Antimicrobial peptide derived from lactic acid bacteria and its application in preparing oral antibacterial products

Abstract

The present invention belongs to the field of biotechnology, and in particular, relates to an antimicrobial peptide derived from lactic acid bacteria and its application in the preparation of oral antibacterial products. The amino acid sequence of the antimicrobial peptide provided by the present invention is shown in SEQ ID NO. 1. The antimicrobial peptide has excellent antibacterial effect and has significant antibacterial effect on a variety of common oral pathogens such as Porphyromonas odonta, Prevotella intermedia, Streptococcus mutans, Staphylococcus aureus, etc. The antimicrobial peptide can be used as a new choice of active ingredients of antimicrobial drugs or other antimicrobial products, especially as an antimicrobial active ingredient of oral antimicrobial products, such as the antimicrobial active ingredient of anti-infection toothpaste. In addition, the present invention also provides a recombinant plasmid containing a nucleotide sequence encoding the above antimicrobial peptide and a construction method thereof, as well as a recombinant bacterium expressing the above antimicrobial peptide and a construction method thereof. By adopting a codon-optimized nucleotide sequence, the coding efficiency is improved, and high expression of the antimicrobial peptide can be achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an antimicrobial peptide derived from lactic acid bacteria and an application thereof in preparing an oral antimicrobial product. Background Art

[0002] The microbial community in the mouth is essential for maintaining oral health, but when harmful bacteria overgrow, this microecological balance will be disrupted, causing a variety of oral problems. Common harmful oral bacteria include Porphyromonas odontolyticus ( Porphyromonas gingivalis )、Prevotella intermedia( Prevotella intermedia )、Streptococcus mutans( Streptococcus mutans ), Staphylococcus aureus ( Staphylococcus aureus ) etc. The overgrowth of these bacteria is closely related to the occurrence of oral diseases, especially oral problems such as gingivitis, periodontitis, caries, and oral ulcers. For example, Porphyromonas odontica is closely related to the occurrence of periodontitis. It can damage the gum tissue by producing harmful toxins, leading to symptoms such as inflammation, bleeding, and swelling. Streptococcus mutans and Prevotella intermedia are closely related to the development of dental caries. They can corrode tooth enamel by producing acidic substances, causing tooth decay.

[0003] In order to prevent these oral infections, toothpaste, as an important tool for daily oral care, usually contains some bactericidal ingredients. However, although traditional chemical synthetic bactericides, such as chlorhexidine and hydrogen peroxide, have significant antibacterial effects, their long-term use may bring some side effects, including inhibition of oral probiotics, the development of drug resistance, oral mucosal irritation and other safety hazards. Therefore, the search for safer, more effective and side-effect-free antibacterial ingredients has become a research hotspot in the field of oral care.

[0004] As a natural antimicrobial substance, antimicrobial peptides (AMPs) derived from lactic acid bacteria can change the permeability of bacterial cell membranes by interacting with bacterial cell membranes, thereby causing bacterial death. From the perspective of antimicrobial effect, unlike traditional chemical synthetic drugs that only target a single target, antimicrobial peptides usually act on multiple components of bacterial cell membranes, which enables them to play a role in a wider range of antimicrobial effects. In addition, another significant advantage of antimicrobial peptides is their low possibility of developing drug resistance. This is because it is difficult for bacteria to change their cell membrane structure through simple gene mutations, thereby avoiding the effects of antimicrobial peptides. Therefore, antimicrobial peptides can effectively inhibit the growth of multi-drug resistant bacteria. For example, antimicrobial peptides have shown strong inhibitory effects on some bacteria with strong drug resistance, such as Staphylococcus aureus (MRSA) and drug-resistant Streptococcus pneumoniae. From the perspective of safety, antimicrobial peptides have low toxicity to mammalian cells when used and will not cause significant side effects to the human body, so they are safer when used in oral care.

