Novel phosphoenolpyruvate carboxylase variants and methods of producing 5'-inosinic acid using the same

Abstract

The present invention relates to novel phosphoenolpyruvate carboxylase variants and methods of producing 5'-inosinic acid using the same. Due to the substitution of one or more amino acids in the amino acid sequence constituting the phosphoenolpyruvate carboxylase, the phosphoenolpyruvate carboxylase variant has a modified protein activity, and thus a recombinant microorganism comprising the phosphoenolpyruvate carboxylase variant can efficiently produce 5'-inosinic acid.

Description

Technical Field

[0001] This invention relates to novel phosphoenolpyruvate carboxylase variants and methods for producing 5'-inosine using them. Background Technology

[0002] 5'-Inosinic acid (or inosine monophosphate (IMP)) is an intermediate in the nucleic acid biosynthesis metabolic system, playing important physiological roles not only in plants and animals but also in various applications, including food, pharmaceuticals, and multiple medical applications. In particular, 5'-Inosinic acid is a nucleic acid-based flavoring agent, attracting considerable attention as a savory flavoring agent due to its significant synergistic effect with monosodium glutamate (MSG) in taste.

[0003] Methods for producing 5'-inosine include enzymatic degradation of ribonucleic acid extracted from yeast cells and chemical phosphorylation of inosine produced through fermentation. Recently, the primary method has been to cultivate microorganisms that produce 5'-inosine and recover the 5'-inosine accumulated in the culture medium.

[0004] To improve the efficiency of 5'-inosine production using microorganisms, various recombinant or mutant strains with excellent 5'-inosine productivity have been developed by applying genetic recombination technology to microorganisms widely used to produce useful substances such as nucleic acids or L-amino acids (e.g., *Escherichia coli* and *Corynebacterium*), along with methods for producing 5'-inosine using them. Specifically, attempts have been made to enhance 5'-inosine production by targeting genes involved in the 5'-inosine biosynthesis pathway, such as enzymes, transcription factors, and transporters, or by inducing promoter mutations that regulate the expression of these genes. However, dozens to hundreds of types of proteins (e.g., enzymes, transcription factors, and transporters) are directly or indirectly involved in 5'-inosine production, and therefore, significant research is still needed to improve 5'-inosine productivity by altering the activity of these proteins.

[0005] [Existing technical documents]

[0006] [Patent Literature]

[0007] Korean Patent No. 10-116602 Summary of the Invention

[0008] Technical issues

[0009] One object of the present invention is to provide novel phosphoenolpyruvate carboxylase variants.

[0010] Another object of the present invention is to provide a polynucleotide encoding the said variant.

[0011] Another object of the present invention is to provide a transformant comprising the said variant or polynucleotide.

[0012] Another object of the present invention is to provide a method for producing 5'-inosine using the said transformant.

[0013] Technical solution

[0014] One aspect of the invention provides a variant of phosphoenolpyruvate carboxylase, wherein one or more amino acids at positions 472 and 673 of the amino acid sequence of SEQ ID NO:4 are replaced by other amino acids.

[0015] The term "phosphoenolpyruvate carboxylase" used in this invention catalyzes the removal of carbon dioxide from phosphoenolpyruvate, and it can be a polypeptide or protein consisting of the amino acid sequence of SEQ ID NO:4 and having phosphoenolpyruvate carboxylase activity.

[0016] Information on the nucleic acid and protein sequences of phosphoenolpyruvate carboxylase can be obtained from known sequence databases (e.g., GenBank, UniProt).

[0017] According to one embodiment of the present invention, phosphoenolpyruvate carboxylase may be encoded by the nucleotide sequence of SEQ ID NO:3.

[0018] The amino acid sequence of the phosphoenolpyruvate carboxylase according to the present invention, or the nucleotide sequence encoding it, may include an amino acid sequence or nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with the amino acid sequence of SEQ ID NO:4 or the nucleotide sequence of SEQ ID NO:3. The terms “homology” or “identity” as used herein refer to the percentage of identity between two sequences, which is determined by comparing a reference nucleotide sequence or amino acid sequence with any other nucleotide sequence or amino acid sequence to correspond as closely as possible to each other and analyzing the compared sequences.

