A Ca-regulating 2+ IRBIT signaling target marker for gastric cancer diagnosis or prognosis evaluation and its application
By detecting the expression level of IRBIT protein or its encoding gene, kits and drugs for gastric cancer diagnosis or prognosis evaluation are developed, which solves the difficulties in early diagnosis and prognosis evaluation of gastric cancer, provides new treatment strategies, and achieves early diagnosis and effective prognosis evaluation.
Patent Information
- Application Number
- CN202411796210.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-09
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2044-12-09
AI Technical Summary
Early diagnostic methods for gastric cancer lack specificity, resulting in most patients having already developed distant metastasis at the time of diagnosis, affecting treatment efficacy and survival. Existing technologies make it difficult to effectively assess the prognosis of gastric cancer.
Using IRBIT protein or its encoding gene as a marker and detecting the expression level of IRBIT protein or its encoding gene, we can develop kits and drugs for the diagnosis or prognosis evaluation of gastric cancer, regulate the Ca2+ signal of gastric cancer, and provide new treatment strategies.
IRBIT is highly expressed in gastric cancer tissues and is associated with tumor size, clinical stage, and metastasis. It can diagnose gastric cancer early and provide new therapeutic targets, filling the gap in research on regulating Ca2+ signaling in gastric cancer, and has important scientific significance and clinical value.
Smart Images

Figure CN119491051B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a method for regulating gastric cancer Ca 2+ Signal target IRBIT is a marker for gastric cancer diagnosis or prognosis evaluation and its application. Background Art
[0002] Gastric cancer is one of the most common malignant tumors in my country. Its etiology is complex, and the molecular mechanisms involved in its development and progression remain largely unexplained, making its effective prevention and treatment challenging. Treatment options primarily include surgery, chemotherapy, targeted therapy, immunotherapy, radiotherapy, and traditional Chinese medicine.
[0003] At present, the survival of gastric cancer patients is closely related to the stage at diagnosis. Due to the lack of specific symptoms in the early stages of gastric cancer and the lack of early diagnostic methods, most patients have already developed distant metastasis at the time of diagnosis, resulting in unsatisfactory expectations and survival after treatment.
[0004] Therefore, it is necessary to find new tumor diagnostic markers that may be used in the diagnosis of gastric cancer, so as to facilitate timely detection and early treatment intervention in gastric cancer patients, and also to provide new targets and research directions for the treatment of gastric cancer.
[0005] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the Invention
[0006] In view of the above technical problems, the embodiment of the present invention provides a method for regulating gastric cancer Ca 2+ The signal target IRBIT is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application to solve the problems raised in the above background technology.
[0007] A reagent for detecting IRBIT protein or its encoding gene is used in the preparation of a product for gastric cancer diagnosis or prognosis assessment.
[0008] Preferably, the IRBIT protein or the gene encoding it is used as a marker for gastric cancer diagnosis or gastric cancer prognosis assessment.
[0009] Preferably, the expression of IRBIT protein is upregulated in gastric cancer patients.
[0010] Preferably, the expression level of IRBIT protein in gastric cancer tissue of gastric cancer patients is positively correlated with tumor size, clinical stage and metastasis.
[0011] Preferably, the product for gastric cancer diagnosis or prognosis assessment includes primers and probes for identifying the gene encoding the IRBIT protein, and antibodies for recognizing the IRBIT protein.
[0012] Preferably, the primers for identifying the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a back primer sequence as shown in SEQ ID NO.2; specifically, the sequence of SEQ ID NO.1 is: TCGCTCGATCTCACAGTCCT; the sequence of SEQ ID NO.2 is: TCCCGGCGTCCAAATTCTG.
[0013] A biomarker for diagnosing or evaluating the prognosis of gastric cancer, comprising an IRBIT protein or a gene encoding the same.
[0014] A kit for diagnosing or evaluating prognosis of gastric cancer, wherein the kit is used for detecting IRBIT protein or its encoding gene.
[0015] Preferably, the primers for recognizing the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a back primer sequence as shown in SEQ ID NO.2.
[0016] Preferably, the kit comprises primers and probes that recognize the gene encoding the IRBIT protein, and antibodies that recognize the IRBIT protein.