[0005] However, no antimicrobial peptides have been found that have significant antibacterial activity against multiple oral pathogens. Therefore, exploring antimicrobial peptides with antibacterial activity against these pathogens will expand the application prospects of antimicrobial peptides in oral antibacterial products and provide new options for antibacterial substances in the field of oral care. Summary of the invention

[0006] In view of the above technical problems, the present invention provides an antimicrobial peptide derived from lactic acid bacteria and its application in the preparation of oral antimicrobial products. The antimicrobial peptide has significant antibacterial activity against a variety of oral pathogens and can be used in oral antimicrobial products.

[0007] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides an application of an antimicrobial peptide in the preparation of an antimicrobial product. The amino acid sequence of the antimicrobial peptide is shown in SEQ ID NO.1.

[0009] SEQ ID NO.1: AKSYSAYSSCSCVNPPCPIATMD.

[0010] This antimicrobial peptide is derived from Lactobacillus acidophilus ( Lactobacillus acidophilus YT1), the genome sequence of which was stored in the NCBI database (index number: NZ_CP025200.1).

[0011] Experimental studies have shown that the antimicrobial peptide has excellent antibacterial effects and has significant antibacterial effects on oral harmful bacteria such as Porphyromonas odontoblastus, Prevotella intermedia, Streptococcus mutans, Staphylococcus aureus, etc. The antimicrobial peptide can be used as a new choice of active ingredients for oral antibacterial products, such as the antibacterial active ingredient of anti-infection toothpaste.

[0012] In addition, this antimicrobial peptide also has an antibacterial effect on common pathogens such as Salmonella, Escherichia coli, Salmonella typhimurium, Bacillus cereus, Pseudomonas aeruginosa, Listeria monocytogenes, and Vibrio parahaemolyticus, and can be used as a new choice for active ingredients of antibacterial drugs or other antibacterial products.

[0013] The second aspect of the present invention provides a gene encoding the antimicrobial peptide, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0014] SEQ ID NO. 2:

[0015] GCTAAATCATATTCAGCTTATTCATCATGTTCATGTGTTAATCCACCATGTCCAATTGCTACTATGGATTAA.

[0016] The third aspect of the present invention provides a recombinant plasmid containing a nucleotide sequence encoding the above antimicrobial peptide.

[0017] The fourth aspect of the present invention provides a method for constructing the above-mentioned recombinant plasmid, which specifically comprises the following operations:

[0018] A promoter sequence and a nucleotide sequence of a leading peptide are added to the 5' end of the nucleotide sequence, and restriction sites are added to both ends of the obtained sequence to obtain a core fragment; the core fragment and the expression vector pSVN are respectively subjected to restriction digestion, the restriction digestion products are purified and recovered, connected with a ligase, and transformed into Escherichia coli MC1061 competent cells, positive transformants are screened after cultivation, and plasmids are extracted from the positive transformants to obtain the recombinant plasmid; the nucleotide sequence of the expression vector pSVN is shown in SEQ ID NO.3.

[0019] Preferably, the nucleotide sequence encoding the antimicrobial peptide is as shown in SEQ ID NO.2.

[0020] Preferably, the restriction site is Bgl II and Hind III.

[0021] Further preferably, the nucleotide sequence of the core fragment is as shown in SEQ ID NO.4.

[0022] Preferably, the ligase is T4-DNA ligase. Further preferably, the ligation condition is 16°C for at least 6 hours.

[0023] Preferably, the cells are transformed into competent E. coli MC1061 cells and then cultured on erythromycin-resistant LB agar plates. Further preferably, the culture conditions are 37° C. for 12-16 h.

[0024] The fifth aspect of the present invention provides a recombinant bacterium expressing the above antimicrobial peptide.

[0025] Preferably, the host bacteria is Lactococcus lactis.

[0026] Preferably, the host bacteria contains plasmid pIL3btc. Plasmid pIL3btc can assist in the expression of the antimicrobial peptide.

[0027] Exemplarily, Lactococcus lactis containing plasmid pIL3btc can be used ( L. lactis ) NZ9000 was used as the host bacteria.