[0019] According to one embodiment of the present invention, phosphoenolpyruvate carboxylase may be derived from wild-type Corynebacterium stationis.

[0020] As used herein, the term "variant" refers to a protein having an amino acid sequence different from that before the mutation, but retaining the function or properties of the protein before the mutation. The mutation is caused by a mutation in the nucleotide sequence of the gene encoding the protein, resulting from a conserved substitution and / or modification of one or more amino acids at the N-terminus, C-terminus, and / or interior of the amino acid sequence. The term "conserved substitution" as used herein means replacing one amino acid with another amino acid having similar structure and / or chemical properties. Conservative substitutions may have minimal or no effect on the activity of the protein or polypeptide. Additionally, the term "modification" refers to the substitution, insertion, deletion, etc., of one or more amino acids. The amino acids are selected from alanine (Ala, A), isoleucine (Ile, I), valine (Val, V), leucine (Leu, L), methionine (Met, M), asparagine (Asn, N), cysteine ​​(Cys, C), glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), glutamic acid (Glu, E), arginine (Arg, R), histidine (His, H), lysine (Lys, K), glycine (Gly, G), and proline (Pro, P).

[0021] Additionally, some variants include those in which one or more parts (e.g., the N-terminal leader sequence or transmembrane region) have been removed, or those in which a part has been removed from the N-terminus and / or C-terminus of the mature protein.

[0022] Compared to the protein before the mutation, the variant may have the ability to increase (enhance), remain unchanged, or decrease (weaken). Here, the term "increase or enhance" includes: the case where the activity of the protein itself is increased compared to the activity of the protein before the mutation; the case where the overall activity of the protein in the cell is higher than that of wild-type strains or strains expressing the protein before the mutation due to increased expression or translation of the gene encoding the protein; and combinations thereof. Conversely, the term "decrease or weaken" includes: the case where the activity of the protein itself is decreased compared to the activity of the protein before the mutation; the case where the overall activity of the protein in the cell is lower than that of wild-type strains or strains expressing the protein before the mutation due to decreased expression or translation of the gene encoding the protein; and combinations thereof. In this invention, the term "variant" may be used interchangeably with terms such as variant type, modification, variant polypeptide, mutated protein, mutant, etc.

[0023] According to one embodiment of the present invention, the variant may consist of the amino acid sequence of SEQ ID NO:2, wherein the proline at position 472 of the amino acid sequence of SEQ ID NO:4 is replaced by serine, and the glycine at position 673 is replaced by aspartic acid.

[0024] More specifically, the phosphoenolpyruvate carboxylase variant may contain an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with the amino acid sequence of SEQ ID NO:2.

[0025] Another aspect of the invention provides a polynucleotide encoding a variant of phosphoenolpyruvate carboxylase.

[0026] As used in this invention, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or longer, which is a long-chain polymer of nucleotides formed by covalently linking nucleotide monomers. More specifically, the term "polynucleotide" refers to a polynucleotide fragment encoding a variant.

[0027] According to one embodiment of the present invention, the polynucleotide may comprise a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2.

[0028] More specifically, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO:1, wherein the nucleotide “c” at position 1414 of the nucleotide sequence encoding phosphoenolpyruvate carboxylase of SEQ ID NO:3 is replaced by the nucleotide “t”, and the nucleotide “g” at position 2018 is replaced by the nucleotide “a”.

[0029] Another aspect of the invention provides a vector comprising a polynucleotide encoding a variant of phosphoenolpyruvate carboxylase.

[0030] Another aspect of the invention provides a transformant comprising a phosphoenolpyruvate carboxylase variant or a polynucleotide.

[0031] As used herein, the term "vector" refers to any type of nucleic acid sequence transfer structure used as a means of transferring and expressing a target gene in a host cell. Unless otherwise stated, the term "vector" may mean a vector that allows the nucleic acid sequence contained therein to be expressed after insertion into the host cell genome and / or a vector that allows the nucleic acid sequence to be expressed independently. The vector contains essential regulatory elements that are operatively linked so that the inserted gene can be expressed. As used herein, the term "operatively linked" means that the target gene and its regulatory sequence are functionally linked together in a manner that enables gene expression, and "regulatory elements" include a promoter for initiating transcription, any operon sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0032] The vectors used in this invention are not particularly limited, as long as they can replicate in host cells, and any vector known in the art can be used. Some examples of vectors include natural or recombinant plasmids, granules, viruses, and bacteriophages. Some examples of phage vectors or granule vectors include, but are not limited to, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A, and some examples of plasmid vectors include, but are not limited to, the pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0033] Vectors can typically be constructed as either vectors for cloning or vectors for expression. Vectors for expression can be conventional vectors used in the art for expressing foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using a variety of methods known in the art.