[0017] Use of a preparation for inhibiting the expression of IRBIT protein or its encoding gene in the preparation of a drug for treating gastric cancer.
[0018] The embodiment of the present invention provides a method for regulating gastric cancer Ca 2+ The signal target IRBIT is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application has the following beneficial effects:
[0019] 1. The present invention has experimentally confirmed that IRBIT is highly expressed in gastric cancer tissues and is positively correlated with tumor size, clinical stage and metastasis; and IRBIT may cause abnormal Ca 2+ Signaling promotes the proliferation, migration, and invasion of gastric cancer cells. Therefore, IRBIT is expected to become a clinical marker for gastric cancer diagnosis or prognosis assessment;
[0020] 2. IRBIT may regulate Ca2+ in gastric cancer 2+ signal, becoming a new target in the clinical treatment of gastric cancer, which may provide new treatment strategies and theoretical basis for the prevention and treatment of gastric cancer, has important scientific significance and clinical value, and may fill the gap in regulating gastric cancer Ca 2+ Gaps in the field of signal research. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Result diagrams of various experiments in Example 1 of the present invention;
[0022] in, Figure 1 A- Figure 1 B is the immunohistochemical detection result of IRBIT in human gastric cancer tissue;
[0023] Figure 1 C-Figure shows the RT-qPCR detection results of IRBIT in human gastric cancer cell lines;
[0024] Figure 1 D- Figure 1 E is the Western-blot detection result of IRBIT in human gastric cancer cell line;
[0025] Figure 1 F- Figure 1 H is the analysis result of IRBIT expression level and clinicopathological characteristics;
[0026] Figure 2 The results of constructing IRBIT overexpression and knockdown cell lines in human gastric cancer cell lines in Example 2 of the present invention are as follows;
[0027] in, Figure 2 A- Figure 2 B is the Western-blot verification result of IRBIT overexpression and knockdown cell lines;
[0028] Figure 2 C- Figure 2 D is the RT-qPCR validation results of IRBIT overexpression and knockdown cell lines;
[0029] Figure 3 This is a graph showing the results of a CCK-8 experiment in Example 2 of the present invention;
[0030] in, Figure 3 A- Figure 3 B shows the cell proliferation results 24 h and 48 h after IRBIT overexpression in gastric cancer cell MGC803;
[0031] Figure 3 C- Figure 3 D shows the cell proliferation results 24 h and 48 h after IRBIT knockdown in gastric cancer cell BGC823;
[0032] Figure 4 This is a diagram showing the results of a cell clone formation experiment in Example 2 of the present invention;
[0033] in, Figure 4 A- Figure 4B shows the results of cell clone formation after IRBIT overexpression in gastric cancer cells MGC803;
[0034] Figure 4 C- Figure 4 D shows the clone formation results of cells after IRBIT knockdown in gastric cancer cell BGC823;
[0035] Figure 5 This is a diagram showing the results of the nude mouse tumor formation experiment in Example 2 of the present invention;
[0036] Figure 5 A- Figure 5 B shows the changes in tumor volume in nude mice after IRBIT was overexpressed in gastric cancer cells MGC803;
[0037] Figure 5 C- Figure 5 D shows the changes in tumor volume in nude mice after IRBIT knockdown in gastric cancer cell line BGC823;
[0038] Figure 6 Result diagrams of each experiment in Example 3 of the present invention;
[0039] Figure 6 A shows the results of single-cell calcium imaging using Fura-2 and AM in normal gastric mucosal cells GES-1 after administration of IP3 receptor agonist IP3 hexapotassium salt.
[0040] Figure 6 B shows the chelation of ER Ca by TPEN in GES-1 cells. 2+ After that, the results of single-cell calcium imaging experiments were performed using Fura-2 AM after administration of IP3 hexapotassium salt.
[0041] Figure 6 C is the chelation of endoplasmic reticulum Ca2+ using TPEN, an endoplasmic reticulum calcium chelator, in gastric cancer cells BGC823. 2+ After that, single-cell calcium imaging was performed using Fura-2 AM after IP3 hexapotassium salt was administered.
