZ-0915-3.

[0105] Example 4: Construction of engineered bacteria containing mutant genes pykA (G168D) and ppc (E210G)

[0106] The construction principle and method are the same as in Example 3. The starting strain is MHZ-0915-1. A strain containing the target mutation was obtained, in which the amino acid at position 210 of the phosphoenolpyruvate carboxylase was mutated from glutamic acid to glycine. The obtained strain was named MHZ-0915-4.

[0107] Example 5: Shake-flask fermentation verification of lysine production by recombinant strains

[0108] The shake-flask performance of the recombinant strains constructed in Examples 1-4 for lysine production was verified. The specific culture media used are as follows:

[0109] Activation medium: 10 g / L peptone, 10 g / L NaCl, 5 g / L yeast extract, 18 g / L agar powder, adjust pH to 7.0.

[0110] Seed culture medium: glucose 14 g / L, ammonium sulfate 4 g / L, yeast extract 2.0 g / L, potassium dihydrogen phosphate 3 g / L, magnesium sulfate heptahydrate 0.4 g / L, ferrous sulfate 0.01 g / L, manganese sulfate 0.01 g / L, pH 7.0.

[0111] Fermentation medium: glucose 60 g / L, ammonium sulfate 40 g / L, yeast extract 4.0 g / L, potassium dihydrogen phosphate 1.6 g / L, magnesium sulfate heptahydrate 1.0 g / L, ferrous sulfate 0.03 g / L, manganese sulfate 0.03 g / L, calcium carbonate 25 g / L, pH 7.0.

[0112] The shake-flask fermentation method for producing lysine is as follows:

[0113] 1. Seed activation: Take the strain to be verified from the cryopreservation tube, streak it on the seed activation medium, and incubate at 37℃ for 12h;

[0114] 2. Seed culture: Pick one loop of activated seeds from the plate and inoculate it into a 500 mL Erlenmeyer flask containing 20 mL of seed culture medium. Incubate at 33 °C and 220 r / min for 7 h with shaking.

[0115] 3. Fermentation culture: Inoculate 2 mL of seed culture into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, and culture at 33 °C and 220 r / min for 12 h with shaking.

[0116] 4. Centrifuge 2 mL of fermentation broth (12000 rpm, 2 min), collect the supernatant, and use HPLC to detect the L-lysine content in the fermentation broth of recombinant bacteria and control bacteria. The concentrations are shown in Table 2 (the data in the table are the average values ​​of the three batches).

[0117] Table 2 Performance test of recombinant strains in producing lysine

[0118] Strain OD 600 ]] L-lysine (g / L) Sugar acid conversion rate % CGMCC No.22648 15.6 21.3 35.5 MHZ-0915-1 (pykA G168D )]]> 15.2 22.6 37.7 MHZ-0915-2 (pykA G168E )]]> 14.9 22.1 36.8 MHZ-0915-3 (ppc E210G )]]> 14.5 22.5 37.5 MHZ-0915-4 (pykA G168D , ppc E210G )]]> 14.2 24.6 41.0

[0119] The fermentation results above show that the L-lysine accumulation of the starting strain CGMCC No.22648 was 21.3 g / L, with a conversion rate of 35.5%. Compared to the starting strain, the four recombinant strains constructed in this embodiment of the invention all showed varying degrees of improvement in lysine yield and conversion rate, indicating that the mutation site in this invention has a promoting effect on lysine accumulation.

[0120] Example 6: Fermentation verification of lysine production by recombinant strain in a fermenter

[0121] The three superior strains obtained, MHZ-0915-1, MHZ-0915-3, and MHZ-0915-4, were further validated through scale-up fermentation in a fermenter. The fermenters used were German Dasgip quadruple 1L fermenters. The fermentation medium formulations are shown in Table 3, and the process control is shown in Table 4. The fermentation experiment for each strain was repeated three times, and the results are shown in Table 5.

[0122] Table 3 Fermentation medium formulation

[0123]

[0124] Table 4 Fermentation Control Process

[0125]

[0126] Table 5 Results of L-Lysine fermentation experiment

[0127]

[0128] The results of the scaled-up fermentation experiments showed that the modified engineered strains MHZ-0915-1, MHZ-0915-3, and MHZ-0915-4 exhibited higher sugar-acid conversion rates. Among them, MHZ-0915-4 showed the most significant improvement, with a 10% increase in sugar-acid conversion rate compared to the original strain. These results indicate that the pyruvate kinase mutant and phosphoenolpyruvate carboxylase mutant provided by this invention can effectively improve the lysine production efficiency of *Escherichia coli*.

[0129] In summary, both pyruvate kinase mutants provided in this invention promote lysine accumulation, but the mutation to aspartic acid is more effective. The phosphoenolpyruvate carboxylase mutant also promotes lysine accumulation, and its combined effect with pyruvate kinase modification is more pronounced than modification alone. From a metabolic pathway perspective, pyruvate kinase mutation may reduce competition for its direct substrate, phosphoenolpyruvate, while the phosphoenolpyruvate carboxylase mutant can more effectively catalyze the carboxylation of phosphoenolpyruvate to oxaloacetate, a precursor for lysine synthesis.