[0028] The sixth aspect of the present invention provides a method for constructing the above-mentioned recombinant bacteria: after the recombinant plasmid obtained by the above-mentioned construction method is digested, the core fragment is purified, connected to the expression vector pSVN by a ligase, transformed into a host bacterium, and positive transformants are screened after cultivation to obtain the recombinant bacteria; the nucleotide sequence of the expression vector pSVN is shown in SEQ ID NO.3. The recombinant bacteria contains the core fragment and can be used as a heterologous expression system for the above-mentioned antimicrobial peptide. After cultivation and induction by adding nisin, the recombinant bacteria can express the above-mentioned antimicrobial peptide.

[0029] A seventh aspect of the present invention provides use of the antimicrobial peptide or recombinant plasmid or recombinant bacteria in the preparation of oral antimicrobial products.

[0030] Optionally, the oral antibacterial product is an antibacterial toothpaste.

[0031] Exemplarily, the antibacterial toothpaste can be made from the following ingredients:

[0032] The above antimicrobial peptide concentrate contains 0.5%~3%wt, sodium fluoride (NaF) 0.1%~0.3%wt, water 30%~40%wt, thickener 5.5%~12%wt, moisturizer 5.1%~16%wt, flavor 0.3%~2%wt, pH adjuster 0.1%~0.3%wt, and abrasive 30%~40%wt. The thickener can be selected from sodium glycolate, aluminum oxide, and talc, such as sodium glycolate 0.5%~2%wt, aluminum oxide or talc 5%~10%wt; the moisturizer can be selected from glycerol and sodium hyaluronate, with the amount of glycerol 5%~15%wt and sodium hyaluronate 0.1%~1%wt; the flavor can be selected from menthol and tea tree essential oil, with the amount of menthol 0.1%~1%wt and tea tree essential oil 0.2%~1%wt; the pH adjuster can be selected from sodium citrate; and the abrasive can be selected from hydrated silicon dioxide. The preparation method can be prepared by the following steps: (1) mixing sodium fluoride, a moisturizer and water under stirring to obtain a uniform matrix; (2) adding a thickener and an abrasive, stirring evenly, and adjusting to a suitable viscosity; (3) adding an antimicrobial peptide concentrate to the mixture, and continuing to stir until the concentrate is evenly distributed; (4) using a pH adjuster to adjust the pH value to between 6.5 and 7.5, which is suitable for the oral environment; (5) adding flavors to adjust the taste and stirring evenly; (6) filling the mixed toothpaste into a tubular container, sealing it, and storing it in a cool and dry place away from direct sunlight.

[0033] The beneficial effects of the present invention are as follows: the antimicrobial peptides provided by the present invention have excellent antimicrobial activity against oral harmful bacteria such as Porphyromonas odonta, Prevotella intermedia, Streptococcus mutans, Staphylococcus aureus, and can be used to prepare oral antimicrobial products, such as antimicrobial toothpaste. Adding antimicrobial peptides to oral antimicrobial products can effectively prevent oral infections, maintain the balance of oral microecology, and reduce the potential safety hazards brought by traditional chemical synthetic bactericides. Experiments have shown that toothpastes added with the antimicrobial peptides show good anti-infection activity. Therefore, the antimicrobial peptides can be used as antimicrobial ingredients in the field of oral care and have broad application prospects in the field of oral health.

[0034] In addition, this antimicrobial peptide also has an antibacterial effect on common pathogens such as Salmonella, Escherichia coli, Salmonella typhimurium, Bacillus cereus, Pseudomonas aeruginosa, Listeria monocytogenes, and Vibrio parahaemolyticus, and can be used as a new choice for active ingredients of antibacterial drugs or other antibacterial products.