[0034] The term "recombinant vector" as used in this invention can be transformed into a suitable host cell and subsequently replicated independently of the host cell genome, or it can be integrated into the genome itself. In this case, the "suitable host cell" may contain an origin of replication, which is a specific nucleotide sequence that enables the vector to replicate in the suitable host cell and from which replication begins. For example, when the vector used is an expression vector and a prokaryotic cell is used as the host, the vector typically contains a strong promoter capable of promoting transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.); a ribosome binding site for initiating translation; and a transcription / translation termination sequence. When a eukaryotic cell is used as the host, the vector contains an origin of replication manipulated in the eukaryotic cell, and some examples of origins of replication include, but are not limited to, the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the gland origin of replication, the AAV origin of replication, and the BBV origin of replication. In addition, recombinant vectors may contain promoters derived from mammalian cell genomes (e.g., metallothionein promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV-tk promoter, etc.), and usually have a polyadenylated sequence as a transcription termination sequence.

[0035] Recombinant vectors may contain selection markers. Selection markers are used to select transformants (host cells) transformed with the vector, and because only cells expressing the selection marker can survive in a culture medium treated with the selection marker, transformed cells can be selected. Some representative examples of selection markers include, but are not limited to, kanamycin, streptomycin, and chloramphenicol.

[0036] Transformants can be generated by inserting a recombinant vector into a host cell, and can be obtained by introducing a recombinant vector into a suitable host cell. A host cell is a cell capable of stably and continuously cloning or expressing an expression vector, and any host cell known in the art can be used.

[0037] In cases where a vector is transformed into prokaryotic cells to produce recombinant microorganisms, some examples of host cells that can be used include, but are not limited to: *E. coli* sp. strains, such as *E. coli* DH5α, *E. coli* JM109, *E. coli* BL21, *E. coli* RR1, *E. coli* LE392, *E. coli* B, *E. coli* X 1776, *E. coli* W3110, and *E. coli* XL1-Blue; *Bacillus* sp. strains, such as *Bacillus subtilis* and *Bacillus thuringiensis*; *Corynebacterium* sp. strains, such as *Corynebacterium glutamicum* and *Corynebacterium tarda*; and various *Enterobacteriaceae* strains, such as *Salmonella typhimurium* and *Serratia marcescens*. Species include *marcescens* and *Pseudomonas*.

[0038] In cases where a vector is transformed into eukaryotic cells to produce recombinant microorganisms, some examples of host cells that can be used include, but are not limited to, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines.

[0039] The term "transformation" as used in this invention refers to the phenomenon in which external DNA is introduced into a host cell, thereby artificially inducing genetic changes, and the term "transformed organism" refers to a host cell in which external DNA has been introduced and the expression of the target gene is stably maintained.

[0040] Transformation can be performed using a suitable vector introduction technique selected based on the host cell type, enabling the target gene or a recombinant vector containing it to be expressed in the host cell. For example, vector introduction can be performed via electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or any combination thereof, but not limited to these methods. As long as the transformed gene can be expressed in the host cell, it can be inserted into the host cell's chromosome, or it can exist extrachromosomally, but is not limited to these methods.

[0041] Transformers may include cells transfected, transformed, or infected in vivo or in vitro with the recombinant vector of the present invention, and may be used in the same sense as recombinant host cells, recombinant cells, or recombinant microorganisms.

[0042] Genes inserted into the recombinant vector of the present invention can be introduced into host cells, such as Corynebacterium strains, through homologous recombination crossover.

[0043] According to one embodiment of the present invention, the transformant may be a Corynebacterium genus microorganism.