[0130] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Li Yan <120> Protein mutants, recombinant bacteria, their preparation methods and applications <130> KHP211117883.2 <160> 28 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 480 <212> PRT <213> Artificial Sequence <400> 1 Met Ser Arg Arg Leu Arg Arg Thr Lys Ile Val Thr Thr Leu Gly Pro 1 5 10 15 Ala Thr Asp Arg Asp Asn Asn Leu Glu Lys Val Ile Ala Ala Gly Ala 20 25 30 Asn Val Val Arg Met Asn Phe Ser His Gly Ser Pro Glu Asp His Lys 35 40 45 Met Arg Ala Asp Lys Val Arg Glu Ile Ala Ala Lys Leu Gly Arg His 50 55 60 Val Ala Ile Leu Gly Asp Leu Gln Gly Pro Lys Ile Arg Val Ser Thr 65 70 75 80 Phe Lys Glu Gly Lys Val Phe Leu Asn Ile Gly Asp Lys Phe Leu Leu 85 90 95 Asp Ala Asn Leu Gly Lys Gly Glu Gly Asp Lys Glu Lys Val Gly Ile 100 105 110 Asp Tyr Lys Gly Leu Pro Ala Asp Val Val Pro Gly Asp Ile Leu Leu 115 120 125 Leu Asp Asp Gly Arg Val Gln Leu Lys Val Leu Glu Val Gln Gly Met 130 135 140 Lys Val Phe Thr Glu Val Thr Val Gly Gly Pro Leu Ser Asn Asn Lys 145 150 155 160 Gly Ile Asn Lys Leu Gly Gly Asp Leu Ser Ala Glu Ala Leu Thr Glu 165 170 175 Lys Asp Lys Ala Asp Ile Lys Thr Ala Ala Leu Ile Gly Val Asp Tyr 180 185 190 Leu Ala Val Ser Phe Pro Arg Cys Gly Glu Asp Leu Asn Tyr Ala Arg 195 200 205 Arg Leu Ala Arg Asp Ala Gly Cys Asp Ala Lys Ile Val Ala Lys Val 210 215 220 Glu Arg Ala Glu Ala Val Cys Ser Gln Asp Ala Met Asp Asp Ile Ile 225 230 235 240 Leu Ala Ser Asp Val Val Met Val Ala Arg Gly Asp Leu Gly Val Glu 245 250 255 Ile Gly Asp Pro Glu Leu Val Gly Ile Gln Lys Ala Leu Ile Arg Arg 260 265 270 Ala Arg Gln Leu Asn Arg Ala Val Ile Thr Ala Thr Gln Met Met Glu 275 280 285 Ser Met Ile Thr Asn Pro Met Pro Thr Arg Ala Glu Val Met Asp Val 290 295 300 Ala Asn Ala Val Leu Asp Gly Thr Asp Ala Val Met Leu Ser Ala Glu 305 310 315 320 Thr Ala Ala Gly Gln Tyr Pro Ser Glu Thr Val Ala Ala Met Ala Arg 325 330 335 Val Cys Leu Gly Ala Glu Lys Ile Pro Ser Ile Asn Val Ser Lys His 340 345 350 Arg Leu Asp Val Gln Phe Asp Asn Val Glu Glu Ala Ile Ala Met Ser 355 360 365 Ala Met Tyr Ala Ala Asn His Leu Lys Gly Val Thr Ala Ile Ile Thr 370 375 380 Met Thr Glu Ser Gly Arg Thr Ala Leu Met Thr Ser Arg Ile Ser Ser 385 390 395 400 Gly Leu Pro Ile Phe Ala Met Ser Arg His Glu Arg Thr Leu Asn Leu 405 410 415 Thr Ala Leu Tyr Arg Gly Val Thr Pro Val His Phe Asp Ser Ala Asn 420 425 430 Asp Gly Val Ala Ala Ala Ser Glu Ala Val Asn Leu Leu Arg Asp Lys 435 440 445 Gly Tyr Leu Met Ser Gly Asp Leu Val Ile Val Thr Gln Gly Asp Val 450 455 460 Met Ser Thr Val Gly Ser Thr Asn Thr Thr Arg Ile Leu Thr Val Glu 465 470 475 480 <210> 2 <211> 480 <212> PRT <213> Artificial Sequence <400> 2 Met Ser Arg Arg Leu Arg Arg Thr Lys Ile Val Thr Thr Leu Gly Pro 1 5 10 15 Ala Thr Asp Arg Asp Asn Asn Leu Glu Lys Val Ile Ala Ala Gly Ala 20 25 30 Asn Val Val Arg Met Asn Phe Ser His Gly Ser Pro Glu Asp His Lys 35 40 45 Met Arg Ala Asp Lys Val Arg Glu Ile Ala Ala Lys Leu Gly Arg His 50 55 60 Val Ala Ile Leu Gly Asp Leu Gln Gly Pro Lys Ile Arg Val Ser Thr 65 70 75 80 Phe Lys Glu Gly Lys Val Phe Leu Asn Ile Gly Asp Lys Phe Leu Leu 85 90 95 Asp Ala Asn Leu Gly Lys Gly Glu Gly Asp Lys Glu Lys Val Gly Ile 100 105 110 Asp Tyr Lys Gly Leu Pro Ala Asp Val Val Pro Gly Asp Ile Leu Leu 115 120 125 Leu Asp Asp Gly Arg Val Gln Leu Lys Val Leu Glu Val Gln Gly Met 130 135 140 Lys Val Phe Thr Glu Val Thr Val Gly Gly Pro Leu Ser Asn Asn Lys 145 150 155 160 Gly Ile Asn Lys Leu Gly Gly Glu Leu Ser Ala Glu Ala Leu Thr Glu 165 170 175 Lys Asp Lys Ala Asp Ile Lys Thr Ala Ala Leu Ile Gly Val Asp Tyr 180 185 190 Leu Ala Val Ser Phe Pro Arg Cys Gly Glu Asp Leu Asn Tyr Ala Arg 195 200 205 Arg Leu Ala Arg Asp Ala Gly Cys Asp Ala Lys Ile Val Ala Lys Val 210 215 220 Glu Arg Ala Glu Ala Val Cys Ser Gln Asp Ala Met Asp Asp Ile Ile 225 230 235 240 Leu Ala Ser Asp Val Val Met Val Ala Arg Gly Asp Leu Gly Val Glu 245 250 255 Ile Gly Asp Pro Glu Leu Val Gly Ile Gln Lys Ala Leu Ile Arg Arg 260 265 270 Ala Arg Gln Leu Asn Arg Ala Val Ile Thr Ala Thr Gln Met Met Glu 275 280 285 Ser Met Ile Thr Asn