[0035] In order to achieve its biosynthesis, the present invention also provides a recombinant plasmid containing a nucleotide sequence encoding the antimicrobial peptide and a construction method thereof, as well as a recombinant bacterium expressing the antimicrobial peptide and a construction method thereof. In the construction method of the recombinant plasmid, the present invention uses a codon-optimized nucleotide sequence, and after the recombinant plasmid is transformed into a host bacterium, the coding efficiency can be improved to achieve high expression of the antimicrobial peptide. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is the plasmid map of the expression vector pSVN in the present invention;

[0037] Figure 2 is the plasmid map of the recombinant plasmid pSVN-NZ_CP025200.1 constructed in Example 2 of the present invention;

[0038] Figure 3 is the plasmid map of plasmid pIL3btc in Example 3 of the present invention;

[0039] Figure 4 It is the inhibition zone of the polypeptide concentrate in Example 4 of the present invention;

[0040] Figure 5 This is the electrophoresis result of the concentrated polypeptide sample in Example 4 of the present invention. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0042] Antimicrobial peptides are not prone to drug resistance and have low toxicity to mammalian cells. They are considered to be the most promising alternatives to antibiotics and can provide new options for the development of new antimicrobial drugs or other antimicrobial products.

[0043] Based on the research of a large number of antimicrobial peptides, an antimicrobial peptide is provided in the embodiment of the present invention, and its amino acid sequence is shown in SEQ ID NO. 1. The antimicrobial peptide has a significant antibacterial effect on oral harmful bacteria such as Porphyromonas odontoblastus, Prevotella intermedia, Streptococcus mutans, Staphylococcus aureus, and also has an inhibitory effect on many other pathogenic bacteria.

[0044] To achieve biosynthesis and improve coding efficiency, the present invention also provides a recombinant plasmid containing a nucleotide sequence encoding the antimicrobial peptide and a method for constructing the same, and provides a recombinant bacterium expressing the antimicrobial peptide and a method for constructing the same.

[0045] The following is further described with reference to specific embodiments.

[0046] The culture medium components in the following examples are:

[0047] GM17 CmEm broth medium: soytone: 5.0 g / L, peptone: 2.5 g / L, casein peptone / enzymatic hydrolyzed casein: 2.5 g / L, yeast extract powder: 2.5 g / L, beef extract powder: 5.0 g / L, glucose: 5.0 g / L, sodium ascorbate: 0.5 g / L, sodium β-glycerophosphate: 19.0 g / L, magnesium sulfate: 0.25 g / L, chloramphenicol: 4 mg / L, erythromycin: 4 mg / L.

[0048] MEM CmEm broth medium: L-arginine: 126.64 mg / L, L-cystine dihydrochloride: 31 mg / L, L-glutamine: 292 mg / L, L-histidine hydrochloride monohydrate: 42 mg / L, L-isoleucine: 52 mg / L, L-leucine: 52 mg / L, L-lysine hydrochloride: 72.5 mg / L, L-methionine: 15 mg / L, L-phenylalanine: 32 mg / L, L-threonine: 48 mg / L, L-tryptophan: 10 mg / L, L-tyrosine disodium salt: 52 mg / L, L-valine: 46 mg / L, choline chloride: 1 mg / L, D-calcium pantothenate: 1 mg / L, folic acid: 1 mg / L, nicotinamide: 1 mg / L, pyridoxal hydrochloride: 1 mg / L, riboflavin: 0.1 mg / L, thiamine hydrochloride: 1 mg / L, inositol: 2 mg / L, CaCl2: 200 mg / L, MgSO4: 97.67 mg / L, KCl: 400 mg / L, NaCl: 6800 mg / L, NaH2PO4-H2O: 140 mg / L, D-glucose: 1000 mg / L, phenol red: 10 mg / L, chloramphenicol: 4 mg / L; erythromycin: 4 mg / L.

[0049] Unless otherwise specified, the raw materials, reagents, drugs or instruments used in the following examples are all conventional commercial products obtained from commercial channels. The methods used in the following examples are all conventional methods in the art unless otherwise specified. Example 1

[0050] This embodiment provides an antimicrobial peptide with antimicrobial activity.

[0051] The preparation method of the antimicrobial peptide is as follows: according to the amino acid sequence shown in SEQ ID NO.1, a conventional solid phase synthesis method is used for synthesis, and then purification is carried out by a conventional method. Example 2

[0052] This example provides a recombinant plasmid containing an antimicrobial peptide encoding an amino acid sequence as shown in SEQ ID NO. 1 and a method for constructing the same.