[0042] Figure 6 D is the gastric cancer cell BGC823 control group, in which the endoplasmic reticulum calcium chelator TPEN was used to chelate endoplasmic reticulum Ca 2+ After that, the results of single-cell calcium imaging experiments were performed using Fura-2 AM after administration of IP3 hexapotassium salt.
[0043] Figure 6 E: After knocking down IRBIT of BGC823 in gastric cancer cells, ER calcium chelator TPEN was used to chelate ER Ca 2+ After IP3 hexapotassium salt was administered, single-cell calcium imaging was performed using Fura-2 AM.
[0044] Figure 6 F is the statistical graph of 6D and 6E;
[0045] Figure 6 G is a graph showing the results of Western-blot experiment verification of knocking down IRBIT in gastric cancer cells BGC823. DETAILED DESCRIPTION
[0046] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making any creative efforts shall fall within the scope of protection of the present invention.
[0047] In view of the above technical problems, the embodiment of the present invention provides a method for regulating gastric cancer Ca 2+ The signal target IRBIT is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application to solve the problems raised in the above background technology.
[0048] Example 1
[0049] 1. Experimental Materials:
[0050] RNAeasy Animal RNA Extraction Kit (Spin Column) was purchased from Shanghai Biotech Co., Ltd., China (Cat. No. R0027); BeyoRT™ II cDNA First-Strand Synthesis Kit (RNase H-) was purchased from Shanghai Biotech Co., Ltd., China (Cat. No. D7168L); PAGE Gel Rapid Preparation Kit (10%) was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. PG112); Three-color Prestained Protein Marker (10 kDa-250 kDa) was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. WJ103); Skim milk powder was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. PS112L); RIPA Lysis Buffer (Strong) was purchased from MCE (Cat. No. HY-K1001); Protease Inhibitor Cocktail (EDTA-Free, 100x in DMSO) was purchased from MCE (Cat. No. HY-K0010); Phosphatase Inhibitor Cocktail I (100x in DMSO was purchased from MCE (catalog number: HY-K0021); rapid transfer buffer (20x) was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd., China (catalog number: WB4600); universal antibody diluent was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd., China (catalog number: WB500D); 20x TBST buffer was purchased from Beijing Solebold Technology Co., Ltd., China (catalog number: T1082); 5x SWE fast high-resolution electrophoresis buffer was purchased from Wuhan Saiweier Biotechnology Co., Ltd., China (catalog number: G2152-1L); primary antibodies were purchased from Invitrogen (catalog number: PA5-60038); secondary antibodies were purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., China (catalog number: ZB-2301); phosphate-buffered saline (PBS) was purchased from Qidu Pharmaceutical Biotechnology Co., Ltd. (catalog number: QB1002); and RPMI1640 medium was purchased from Thermo Fisher Scientific (catalog number: C11875500BT).
[0051] 2. The experimental reagents are prepared as follows:
[0052] (1) Preparation of RIPA lysis buffer: Prepare RIPA lysis buffer according to the volume ratio of RIPA lysis buffer: PMSF: protease inhibitor: phosphorylase inhibitor = 100: 1: 1: 1. Prepare it immediately before use and operate on ice throughout the process.
[0053] (2) Preparation of 1xTBST buffer: Add 1900 mL of ultrapure water to 100 mL of 20xTBST buffer and 1 mL of Tween 20;
[0054] (3) Cell culture medium: by volume, the culture medium contains 90% basal culture medium, 10% fetal bovine serum, and 1% streptomycin / penicillin;
[0055] 3. Cell Experiment Methods:
[0056] (1) Cell recovery: Quickly remove the frozen GES-1, AGS, SGC7901, BGC823, MGC803, and MKN45 cells from liquid nitrogen and place them in an ice box. Then quickly place the cryovials in a water bath preheated to 37°C to thaw quickly and immediately bring them to the clean bench. Pipette the cell freezing solution into a centrifuge tube containing culture medium and pipette up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm for 5 min at room temperature. After centrifugation, aspirate and discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, pipette repeatedly to make a cell suspension, place in a culture flask, and culture in a cell culture incubator at 37°C and 5% CO2.