Pro Met Pro Thr Arg Ala Glu Val Met Asp Val 290 295 300 Ala Asn Ala Val Leu Asp Gly Thr Asp Ala Val Met Leu Ser Ala Glu 305 310 315 320 Thr Ala Ala Gly Gln Tyr Pro Ser Glu Thr Val Ala Ala Met Ala Arg 325 330 335 Val Cys Leu Gly Ala Glu Lys Ile Pro Ser Ile Asn Val Ser Lys His 340 345 350 Arg Leu Asp Val Gln Phe Asp Asn Val Glu Glu Ala Ile Ala Met Ser 355 360 365 Ala Met Tyr Ala Ala Asn His Leu Lys Gly Val Thr Ala Ile Ile Thr 370 375 380 Met Thr Glu Ser Gly Arg Thr Ala Leu Met Thr Ser Arg Ile Ser Ser 385 390 395 400 Gly Leu Pro Ile Phe Ala Met Ser Arg His Glu Arg Thr Leu Asn Leu 405 410 415 Thr Ala Leu Tyr Arg Gly Val Thr Pro Val His Phe Asp Ser Ala Asn 420 425 430 Asp Gly Val Ala Ala Ala Ser Glu Ala Val Asn Leu Leu Arg Asp Lys 435 440 445 Gly Tyr Leu Met Ser Gly Asp Leu Val Ile Val Thr Gln Gly Asp Val 450 455 460 Met Ser Thr Val Gly Ser Thr Asn Thr Thr Arg Ile Leu Thr Val Glu 465 470 475 480 <210> 3 <211> 883 <212> PRT <213> Artificial Sequence <400> 3 Met Asn Glu Gln Tyr Ser Ala Leu Arg Ser Asn Val Ser Met Leu Gly 1 5 10 15 ​​​​​​​​​​​​Asn Asp Glu Leu Leu Pro Val Ala Arg Ala Phe Ser Gln Phe Leu Asn 65 70 75 80 Leu Ala Asn Thr Ala Glu Gln Tyr His Ser Ile Ser Pro Lys Gly Glu 85 90 95 Ala Ala Ser Asn Pro Glu Val Ile Ala Arg Thr Leu Arg Lys Leu Lys 100 105 110 Asn Gln Pro Glu Leu Ser Glu Asp Thr Ile Lys Lys Ala Val Glu Ser 115 120 125 Leu Ser Leu Glu Leu Val Leu Thr Ala His Pro Thr Glu Ile Thr Arg 130 135 140 Arg Thr Leu Ile His Lys Met Val Glu Val Asn Ala Cys Leu Lys Gln 145 150 155 160 Leu Asp Asn Lys Asp Ile Ala Asp Tyr Glu His Asn Gln Leu Met Arg 165 170 175 Arg Leu Arg Gln Leu Ile Ala Gln Ser Trp His Thr Asp Glu Ile Arg 180 185 190 Lys Leu Arg Pro Ser Pro Val Asp Glu Ala Lys Trp Gly Phe Ala Val 195 200 205 Val Gly Asn Ser Leu Trp Gln Gly Val Pro Asn Tyr Leu Arg Glu Leu 210 215 220 Asn Glu Gln Leu Glu Glu Asn Leu Gly Tyr Lys Leu Pro Val Glu Phe 225 230 235 240 Val Pro Val Arg Phe Thr Ser Trp Met Gly Gly Asp Arg Asp Gly Asn 245 250 255 Pro Asn Val Thr Ala Asp Ile Thr Arg His Val Leu Leu Leu Ser Arg 260 265 270 Trp Lys Ala Thr Asp Leu Phe Leu Lys Asp Ile Gln Val Leu Val Ser 275 280 285 Glu Leu Ser Met Val Glu Ala Thr Pro Glu Leu Leu Ala Leu Val Gly 290 295 300 Glu Glu Gly Ala Ala Glu Pro Tyr Arg Tyr Leu Met Lys Asn Leu Arg 305 310 315 320 Ser Arg Leu Met Ala Thr Gln Ala Trp Leu Glu Ala Arg Leu Lys Gly 325 330 335 Glu Glu Leu Pro Lys Pro Glu Gly Leu Leu Thr Gln Asn Glu Glu Leu 340 345 350 Trp Glu Pro Leu Tyr Ala Cys Tyr Gln Ser Leu Gln Ala Cys Gly Met 355 360 365 Gly Ile Ile Ala Asn Gly Asp Leu Leu Asp Thr Leu Arg Arg Val Lys 370 375 380 Cys Phe Gly Val Pro Leu Val Arg Ile Asp Ile Arg Gln Glu Ser Thr 385 390 395 400 Arg His Thr Glu Ala Leu Gly Glu Leu Thr Arg Tyr Leu Gly Ile Gly 405 410 415 Asp Tyr Glu Ser Trp Ser Glu Ala Asp Lys Gln Ala Phe Leu Ile Arg 420 425 430 Glu Leu Asn Ser Lys Arg Pro Leu Leu Pro Arg Asn Trp Gln Pro Ser 435 440 445 Ala Glu Thr Arg Glu Val Leu Asp Thr Cys Gln Val Ile Ala Glu Ala 450 455 460 Pro Gln Gly Ser Ile Ala Ala Tyr Val Ile Ser Met Ala Lys Thr Pro 465 470 475 480 Ser Asp Val Leu Ala Val His Leu Leu Leu Lys Glu Ala Gly Ile Gly 485 490 495 Phe Ala Met Pro Val Ala Pro Leu Phe Glu Thr Leu Asp Asp Leu Asn 500 505 510 Asn Ala Asn Asp Val Met Thr Gln Leu Leu Asn Ile Asp Trp Tyr Arg 515 520 525 Gly Leu Ile Gln Gly Lys Gln Met Val Met Ile Gly Tyr Ser Asp Ser 530 535 540 Ala Lys Asp Ala Gly Val Met Ala Ala Ser Trp Ala Gln Tyr Gln Ala 545 550 555 560 Gln Asp Ala Leu Ile Lys Thr Cys Glu Lys Ala Gly Ile Glu Leu Thr 565 570 575 Leu Phe His Gly Arg Gly Gly Ser Ile Gly Arg Gly Gly Ala Pro Ala 580 585 590 His Ala Ala Leu Leu Ser Gln Pro Pro Gly Ser Leu Lys Gly Gly Leu 595 600 605 Arg Val Thr Glu Gln Gly Glu Met Ile Arg Phe Lys Tyr Gly Leu Pro 610 615 620 Glu Ile Thr Val Ser Ser Leu Ser Leu Tyr Thr Gly Ala Ile Leu Glu 625 630 635 640 Ala Asn Leu Leu Pro Pro Pro Glu Pro Lys Glu Ser Trp Arg Arg Ile 645 650 655 Met Asp Glu Leu Ser Val Ile Ser Cys Asp Val Tyr Arg Gly Tyr Val 660 665 670 Arg Glu Asn Lys Asp Phe Val Pro Tyr Phe Arg Ser