[0053] Add the promoter PnisA and leader peptide sequence to the 5' end of the nucleotide sequence shown in SEQ ID NO. 2, and add restriction sites at both ends. Bgl II and Hind III, artificially synthesized core fragment. The synthetic sequence (as shown in SEQ ID NO.4) is (the bold part is the core fragment. The underlined part is the restriction site):

[0054] SEQ ID NO. 4:

[0055] ga agatct tcCTAGTCTTATAACTATACTGACAATAGAAACATTAACAAATCTAAAACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAATAATATTATTGTCGATAACGCGAGCATAATAAACGGCTCTGATTAAATTCTGAAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACT ACAAAATAAATTATAAGGAGGCACTCACCATGAGTACAAAAGATTTTAACTTGGATTTGGTATCTGTTTCGAAGAAAGATTCAGGTGCATCACCACGCgctaaatcatattcagcttattcatcatgttcatgtgttaatccaccatgtccaattgctactatggattaaccc aagctt ggg.

[0056] The core fragment I and the expression vector pSVN (shown in SEQ ID NO.3, the plasmid map is shown in Figure 1 as shown) are performed separately Bgl II and Hind III double digestion, the digestion product was purified and recovered, connected with T4-DNA ligase at 16°C overnight, transformed into E. coli MC1061 competent cells, coated on erythromycin-resistant LB agar plates, cultured at 37°C for 12-16 hours, and single colonies were picked for colony PCR. The PCR product was verified by 1.5% agarose gel electrophoresis, and the cloned strains with positive verification results were sent to the company for sequencing. The recombinant plasmid pSVN-NZ_CP025200.1 was obtained if the sequencing was correct, and its plasmid map is shown as follows Figure 2 shown.

[0057] SEQ ID NO. 3:

[0058] Example 3

[0059] This example provides a recombinant bacterium expressing an antimicrobial peptide with an amino acid sequence as shown in SEQ ID NO. 1. The construction method is as follows: the recombinant plasmid obtained in Example 2 is Bgl II and Hind III double digestion, the digestion product was purified and recovered, ligated to the expression vector pSVN with T4-DNA ligase at 16°C overnight, and electroporated into the host bacteria containing plasmid pIL3btc L. lactis NZ9000 (the plasmid map of plasmid pIL3btc is as shown in Figure 3 After culturing and screening positive transformants, recombinant bacteria expressing the antimicrobial peptide are obtained. Example 4

[0060] In this example, the recombinant bacteria constructed in Example 3 were subjected to expression identification and polypeptide concentrate preparation.

[0061] Inoculate a single colony into 10 mL of GM17 CmEm broth medium, culture at 30°C overnight, and then expand the culture in 500 mL of MEM CmEm broth medium at a 1% inoculum volume and culture at 30°C until OD 600 =0.4-0.6. Add nisin at a final concentration of 5 ng / mL to induce polypeptide expression and culture overnight at 30°C. Centrifuge at 6500 rpm for 30 min to collect cells and cell-free supernatant.

[0062] 100% TCA was added to 500 mL of cell-free supernatant to a final concentration of 10%, and the peptides were precipitated at 4°C overnight. The samples were then centrifuged at 6500 rpm for 30 min at 4°C and washed 2-3 times with 20 mL of ice acetone. After drying, the peptide precipitate was dissolved in 2 mL of PBS solution to obtain an antimicrobial peptide concentrate (antimicrobial peptide concentration of 80 mg / L). Using Micrococcus luteus as an indicator bacteria, the spotting method was used to detect the antibacterial activity of the peptide concentrate. The results showed that the inhibition zone of the concentrated peptide sample (such as Figure 4 shown) is 1.80 cm in diameter.