[0057] (2) Cell counting and plating: Take the above 6 types of cells in the logarithmic growth phase, digest with trypsin, collect the cells, add RPMI1640 complete medium, and mix by pipetting to prepare cell suspension. After counting with a microplate reader, adjust the above cell seeding density to 1x10 6 Each cell type was inoculated into two 60 mm dishes, with about 200 μL per well, and cultured in a constant temperature incubator at 37°C and 5% CO2.
[0058] (3) RNA and protein extraction: When the cell growth density in the culture dish reaches 70% to 80% confluence, RNA and protein of the above six cell types can be extracted. After reverse transcription of RNA into cDNA using the Biyuntian reverse transcription kit, the mRNA expression of IRBIT in each cell type was detected by RT-qPCR. The IRBIT primer sequence was: IRBIT (F: TCGCTCGATCTCACAGTCCT, R: TCCCGGCGTCCAAATTCTG). The extracted protein was first quantified by BCA method, and then the protein expression of IRBIT in each cell type was detected by Western Blot.
[0059] RT-qPCR and Western-Blot were used to detect the mRNA and protein expressions of IRBIT in human gastric cancer cell lines and normal gastric mucosal cells GES-1.
[0060] 4. Clinical Data and Research
[0061] The expression level of IRBIT in human gastric cancer tissues was detected, and the correlation between its expression level and the clinicopathological characteristics of patients was analyzed.
[0062] (1) Determine the expression of IRBIT in gastric cancer tissues: 50 samples of fresh human gastric cancer tissues and adjacent normal gastric tissues were collected (Shanghai Xinchao Company, in compliance with ethical review); the expression of IRBIT in fresh human gastric cancer tissues and adjacent normal gastric tissues was detected by RT-qPCR and Western-Blot; in addition, paraffin-embedded gastric cancer tissues and adjacent normal gastric tissue specimens were made into 4 μm slice specimens; then dewaxing, hydration, antigen repair, serum blocking, incubation with primary antibody, incubation with secondary antibody, addition of SABC, addition of colorimetric agent, counterstaining, sealing, etc., and immunohistochemistry was used to detect the expression and localization of IRBIT in fresh human gastric cancer tissues and adjacent normal gastric tissues.
[0063] (2) Confirm the correlation between the expression level of IRBIT in gastric cancer tissues and the clinical pathological characteristics of patients:
[0064] ① Purchase human gastric cancer tissue microarrays (150 cases) (Shanghai Xinchao Company, in compliance with ethical review);
[0065] ② Immunohistochemical staining, the method is the same as above;
[0066] ③ Image J software was used to analyze the differential expression of IRBIT in human gastric cancer tissues and adjacent normal gastric tissues;
[0067] ④Analyze the correlation between the expression level of IRBIT in human gastric cancer tissues and the clinical pathological characteristics of gastric cancer patients, such as tumor size, TNM stage, differentiation and lymph node metastasis.
[0068] 5. Experimental results:
[0069] Figure 1 A- Figure 1 B Results showed that immunohistochemistry analysis showed that the protein expression of IRBIT in human gastric cancer tissue was higher than that in adjacent normal gastric tissue. Figure 1 C The results showed that RT-qPCR detection found that the expression of IRBIT mRNA in gastric cancer cell lines AGS, SGC7901 and BGC823 was higher than that in normal gastric mucosal cells GES-1; the expression of IRBIT mRNA in gastric cancer cell lines MKN45 and MGC803 was lower than that in normal gastric mucosal cells GES-1. Figure 1 D- Figure 1 Western-blot results of E showed that the expression of IRBIT protein in gastric cancer cell lines AGS, SGC7901 and BGC823 was higher than that in normal gastric mucosal cells GES-1; the expression of IRBIT protein in gastric cancer cell lines MKN45 and MGC803 was lower than that in normal gastric mucosal cells GES-1. Figure 1 F- Figure 1The results suggest that patients with high IRBIT expression in gastric cancer tissues have larger tumors, advanced clinical stages, and are more likely to develop lymph node metastasis. These clinical and pathological findings from human gastric cancer cells and tissues suggest that IRBIT is a tumor-promoting factor in gastric cancer.