Ala Thr Pro Glu 675 680 685 Gln Glu Leu Gly Lys Leu Pro Leu Gly Ser Arg Pro Ala Lys Arg Arg 690 695 700 Pro Thr Gly Gly Val Glu Ser Leu Arg Ala Ile Pro Trp Ile Phe Ala 705 710 715 720 Trp Thr Gln Asn Arg Leu Met Leu Pro Ala Trp Leu Gly Ala Gly Thr 725 730 735 Ala Leu Gln Lys Val Val Glu Asp Gly Lys Gln Ser Glu Leu Glu Ala 740 745 750 Met Cys Arg Asp Trp Pro Phe Phe Ser Thr Arg Leu Gly Met Leu Glu 755 760 765 Met Val Phe Ala Lys Ala Asp Leu Trp Leu Ala Glu Tyr Tyr Asp Gln 770 775 780 Arg Leu Val Asp Lys Ala Leu Trp Pro Leu Gly Lys Glu Leu Arg Asn 785 790 795 800 Leu Gln Glu Glu Asp Ile Lys Val Val Leu Ala Ile Ala Asn Asp Ser 805 810 815 His Leu Met Ala Asp Leu Pro Trp Ile Ala Glu Ser Ile Gln Leu Arg 820 825 830 Asn Ile Tyr Thr Asp Pro Leu Asn Val Leu Gln Ala Glu Leu Leu His 835 840 845 Arg Ser Arg Gln Ala Glu Lys Glu Gly Gln Glu Pro Asp Pro Arg Val 850 855 860 Glu Gln Ala Leu Met Val Thr Ile Ala Gly Ile Ala Ala Gly Met Arg 865 870 875 880 Asn Thr Gly <210> 4 <211> 480 <212> PRT <213> Artificial Sequence <400> 4 Met Ser Arg Arg Leu Arg Arg Thr Lys Ile Val Thr Thr Leu Gly Pro 1 5 10 15 Ala Thr Asp Arg Asp Asn Asn Leu Glu Lys Val Ile Ala Ala Gly Ala 20 25 30 Asn Val Val Arg Met Asn Phe Ser His Gly Ser Pro Glu Asp His Lys 35 40 45 Met Arg Ala Asp Lys Val Arg Glu Ile Ala Ala Lys Leu Gly Arg His 50 55 60 Val Ala Ile Leu Gly Asp Leu Gln Gly Pro Lys Ile Arg Val Ser Thr 65 70 75 80 Phe Lys Glu Gly Lys Val Phe Leu Asn Ile Gly Asp Lys Phe Leu Leu 85 90 95 Asp Ala Asn Leu Gly Lys Gly Glu Gly Asp Lys Glu Lys Val Gly Ile 100 105 110 Asp Tyr Lys Gly Leu Pro Ala Asp Val Val Pro Gly Asp Ile Leu Leu 115 120 125 Leu Asp Asp Gly Arg Val Gln Leu Lys Val Leu Glu Val Gln Gly Met 130 135 140 Lys Val Phe Thr Glu Val Thr Val Gly Gly Pro Leu Ser Asn Asn Lys 145 150 155 160 Gly Ile Asn Lys Leu Gly Gly Gly Leu Ser Ala Glu Ala Leu Thr Glu 165 170 175 Lys Asp Lys Ala Asp Ile Lys Thr Ala Ala Leu Ile Gly Val Asp Tyr 180 185 190 Leu Ala Val Ser Phe Pro Arg Cys Gly Glu Asp Leu Asn Tyr Ala Arg 195 200 205 Arg Leu Ala Arg Asp Ala Gly Cys Asp Ala Lys Ile Val Ala Lys Val 210 215 220 Glu Arg Ala Glu Ala Val Cys Ser Gln Asp Ala Met Asp Asp Ile Ile 225 230 235 240 Leu Ala Ser Asp Val Val Met Val Ala Arg Gly Asp Leu Gly Val Glu 245 250 255 Ile Gly Asp Pro Glu Leu Val Gly Ile Gln Lys Ala Leu Ile Arg Arg 260 265 270 Ala Arg Gln Leu Asn Arg Ala Val Ile Thr Ala Thr Gln Met Met Glu 275 280 285 Ser Met Ile Thr Asn Pro Met Pro Thr Arg Ala Glu Val Met Asp Val 290 295 300 Ala Asn Ala Val Leu Asp Gly Thr Asp Ala Val Met Leu Ser Ala Glu 305 310 315 320 Thr Ala Ala Gly Gln Tyr Pro Ser Glu Thr Val Ala Ala Met Ala Arg 325 330 335 Val Cys Leu Gly Ala Glu Lys Ile Pro Ser Ile Asn Val Ser Lys His 340 345 350 Arg Leu Asp Val Gln Phe Asp Asn Val Glu Glu Ala Ile Ala Met Ser 355 360 365 Ala Met Tyr Ala Ala Asn His Leu Lys Gly Val Thr Ala Ile Ile Thr 370 375 380 Met Thr Glu Ser Gly Arg Thr Ala Leu Met Thr Ser Arg Ile Ser Ser 385 390 395 400 Gly Leu Pro Ile Phe Ala Met Ser Arg His Glu Arg Thr Leu Asn Leu 405 410 415 Thr Ala Leu Tyr Arg Gly Val Thr Pro Val His Phe Asp Ser Ala Asn 420 425 430 Asp Gly Val Ala Ala Ala Ser Glu Ala Val Asn Leu Leu Arg Asp Lys 435 440 445 Gly Tyr Leu Met Ser Gly Asp Leu Val Ile Val Thr Gln Gly Asp Val 450 455 460 Met Ser Thr Val Gly Ser Thr Asn Thr Thr Arg Ile Leu Thr Val Glu 465 470 475 480 <210> 5 <211> 883 <212> PRT <213> Artificial Sequence <400> 5 Met Asn Glu Gln Tyr Ser Ala Leu Arg Ser Asn Val Ser Met Leu Gly 1 5 10 15 Lys Val Leu Gly Glu Thr Ile Lys Asp Ala Leu Gly Glu His Ile Leu 20 25 30 Glu Arg Val Glu Thr Ile Arg Lys Leu Ser Lys Ser Ser Arg Ala Gly 35 40 45 Asn Asp Ala Asn Arg Gln Glu Leu Leu Thr Thr Leu Gln Asn Leu Ser 50 55 60 Asn Asp Glu Leu Leu Pro Val Ala Arg Ala Phe Ser Gln Phe Leu Asn 65 70 75 80 Leu Ala Asn Thr Ala Glu Gln Tyr His Ser Ile Ser Pro Lys Gly Glu 85 90 95 Ala Ala Ser Asn Pro Glu Val Ile Ala Arg Thr Leu Arg Lys Leu Lys 100 105 110 Asn Gln Pro Glu Leu Ser Glu Asp Thr Ile Lys Lys Ala Val Glu Ser 115 120 125 Leu Ser Leu Glu Leu Val Leu Thr Ala His Pro Thr