[0063] The peptides separated from the cell-free supernatant were identified by Tricine-SDS-Page electrophoresis. Figure 5 Lane 1 is the vector host bacteria containing the antimicrobial peptide, lane 2 is the control group without the antimicrobial peptide fragment, and lane 3 is the protein marker. Example 5

[0064] In this example, the antibacterial spectrum of the antimicrobial peptide with the amino acid sequence shown in SEQ ID NO.1 was determined.

[0065] The recombinant bacteria constructed in Example 3 were cultured according to the culture method in Example 4, and the cell-free supernatant was collected and concentrated using TCA according to the method in Example 4 to obtain a concentrate of the antimicrobial peptide having an amino acid sequence as shown in SEQ ID NO. 1 (the antimicrobial peptide concentration was 80 mg / L). The Oxford cup method was used to add different indicator bacteria to the test plate, 10 µL of nisP protein and 50 µL of antimicrobial peptide concentrate were added to the Oxford cup wells, and the antimicrobial activity of the antimicrobial peptide concentrate against different indicator bacteria (see Table 1) was determined after culturing in a 37°C constant temperature incubator for 18 hours, and the diameter of the antibacterial zone was counted. The above experimental operations were performed in parallel 3 times. The results are shown in Tables 1 and 2.

[0066] Table 1 Diameters of inhibition zones against common oral pathogens

[0067] Strain name Diameter of the inhibition zone of polypeptide I (unit: mm) Staphylococcus aureus ATCC25923 13.9±0.1 Streptococcus mutans ATCC 21752 14.4±0.1 Porphyromonas odontolyticus ATCC 2561 15.8±0.2 Prevotella intermedia ATCC 49046 16.2±0.2

[0068] Table 2 Diameters of inhibition zones against other pathogenic bacteria

[0069] Strain name Diameter of the inhibition zone of polypeptide I (unit: mm) Salmonella 56-1105R 14.8±0.2 Salmonella 87-652R 16.5±0.2 Escherichia coli ATCC25922 13.0±0.1 Typhimurium LT2 12.2±0.3 Bacillus cereus 14579 18.5±0.2 Pseudomonas aeruginosa OA1 14.7±0.1 Listeria monocytogenes ATCC15313 16.4±0.1 Vibrio parahaemolyticus 17903 14.8±0.2 Example 6

[0070] The recombinant bacteria constructed in Example 3 were cultured using the culture method in Example 4, and the cell-free supernatant was collected and concentrated using TCA according to the method in Example 4 to obtain a concentrate of the antimicrobial peptide having an amino acid sequence as shown in SEQ ID NO. 1 (the concentration of the antimicrobial peptide was 80 mg / L). The concentrate was used to prepare an antibacterial toothpaste, and its ingredients and contents are shown in Table 3.

[0071] Table 3 Ingredients and contents of antibacterial toothpaste

[0072] Element Content (weight percentage) Antimicrobial peptide concentrate 2% Sodium fluoride 0.3% water 36.5% glycerin 15% Sodium glycolate 2% Alumina 9.5% Sodium Hyaluronate 0.6% Menthol 0.8% Sodium Citrate 0.3% Hydrated Silica 32% Tea Tree Oil 1%

[0073] The preparation method is:

[0074] 1. Mix glycerin, sodium fluoride, sodium hyaluronate and other ingredients such as water to obtain a uniform matrix under stirring;

[0075] 2. Add sodium glycolate, alumina and hydrated silicon dioxide, stir well and adjust to the appropriate viscosity.

[0076] 3. Add the antimicrobial peptide concentrate obtained in Example 4 to the mixture and continue stirring until it is evenly distributed.

[0077] 4. Adjust the pH value of the formula with sodium citrate to ensure that the pH value of the toothpaste is between 6.5 and 7.5, which is suitable for the oral environment.

[0078] 5. Add menthol and tea tree essential oil, adjust the taste and stir well.

[0079] 6. Fill the mixed toothpaste into a tube container, seal it, and store it in a cool and dry place away from direct sunlight.