[0044] Corynebacterium species can include, but are not limited to, *Corynebacterium crudilactis*, *Corynebacterium deserti*, *Corynebacterium callunae*, *Corynebacterium suranareeae*, *Corynebacterium lubricantis*, *Corynebacterium doosanense*, *Corynebacterium efficiens*, *Corynebacterium uterequi*, *Corynebacterium pacaense*, *Corynebacterium singulare*, *Corynebacterium humireducens*, *Corynebacterium marinum*, *Corynebacterium halotolerans*, *Corynebacterium spheniscorum*, and *Corynebacterium freundii*. Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, or Corynebacterium flavescens.

[0045] The transformant in this invention may be: a strain containing the above-mentioned phosphoenolpyruvate carboxylase variant or a polynucleotide encoding it, or a vector containing a phosphoenolpyruvate carboxylase variant; a strain expressing the phosphoenolpyruvate carboxylase variant or polynucleotide; or a strain having phosphoenolpyruvate carboxylase variant activity, but is not limited thereto.

[0046] In addition to phosphoenolpyruvate carboxylase variants, the transformants of the present invention may also contain other protein variants or genetic mutants.

[0047] According to one embodiment of the invention, the transformant may have the ability to produce 5'-inosine.

[0048] 5'-Inosinic acid is a nucleic acid-based compound that imparts flavor to food, especially umami (salty) taste, and it is used with the same meaning as inosine monophosphate (IMP).

[0049] Transformants may naturally possess the ability to produce 5'-inosine, or they may be transformants artificially endowed with the ability to produce 5'-inosine.

[0050] According to one embodiment of the invention, the transformant may have an enhanced ability to produce 5'-inosine due to changes in phosphoenolpyruvate carboxylase activity.

[0051] The term "enhanced production capacity" as used in this invention refers to an increase in 5'-inosinic acid productivity compared to that of the parental strain. The term "parental strain" as used herein refers to a wild-type strain or a mutant strain to be mutated, and includes strains to be directly mutated or transformed using recombinant vectors, etc. In this invention, the parental strain may be a wild-type Corynebacterium strain or a Corynebacterium strain mutated from a wild-type microorganism.

[0052] Compared to the parent strain, the transformants according to the invention exhibit an enhanced ability to produce 5'-inosine due to the change in phosphoenolpyruvate carboxylase activity caused by the introduction of a phosphoenolpyruvate carboxylase variant. More specifically, the amount of 5'-inosinic acid produced by the transformant may be at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% higher than the amount of 5'-inosinic acid produced by the parent strain, or may be 1.1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 times higher than the amount of 5'-inosinic acid produced by the parent strain, but is not limited thereto. For example, the amount of 5'-inosinic acid produced by a transformant containing a phosphoenolpyruvate carboxylase variant can be at least 5% higher than the amount of 5'-inosinic acid produced by the parent strain, specifically 5% to 50% (preferably 10% to 40%).

[0053] Another aspect of the invention provides a method for producing 5'-inosine, comprising the steps of: culturing a transformant in a culture medium; and recovering 5'-inosine from the transformant or from a culture medium in which the transformant was cultured.

[0054] Cultures can be performed using suitable culture media and conditions known in the art, and those skilled in the art can readily adjust and use the culture media and conditions. Specifically, the culture medium can be a liquid medium, but is not limited thereto. Some examples of culture methods include, but are not limited to, batch culture, continuous culture, fed-batch culture, or combinations thereof.

[0055] According to one embodiment of the invention, the culture medium should be suitably adapted to meet the requirements of a specific strain and can be appropriately modified by those skilled in the art. For culture media for Escherichia sp. strains, references can be made to known literature (Manual of Methods for General Bacteriology, American Society for Bacteriology, Washington DC, USA, 1981), but the invention is not limited thereto.

[0056] According to one embodiment of the invention, the culture medium may contain a variety of carbon sources, nitrogen sources, and trace element components. Examples of usable carbon sources include: sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats, such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids, such as palmitic acid, stearic acid, and linoleic acid; alcohols, such as glycerol and ethanol; and organic acids, such as acetic acid. These substances may be used alone or in mixtures, but are not limited thereto. Examples of usable nitrogen sources include peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean flour, urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used alone or in mixtures, but are not limited thereto. Examples of usable phosphorus sources include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or ferric sulfate. Furthermore, the culture medium may contain essential growth substances, such as amino acids and vitamins. In addition, suitable precursors may be used in the culture medium. The culture medium or individual components may be added to the culture medium in batches or continuously using suitable methods during culture, but are not limited to this.