Glu Ile Thr Arg 130 135 140 Arg Thr Leu Ile His Lys Met Val Glu Val Asn Ala Cys Leu Lys Gln 145 150 155 160 Leu Asp Asn Lys Asp Ile Ala Asp Tyr Glu His Asn Gln Leu Met Arg 165 170 175 Arg Leu Arg Gln Leu Ile Ala Gln Ser Trp His Thr Asp Glu Ile Arg 180 185 190 Lys Leu Arg Pro Ser Pro Val Asp Glu Ala Lys Trp Gly Phe Ala Val 195 200 205 Val Glu Asn Ser Leu Trp Gln Gly Val Pro Asn Tyr Leu Arg Glu Leu 210 215 220 Asn Glu Gln Leu Glu Glu Asn Leu Gly Tyr Lys Leu Pro Val Glu Phe 225 230 235 240 Val Pro Val Arg Phe Thr Ser Trp Met Gly Gly Asp Arg Asp Gly Asn 245 250 255 Pro Asn Val Thr Ala Asp Ile Thr Arg His Val Leu Leu Leu Ser Arg 260 265 270 Trp Lys Ala Thr Asp Leu Phe Leu Lys Asp Ile Gln Val Leu Val Ser 275 280 285 Glu Leu Ser Met Val Glu Ala Thr Pro Glu Leu Leu Ala Leu Val Gly 290 295 300 Glu Glu Gly Ala Ala Glu Pro Tyr Arg Tyr Leu Met Lys Asn Leu Arg 305 310 315 320 Ser Arg Leu Met Ala Thr Gln Ala Trp Leu Glu Ala Arg Leu Lys Gly 325 330 335 Glu Glu Leu Pro Lys Pro Glu Gly Leu Leu Thr Gln Asn Glu Glu Leu 340 345 350 Trp Glu Pro Leu Tyr Ala Cys Tyr Gln Ser Leu Gln Ala Cys Gly Met 355 360 365 Gly Ile Ile Ala Asn Gly Asp Leu Leu Asp Thr Leu Arg Arg Val Lys 370 375 380 Cys Phe Gly Val Pro Leu Val Arg Ile Asp Ile Arg Gln Glu Ser Thr 385 390 395 400 Arg His Thr Glu Ala Leu Gly Glu Leu Thr Arg Tyr Leu Gly Ile Gly 405 410 415 Asp Tyr Glu Ser Trp Ser Glu Ala Asp Lys Gln Ala Phe Leu Ile Arg 420 425 430 Glu Leu Asn Ser Lys Arg Pro Leu Leu Pro Arg Asn Trp Gln Pro Ser 435 440 445 Ala Glu Thr Arg Glu Val Leu Asp Thr Cys Gln Val Ile Ala Glu Ala 450 455 460 Pro Gln Gly Ser Ile Ala Ala Tyr Val Ile Ser Met Ala Lys Thr Pro 465 470 475 480 Ser Asp Val Leu Ala Val His Leu Leu Leu Lys Glu Ala Gly Ile Gly 485 490 495 Phe Ala Met Pro Val Ala Pro Leu Phe Glu Thr Leu Asp Asp Leu Asn 500 505 510 Asn Ala Asn Asp Val Met Thr Gln Leu Leu Asn Ile Asp Trp Tyr Arg 515 520 525 Gly Leu Ile Gln Gly Lys Gln Met Val Met Ile Gly Tyr Ser Asp Ser 530 535 540 Ala Lys Asp Ala Gly Val Met Ala Ala Ser Trp Ala Gln Tyr Gln Ala 545 550 555 560 Gln Asp Ala Leu Ile Lys Thr Cys Glu Lys Ala Gly Ile Glu Leu Thr 565 570 575 Leu Phe His Gly Arg Gly Gly Ser Ile Gly Arg Gly Gly Ala Pro Ala 580 585 590 His Ala Ala Leu Leu Ser Gln Pro Pro Gly Ser Leu Lys Gly Gly Leu 595 600 605 Arg Val Thr Glu Gln Gly Glu Met Ile Arg Phe Lys Tyr Gly Leu Pro 610 615 620 Glu Ile Thr Val Ser Ser Leu Ser Leu Tyr Thr Gly Ala Ile Leu Glu 625 630 635 640 Ala Asn Leu Leu Pro Pro Pro Glu Pro Lys Glu Ser Trp Arg Arg Ile 645 650 655 Met Asp Glu Leu Ser Val Ile Ser Cys Asp Val Tyr Arg Gly Tyr Val 660 665 670 Arg Glu Asn Lys Asp Phe Val Pro Tyr Phe Arg Ser Ala Thr Pro Glu 675 680 685 Gln Glu Leu Gly Lys Leu Pro Leu Gly Ser Arg Pro Ala Lys Arg Arg 690 695 700 Pro Thr Gly Gly Val Glu Ser Leu Arg Ala Ile Pro Trp Ile Phe Ala 705 710 715 720 Trp Thr Gln Asn Arg Leu Met Leu Pro Ala Trp Leu Gly Ala Gly Thr 725 730 735 Ala Leu Gln Lys Val Val Glu Asp Gly Lys Gln Ser Glu Leu Glu Ala 740 745 750 Met Cys Arg Asp Trp Pro Phe Phe Ser Thr Arg Leu Gly Met Leu Glu 755 760 765 Met Val Phe Ala Lys Ala Asp Leu Trp Leu Ala Glu Tyr Tyr Asp Gln 770 775 780 Arg Leu Val Asp Lys Ala Leu Trp Pro Leu Gly Lys Glu Leu Arg Asn 785 790 795 800 Leu Gln Glu Glu Asp Ile Lys Val Val Leu Ala Ile Ala Asn Asp Ser 805 810 815 His Leu Met Ala Asp Leu Pro Trp Ile Ala Glu Ser Ile Gln Leu Arg 820 825 830 Asn Ile Tyr Thr Asp Pro Leu Asn Val Leu Gln Ala Glu Leu Leu His 835 840 845 Arg Ser Arg Gln Ala Glu Lys Glu Gly Gln Glu Pro Asp Pro Arg Val 850 855 860 Glu Gln Ala Leu Met Val Thr Ile Ala Gly Ile Ala Ala Gly Met Arg 865 870 875 880 Asn Thr Gly <210> 6 <211> 1443 <212> DNA <213> Artificial Sequence <400> 6 atgtccagaa ggcttcgcag aacaaaaatc gttaccacgt taggcccagc aacagatcgc 60 gataataatc ttgaaaaagt tatcgcggcg ggtgccaacg ttgtacgtat gaacttttct 120 cacggctcgc ctgaagatca caaaatgcgc gcggataaag ttcgtgagat tgccgcaaaa 180 ctggggcgtc atgtggctat tctgggtgac ctccaggggc ccaaaatccg tgtatccacc 240 tttaaagaag gcaaagtttt cctcaatatt ggggataaat tcctgctcga cgccaacctg 300 ggtaaaggtg aaggcgacaa