[0070] Example 2
[0071] 1. Experimental Materials:
[0072] The IRBIT-overexpressing lentiviral strain was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. (order number: 34268); the IRBIT-knockout lentiviral strain was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. (order number: 34292); CCK-8 reagent was purchased from MCE, USA (catalog number: HY-K0301); phosphate-buffered saline (PBS) was purchased from Qidu Pharmaceutical Biotechnology Co., Ltd. (catalog number: QB1002); RPMI1640 medium was purchased from Thermo Fisher Scientific, USA (catalog number: C11875500BT); and nude mice were purchased from Beijing Huafukang Biotechnology Co., Ltd.
[0073] 2. The experimental reagents are prepared as follows:
[0074] (1) Cell culture medium: The culture medium contains 90% basal culture medium, 10% fetal bovine serum, and 1% streptomycin / penicillin by volume.
[0075] (2) Phosphate buffer: Dissolve 0.818 g NaCl, 0.037 g KCl, 0.022 g CaCl2, 0.238 g HEPES, and 0.18 g glucose in 90 mL ultrapure water, adjust the pH to 7.4, and dilute to 100 mL for later use.
[0076] (3) Cell digestion solution: 0.25 g trypsin, 0.02 g EDTA, dissolved in 70 mL PBS solution, adjusted to pH 7.2-7.4, and made up to 100 mL with ultrapure water. Filter sterilize and use during cell culture and subculture.
[0077] (4) Preparation of CCK-8 working solution: Inoculate 100 μL of cell suspension per well of a 96-well plate and prepare CCK-8 solution. The preparation method is as follows: add 10 μL of CCK-8 solution and 90 μL of serum-free culture medium to each well. Preheat the CCK-8 solution to room temperature before use and prepare it immediately.
[0078] 3. Cell Experiment Methods:
[0079] (1) Cell recovery: Quickly remove the frozen MGC803 and BGC823 cells from liquid nitrogen and place them in an ice box. Then quickly place the cryovials in a water bath preheated to 37°C to thaw quickly and immediately bring them to the clean bench. Pipette the cell freezing solution into a centrifuge tube containing culture medium and pipette up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm and 4°C for 5 min. After centrifugation, aspirate and discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, pipette repeatedly to make a cell suspension, place in a culture flask, and culture in a cell culture incubator at 37°C and 5% CO2.
[0080] (2) Cell transfection: Cells can be transfected after 2-3 passages. Before transfection, cells are plated in 6-well plates. After the cell growth density reaches 40%-50% confluence and the cells are in good condition, transfection can be performed. IRBIT is overexpressed in the gastric cancer cell line MGC803, which lowly expresses IRBIT; IRBIT is knocked down in the gastric cancer cell line BGC823, which high-expresses IRBIT. Positive clones are then selected with puromycin and expanded to establish cell lines.
[0081] (3) CCK-8 assay was used to detect changes in cell proliferation after overexpression and knockdown of IRBIT;
[0082] (4) Cell clone formation assay was used to detect changes in cell proliferation after overexpression and knockdown of IRBIT;
[0083] (5) Nude mouse tumor formation experiments were used to detect the overall changes in tumors after overexpression and knockdown of IRBIT.