[0057] According to one embodiment of the invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, antifoaming agents such as fatty acid polyethylene glycol esters can be used to suppress foaming during cultivation. Furthermore, to maintain the culture medium under aerobic conditions, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium. The temperature of the culture medium is typically between 20°C and 45°C, for example, between 25°C and 40°C. Cultivation can continue until the desired amount of useful substances is produced. For example, the cultivation time can be between 10 hours and 160 hours.

[0058] According to one embodiment of the invention, in the step of recovering 5'-inosinic acid from the cultured transformant or from the culture medium in which the transformant was cultured, the generated 5'-inosinic acid can be collected or recovered from the culture medium using suitable methods known in the art, according to the culture method. Some examples of methods that can be used to recover the generated 5'-inosinic acid include, but are not limited to, centrifugation, filtration, extraction, and spraying. Drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion), etc.

[0059] According to one embodiment of the present invention, the step of recovering 5'-inosinic acid can be carried out by centrifuging the culture medium at low speed to remove biomass and separating the obtained supernatant by ion exchange chromatography.

[0060] According to one embodiment of the present invention, the step of recovering 5'-inosine acid may include a process for purifying 5'-inosine acid.

[0061] Beneficial effects

[0062] The phosphoenolpyruvate carboxylase variant according to the present invention is obtained by replacing one or more amino acids constituting the amino acid sequence of phosphoenolpyruvate carboxylase to alter the activity of the protein, and the recombinant microorganism containing the phosphoenolpyruvate carboxylase variant is able to efficiently produce 5'-inosine. Attached Figure Description

[0063] Figure 1 The structure of the pK19msb plasmid according to one embodiment of the present invention is shown. Detailed Implementation

[0064] The invention will be described in more detail below. However, this description is presented by way of example only to facilitate understanding of the invention, and the scope of the invention is not limited to this exemplary description.

[0065] Example 1. Construction of a strain expressing a phosphoenolpyruvate carboxylase variant

[0066] To evaluate the effect of a variant (SEQ ID NO:2) of phosphoenolpyruvate carboxylase (SEQ ID NO:4) with serine (S) replacing proline (P) at position 472 and aspartic acid (D) replacing glycine (G) at position 673 on 5'-inosine production, the inventors constructed a vector for expressing the phosphoenolpyruvate carboxylase variant and introduced the strain into the vector.

[0067] 1-1. Construction of a vector for expressing a phosphoenolpyruvate carboxylase variant

[0068] Genomic DNA from wild-type Corynebacterium ATCC6872 was used as a template, and PCR was performed using primer pair 1 and 2. The PCR fragment and pK19msb plasmid (SEQ ID NO:5) were treated with the restriction enzyme smaI (NEB) and ligated together using T4 ligase. The resulting plasmid was named pK_PC.

[0069] PCR amplification was performed using Pfu PreMix (Bioneer) under the following conditions: denaturation at 95°C for 5 minutes, followed by 30 cycles, each consisting of 30 seconds at 95°C, 30 seconds at 58°C, and 1 minute and 30 seconds at 72°C, followed by reaction at 72°C for 5 minutes.

[0070] The primer sequences used for plasmid construction are shown in Table 1 below.

[0071] [Table 1]

[0072] Primer name SEQ ID NO. Primer sequences (5′-3′) Primer 1 6 CTCTGCTCGCTCACTGGTCT Primer 2 7 TACTCGCTGTGTCGTAGCGGG

[0073] 1-2. Construction of mutant strains in which a phosphoenolpyruvate carboxylase variant was introduced.

[0074] The method for preparing electrocompetent cells (a modified version of the method by van der Rest et al.) was used as a method for transforming Corynebacterium tarda KCCM13339P.