agaaaaagtc ggtatcgact acaaaggcct gcctgctgac 360 gtcgtgcctg gtgacatcct gctgctggac gatggtcgcg tccagttaaa agtactggaa 420 gttcagggca tgaaagtgtt caccgaagtc accgtcggtg gtcccctctc caacaataaa 480 ggtatcaaca aacttggcgg cgatttgtcg gctgaagcgc tgaccgaaaa agacaaagca 540 gacattaaga ctgcggcgtt gattggcgta gattacctgg ctgtctcctt cccacgctgt 600 ggcgaagatc tgaactatgc ccgtcgcctg gcacgcgatg caggatgtga tgcgaaaatt 660 gttgccaagg ttgaacgtgc ggaagccgtt tgcagccagg atgcaatgga tgacatcatc 720 ctcgcctctg acgtggtaat ggttgcacgt ggcgacctcg gtgtggaaat tggcgacccg 780 gaactggtcg gcattcagaa agcgttgatc cgtcgtgcgc gtcagctaaa ccgagcggta 840 atcacggcga cccagatgat ggagtcaatg attactaacc cgatgccgac gcgtgcagaa 900 gtcatggacg tagcaaacgc cgttctggat ggtactgacg ctgtgatgct gtctgcagaa 960 actgccgctg ggcagtatcc gtcagaaacc gttgcagcca tggcgcgcgt ttgcctgggt 1020 gcggaaaaaa tcccgagcat caacgtttct aaacaccgtc tggacgttca gttcgacaat 1080 gtggaagaag ctattgccat gtcagcaatg tacgcagcta accacctgaa aggcgttacg 1140 gcgatcatca ccatgaccga atcgggtcgt accgcgctga tgacctcccg tatcagctct 1200 ggtctgccaa ttttcgccat gtcgcgccat gaacgtacgc tgaacctgac tgctctctat 1260 cgtggcgtta cgccggtgca ctttgatagc gctaatgacg gcgtagcagc tgccagcgaa 1320 gcggttaatc tgctgcgcga taaaggttac ttgatgtctg gtgacctggt gattgtcacc 1380 cagggcgacg tgatgagtac cgtgggttct actaatacca cgcgtatttt aacggtagag 1440 taa 1443 <210> 7 <211> 1443 <212> DNA <213> Artificial Sequence <400> 7 atgtccagaa ggcttcgcag aacaaaaatc gttaccacgt taggcccagc aacagatcgc 60 gataataatc ttgaaaaagt tatcgcggcg ggtgccaacg ttgtacgtat gaacttttct 120 cacggctcgc ctgaagatca caaaatgcgc gcggataaag ttcgtgagat tgccgcaaaa 180 ctggggcgtc atgtggctat tctgggtgac ctccaggggc ccaaaatccg tgtatccacc 240 tttaaagaag gcaaagtttt cctcaatatt ggggataaat tcctgctcga cgccaacctg 300 ggtaaaggtg aaggcgacaa agaaaaagtc ggtatcgact acaaaggcct gcctgctgac 360 gtcgtgcctg gtgacatcct gctgctggac gatggtcgcg tccagttaaa agtactggaa 420 gttcagggca tgaaagtgtt caccgaagtc accgtcggtg gtcccctctc caacaataaa 480 ggtatcaaca aacttggcgg cgagttgtcg gctgaagcgc tgaccgaaaa agacaaagca 540 gacattaaga ctgcggcgtt gattggcgta gattacctgg ctgtctcctt cccacgctgt 600 ggcgaagatc tgaactatgc ccgtcgcctg gcacgcgatg caggatgtga tgcgaaaatt 660 gttgccaagg ttgaacgtgc ggaagccgtt tgcagccagg atgcaatgga tgacatcatc 720 ctcgcctctg acgtggtaat ggttgcacgt ggcgacctcg gtgtggaaat tggcgacccg 780 gaactggtcg gcattcagaa agcgttgatc cgtcgtgcgc gtcagctaaa ccgagcggta 840 atcacggcga cccagatgat ggagtcaatg attactaacc cgatgccgac gcgtgcagaa 900 gtcatggacg tagcaaacgc cgttctggat ggtactgacg ctgtgatgct gtctgcagaa 960 actgccgctg ggcagtatcc gtcagaaacc gttgcagcca tggcgcgcgt ttgcctgggt 1020 gcggaaaaaa tcccgagcat caacgtttct aaacaccgtc tggacgttca gttcgacaat 1080 gtggaagaag ctattgccat gtcagcaatg tacgcagcta accacctgaa aggcgttacg gcgatcatca ccatgaccga atcgggtcgt accgcgctga tgacctcccg tatcagctct ggtctgccaa ttttcgccat gtcgcgccat gaacgtacgc tgaacctgac tgctctctat cgtggcgtta cgccggtgca ctttgatagc gctaatgacg gcgtagcagc tgccagcgaa gcggttaatc tgctgcgcga taaaggttac ttgatgtctg gtgacctggt gattgtcacc 1380 1440. 1440. 1440. 1440. 1440. 1440. 1440. 1440. 1440. 1440. 1440 taa 1443 <210> 8 <211> 2652 <212> DNA <213> Artificial Sequence <400> 8 atgaacgaac aatattccgc attgcgtagt aatgtcagta tgctcggcaa agtgctggga 120. gaaaccatca aggatgcgtt gggagaacac attcttgaac gcgtagaaac tatccgtaag ttgtcgaaat cttcacgcgc tggcaatgat gctaaccgcc aggagttgct caccacctta caaaatttgt cgaacgacga gctgctgccc gttgcgcgtg cgtttagtca gttcctgac 240 ctggccaaca ccgccgagca atacacagc atttcgccga aaggcgaagc tgccagcaac 300 ccggaagtga tcgcccgcac cctgcgtaaa ctgaaaaacc agccggaact gagcgaagac 360 accatcaaaa aagcagtgga atcgctgtcg ctggaactgg tcctcacggc tcacccaacc 420 gaaattaccc gtcgtacact gatccacaaa atggtggaag tgaacgcctg tttaaaacag 480 ctcgataaca aagatatcgc tgactacgaa cacaaccagc tgatgcgtcg cctgcgccag 540 ttgatcgccc agtcatggca taccgatgaa atccgtaagc tgcgtccaag cccggtagat 600 gaagccaaat ggggctttgc cgtagtggga aacagcctgt ggcaaggcgt accaaattac 660 ctgcgcgaac tgaacgaaca actggaagag aacctcggct acaaactgcc cgtcgaattt 720 gttccggtcc gttttacttc gtggatgggc ggcgaccgcg acggcaaccc gaacgtcact 