[0080] Testing the effectiveness of this toothpaste against oral bacteria:

[0081] Porphyromonas odontica and Prevotella intermedia were inoculated in brain heart infusion broth and cultured at 37°C for 24-36 h. Streptococcus mutans was inoculated in trypticase soy broth and cultured at 37°C and 5% CO2 for 18-24 h. Staphylococcus aureus was inoculated in LB medium and cultured at 37°C for 24 h. After the above bacterial culture solutions were adjusted to an OD of 0.1 at 600 nm, they were mixed with water and 15%wt toothpaste suspension, respectively, and cultured for 24 h under suitable bacterial conditions, which were used as the control group and the experimental group, respectively. The number of colonies in each mixed culture solution was counted, and the inhibition rate was calculated.

[0082] Inhibition rate = (number of colonies in the control group - number of colonies in the test group) / number of colonies in the control group × 100%

[0083] The results are shown in Table 4:

[0084] Table 4 Antibacterial rate of toothpaste

[0085] Bacteria name Antibacterial rate (%) Staphylococcus aureus ATCC25923 95.2% Streptococcus mutans ATCC 21752 92.5% Porphyromonas odontolyticus ATCC 2561 90.4% Prevotella intermedia ATCC 49046 88.6%

[0086] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of an antimicrobial peptide in the preparation of an antimicrobial product, characterized in that: The amino acid sequence of the antimicrobial peptide is shown in SEQID NO.1, and the bacteria are Staphylococcus aureus, Streptococcus mutans, Porphyromonas odontii, Prevotella intermedia, Salmonella, Escherichia coli, Salmonella typhimurium, Bacillus cereus, Pseudomonas aeruginosa, Listeria monocytogenes and / or Vibrio parahaemolyticus.

2. The antimicrobial peptide encoding gene according to claim 1, characterized in that The nucleotide sequence of the gene encoding the antimicrobial peptide is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing a nucleotide sequence encoding the antimicrobial peptide according to claim 1.

4. The method for constructing the recombinant plasmid according to claim 3, characterized in that: The specific operations include: A promoter sequence and a nucleotide sequence of a leader peptide are added to the 5' end of the nucleotide sequence of the antimicrobial peptide, and restriction sites are added to both ends of the obtained sequence to obtain a core fragment; the core fragment and the expression vector pSVN are respectively subjected to restriction digestion, the restriction digestion products are purified and recovered, connected with a ligase, and transformed into Escherichia coli MC1061 competent cells, positive transformants are screened after cultivation, and plasmids are extracted from the positive transformants; the nucleotide sequence of the expression vector pSVN is shown in SEQ ID NO.

3.

5. The construction method according to claim 4, characterized in that: The nucleotide sequence encoding the antimicrobial peptide is shown in SEQ ID NO. 2; and / or The restriction site is Bgl II and Hind III; and / or The ligase is T4-DNA ligase; and / or The cells were transformed into competent E. coli MC1061 and cultured on erythromycin-resistant LB agar plates.

6. The construction method according to claim 4 or 5, characterized in that: The nucleotide sequence of the core fragment is shown in SEQ ID NO.

4.

7. A recombinant bacterium expressing the antimicrobial peptide according to claim 1.

8. The recombinant bacterium according to claim 7, characterized in that The host bacteria is Lactococcus lactis; and / or The host bacteria contains plasmid pIL3btc.

9. The method for constructing a recombinant bacterium according to claim 7 or 8, characterized in that: After the recombinant plasmid constructed by the construction method according to any one of claims 4 to 6 is digested, the core fragment is purified, connected to the expression vector pSVN by a ligase, transformed into a host bacterium, and positive transformants are screened after cultivation to obtain the recombinant bacterium; the nucleotide sequence of the expression vector pSVN is shown in SEQ ID NO.

3.

10. Use of the antimicrobial peptide according to claim 1 or the coding gene according to claim 2 or the recombinant plasmid according to claim 3 or the recombinant bacteria according to claim 7 or 8 in the preparation of an oral antibacterial product, wherein the bacteria are Staphylococcus aureus, Streptococcus mutans, Porphyromonas odonta and / or Prevotella intermedia.

Images