[0075] First, *Corynebacterium kansui* KCCM13339P was cultured in primary culture in 10 mL of 2YT medium supplemented with 2% glucose (containing 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L sodium chloride) to prepare a seed culture. Isonicotinic acid hydrazine at a concentration of 1 mg / mL and 2.5% glycine were added to 100 mL of glucose-free 2YT medium. Then, the seed culture was inoculated into the 2YT medium to allow OD to reach the target value. 610 The value reached 0.3, and then it was incubated at 30°C and 180 rpm for 5 to 8 hours to allow the OD to reach 0.3. 610The pH value reached 0.6 to 0.7. The culture was kept on ice for 30 minutes and then centrifuged at 3500 rpm for 10 minutes at 4 °C. The supernatant was then discarded, and the precipitated, stationary Corynebacterium KCCM13339P was washed four times with 10% glycerol solution and finally resuspended in 0.5 ml of 10% glycerol solution to prepare competent cells. Electroporation was performed using a Bio-Rad electroporator. The prepared competent cells and the constructed pK_PC vector were placed in an electroporation cup (0.2 mm) and electroporated at 2.5 kV, 200 Ω, and 12.5 μF. Immediately after electroporation, 1 ml of regeneration (RG) medium (containing 18.5 g / L brain heart infusion and 0.5 M sorbitol) was added to the cells, and the cells were then heat-treated at 46 °C for 6 minutes. Cells were then cooled to room temperature, transferred to 15 ml capped tubes, incubated at 30°C for 2 hours, and plated onto selective medium (containing 5 g / L tryptone, 5 g / L NaCl, 2.5 g / L yeast extract, 18.5 g / L brain heart extract powder, 15 g / L agar, 91 g / L sorbitol, and 20 μg / L kanamycin). Cells were cultured at 30°C for 72 hours, and the resulting colonies were cultured in medium until the stationary phase to induce secondary recombination. Cells were then diluted to 10⁻⁶. -5 Up to 10 -7 The strain was inoculated onto antibiotic-free agar plates (containing 10% sucrose) and selected strains that were not resistant to kanamycin and could grow on the medium containing 10% sucrose and named IPC-1.

[0076] Experimental Example 1. Evaluation of 5'-inosine productivity of strains expressing phosphoenolpyruvate carboxylase variants

[0077] Compare the 5'-inosine productivity between the parental strain KCCM13339P and the mutant strain IPC-1, which incorporates a phosphoenolpyruvate carboxylase variant.

[0078] Each strain (parental strain or mutant strain) was inoculated at 1% volume into 100 mL flasks containing 10 mL of the medium for 5'-inosinic acid production shown in Table 2 below, and cultured at 34 °C with shaking at 200 rpm for 45 hours. After culture, the concentration of 5'-inosinic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0079] [Table 2]

[0080]

[0081]

[0082] [Table 3]

[0083] strain 5'-inosine production (g / L) KCCM13339P 20.0 IPC-1 23.2

[0084] As shown in Table 3 above, it was confirmed that the amount of 5'-inosinic acid produced by the mutant strain, which introduced a phosphoenolpyruvate carboxylase variant, was increased by approximately 16% compared to the amount produced by the parent strain. This was due to the substitution of amino acids at positions 472 and 673 with other amino acids. These results indicate that the introduction of point mutations into phosphoenolpyruvate carboxylase has a significant effect on 5'-inosinic acid productivity.

[0085] The invention has been described to date with reference to some preferred embodiments. Those skilled in the art will understand that the invention can be practiced in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustratively rather than restrictively. The scope of the invention is defined by the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as included in the invention.

[0086] [Registration Number]

[0087] Preservation Institution: Korean Culture Center of Microorganisms (KCCM)

[0088] Registration No.: KCCM13339P

[0089] Deposit date: March 29, 2023

[0090]

[0091]

Claims

1. A variant of phosphoenolpyruvate carboxylase, comprising the amino acid sequence of SEQ ID NO: 2, wherein proline at position 472 of the amino acid sequence of SEQ ID NO: 4 is replaced by serine, and glycine at position 673 is replaced by aspartic acid.

2. A polynucleotide encoding the variant of claim 1.

3. A transformant comprising the variant of claim 1 or the polynucleotide of claim 2.

4. The transformant according to claim 3, which is a Corynebacterium ( Corynebacterium () belongs to microorganisms.

5. The transformant of claim 3, which has the ability to produce 5'-inosine.

6. A method for producing 5'-inosine, comprising the following steps: The transformant of claim 3 is cultured in a culture medium; as well as 5'-inosinic acid is recovered from the transformant or from the culture medium in which the transformant is cultured.

Images