780 gccgatatca cccgccacgt cctgctactc agccgctgga aagccaccga tttgttcctg 840 aaagatattc aggtgctggt ttctgaactg tcgatggttg aagcgacccc tgaactgctg 900 gcgctggttg gcgaagaagg tgccgcagaa ccgtatcgct atctgatgaa aaacctgcgt 960 tctcgcctga tggcgacaca ggcatggctg gaagcgcgcc tgaaaggcga agaactgcca 1080. aaaccagaag gcctgctgac aaaacgaa gaactgtggg aaccgctcta cgcttgctac cagtcacttc aggcgtgtgg catgggtatt atcgccaacg gcgatctgct cgacaccctg cgccgcgtga aatgtttcgg cgtaccgctg gtccgtattg atatccgtca ggagagcacg cgtcataccg aagcgctggg cgagctgacc cgctacctcg gtatcggcga ctacgaaagc tggtcagagg ccgacaaaca ggcgttcctg atccgcgac tgaactccaa acgtccgctt ctgccgcgca actggcaacc aagcgccgaa acgcgcgaag tgctcgatac ctgccaggtg attgccgaag caccgcaagg ctccattgcc gcctacgtga tctcgatggc gaaaacgccg tccgacgtac tggctgtcca cctgctgctg aaagaagcgg gtatcgggtt tgcgatgccg gttgctccgc tgtttgaaac cctcgatgat ctgaacaacg ccaacgatgt catgacccag ctgctcaata ttgactggta tcgtggcctg attcagggca aacagatggt gatgattggc tattccgact cagcaaaaga tgcgggagtg atggcagctt cctgggcgca atatcaggca caggatgcat taatcaaaac ctgcgaaaaa gcgggtattg agctgacgtt gttccacggt 1740 cgcggcggtt ccattggtcg cggcggcgca cctgctcatg cggcgctgct gtcacaaccg 1800 ccaggaagcc tgaaaggcgg cctgcgcgta accgaacagg gcgagatgat ccgctttaaa 1860 tatggtctgc cagaaatcac cgtcagcagc ctgtcgcttt ataccggggc gattctggaa 1920 gccaacctgc tgccaccgcc ggagccgaaa gagagctggc gtcgcattat ggatgaactg 1980 tcagtcatct cctgcgatgt ctaccgcggc tacgtacgtg aaaacaaaga ttttgtgcct 2040 tacttccgct ccgctacgcc ggaacaagaa ctgggcaaac tgccgttggg ttcacgtccg 2100 gcgaaacgtc gcccaaccgg cggcgtcgag tcactacgcg ccattccgtg gatcttcgcc 2160 tggacgcaaa accgtctgat gctccccgcc tggctgggtg caggtacggc gctgcaaaaa 2220 gtggtcgaag acggcaaaca gagcgagctg gaggctatgt gccgcgattg gccattcttc 2280 tcgacgcgtc tcggcatgct ggagatggtc ttcgccaaag cagacctgtg gctggcggaa 2340 tactatgacc aacgcctggt agacaaagca ctgtggccgt taggtaaaga gttacgcaac 2400 ctgcaagaag aagacatcaa agtggtgctg gcgattgcca acgattccca tctgatggcc 2460 gatctgccgt ggattgcaga gtctattcag ctacggaata tttacaccga cccgctgaac 2520 gtattgcagg ccgagttgct gcaccgctcc cgccaggcag aaaaagaagg ccaggaaccg 2580 gatcctcgcg tcgaacaagc gttaatggtc actattgccg ggattgcggc aggtatgcgt 2640 aataccggct aa 2652 <210> 9 <211> 59 <212> DNA <213> Artificial Sequence <400> 9 tcctaggtat aatactagtc tcgacgccaa cctgggtaag ttttagagct agaaatagc 59 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <400> 10 actagtatta tacctaggac tgagctagct gtcaag 36 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 gagattgccg caaaactggg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 atcgccgcca agtttgttga 20 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <400> 13 caacaaactt ggcggcgatt tgtcggctga agcgctgacc 40 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 cgctttctga atgccgacca 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 tcaacaaact tggcggcgat 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 cgataataat cttgaaaaag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 tttgctacgt ccatgacttc 20 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <400> 18 tcaacaaact tggcggcgaa ttgtcggctg aagcgctgac 40 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 tcaacaaact tggcggcgaa 20 <210> 20 <211> 59 <212> DNA <213> Artificial Sequence <400> 20 tcctaggtat aatactagtc aaatggggct ttgccgtagg ttttagagct agaaatagc 59 <210> twenty one <211> 36 <212> DNA <213> Artificial Sequence <400> twenty one actagtatta tacctaggac tgagctagct gtcaag 36 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two aaggcgaagc tgccagcaac 20 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three cactacggca aagccccatt 20 <210> twenty four <211> 40 <212> DNA <213> Artificial Sequence <400> twenty four aaatggggct ttgccgtagt gggcaacagc ctgtggcaag 40 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <400> 25 gtttttcatc agatagcgat 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 ggggctttgc cgtagtgggc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 tgaacgcgta gaaactatcc 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 cgttggcgat aatacccatg 20

Claims

1. A protein mutant, characterized in that, It is a pyruvate kinase mutant and / or a phosphoenolpyruvate carboxylase mutant, wherein the amino acid sequence of the pyruvate kinase mutant is as shown in SEQ ID NO.1 or 2, and the amino acid sequence of the phosphoenolpyruvate carboxylase mutant is as shown in SEQ ID NO.

3.

2. A nucleic acid molecule encoding the protein mutant of claim 1.

3. A biological material containing the nucleic acid molecule of claim 2, wherein the biological material is recombinant DNA, a vector, or a host cell.

4. A recombinant microorganism, characterized in that, The recombinant microorganism expresses the protein mutant of claim 1; The recombinant microorganism is Escherichia coli.

5. The recombinant microorganism according to claim 4, characterized in that, The recombinant microorganism expresses the pyruvate kinase mutant but does not express the pyruvate kinase present in its originating strain; And / or, the recombinant microorganism expresses the phosphoenolpyruvate carboxylase mutant.

6. Any of the following applications of the protein mutant of claim 1, the nucleic acid molecule of claim 2, or the biomaterial of claim 3: (1) Application in increasing the yield and / or conversion rate of lysine in Escherichia coli; (2) Application in the construction of Escherichia coli for lysine production.

7. The application of the recombinant microorganisms according to claim 4 or 5 in the fermentation production of lysine.

8. The method for constructing recombinant microorganisms according to claim 4 or 5, characterized in that, include: The coding gene for pyruvate kinase in the starting strain was mutated to the coding gene for the pyruvate kinase mutant. And / or, the phosphoenolpyruvate carboxylase mutant is expressed in any one or more of the following ways: (1) The coding gene for phosphoenolpyruvate carboxylase in the starting strain was mutated to the coding gene for the phosphoenolpyruvate carboxylase mutant. (2) Integrate the coding gene of the phosphoenolpyruvate carboxylase mutant at a location on the chromosome of the starting strain other than the location of the original phosphoenolpyruvate carboxylase coding gene. (3) Introduce an expression plasmid containing the coding gene of the phosphoenolpyruvate carboxylase mutant into the starting strain.

9. A method for producing lysine, characterized in that, include: Cultivate the recombinant microorganisms as described in claim 4 or 5.

Images