[0084] 4 Experimental results:
[0085] (1) Construction results of IRBIT overexpression and knockdown cell lines: First, Western-blot and RT-qPCR verified the successful construction of IRBIT overexpression and knockdown cell lines. Figure 2 A- Figure 2 Results B showed that Western-blot analysis showed that IRBIT was successfully overexpressed in the gastric cancer cell line MGC803 and stably transformed into the gastric cancer cell line BGC823. Figure 2 C- Figure 2 D: RT-qPCR assay verified that the mRNA expression of IRBIT in the MGC803 overexpressing stable transfectant was significantly higher than that in the control group; the mRNA expression of IRBIT in the BGC823 knockdown stable transfectant was significantly lower than that in the control group;
[0086] (2) CCK-8 experiment: After IRBIT overexpression, the cell proliferation activity was significantly increased compared with the control group; after IRBIT knockdown, the cell proliferation activity was significantly decreased compared with the control group; Figure 3 A- Figure 3 B: CCK-8 assay showed that the proliferation ability of gastric cancer cell line MGC803 was significantly increased 24 h and 48 h after IRBIT overexpression; Figure 3 C- Figure 3 D: In the gastric cancer cell line BGC823, the proliferation ability of cells was significantly decreased 24 h and 48 h after IRBIT knockdown;
[0087] (3) Cell clone formation experiment: After IRBIT overexpression, the cell clone proliferation ability increased compared with the control group; after IRBIT knockdown, the cell clone proliferation ability decreased compared with the control group; Figure 4 A- Figure 4 B: Cell clone formation assay showed that overexpression of IRBIT in gastric cancer cell line MGC803 significantly increased the clonal proliferation ability of cells; Figure 4 C- Figure 4 D: After IRBIT knockdown in the gastric cancer cell line BGC823, the clonal proliferation ability of cells was significantly reduced;
[0088] (4) Nude mouse tumor formation experiment: After IRBIT overexpression, the size and volume of nude mouse tumors were significantly increased compared with the control group; after IRBIT knockdown, the size and volume of nude mouse tumors were significantly reduced compared with the control group. Figure 5 A- Figure 5 B: Nude mouse tumorigenesis experiments showed that overexpression of IRBIT in the gastric cancer cell line MGC803 significantly increased the tumor volume in nude mice. Figure 5 C- Figure 5 D: After IRBIT knockdown in the gastric cancer cell line BGC823, the volume and weight of nude mouse tumors were significantly reduced.
[0089] Example 3
[0090] 1. Experimental Materials:
[0091] Dimethyl sulfoxide (DMSO) was purchased from MCE (Cat. No. HY-B0572), calcium fluorescence detection reagent Fura-2 AM was purchased from Solebro (Cat. No. F8500), and SN-6 was purchased from MacLean (Cat. No. S872232-5mg).
[0092] 2. The experimental reagents are prepared as follows:
[0093] (1) Cell culture medium: The culture medium contains 90% basal culture medium, 10% fetal bovine serum, and 1% streptomycin / penicillin by volume.
[0094] (2) Phosphate buffer: Dissolve 0.818 g NaCl, 0.037 g KCl, 0.022 g CaCl2, 0.238 g HEPES, and 0.18 g glucose in 90 mL double-distilled water, adjust the pH to 7.4, and dilute to 100 mL for later use.
[0095] (3) Cell digestion solution: 0.25 g trypsin, 0.02 g EDTA, dissolved in 70 mL PBS solution, adjusted to pH 7.2-7.4, and made up to 100 mL with ultrapure water. Filter sterilize and use during cell culture and subculture.
[0096] (4) Calcium dye: Dissolve 100 μg of the cell-permeable calcium ion fluorescent probe Fura-2, AM in 45.6 μL DMSO (dimethyl sulfoxide) to prepare a 10 mM stock solution. Store in the dark at -20°C. Before use, take 1 μL of Fura-2, AM stock solution, add 1 mL of phosphate buffer, preheat at 37°C, and prepare it immediately before use.
[0097] 3. Cell experiment method:
[0098] (1) Cell recovery: Quickly remove the frozen GES-1 and BGC823 cells from liquid nitrogen and place them in an ice box. Then quickly place the cryovials in a water bath preheated to 37°C to thaw quickly and immediately take them to the clean bench. Pipette the cell freezing solution into the centrifuge tube containing the culture medium and pipette up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm and 4°C for 5 min. After centrifugation, aspirate and discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, pipette repeatedly to make a cell suspension, place in a culture flask, and culture in a cell culture incubator at 37°C and 5% CO2.
[0099] (2) Cell passaging: Cells can be passaged when their growth density reaches 80% to 90% confluence. Discard the old culture medium, wash away the remaining old culture medium with PBS, and repeat the wash twice. Discard the PBS, add cell digestion solution and quickly spread evenly. Observe under a microscope. After about 70% to 80% of the cells shrink and become round, tap the outer wall of the culture container to detach the cells from the culture surface. Immediately add culture medium with 2 times the volume of digestion solution to terminate digestion. Use a pipette to gently blow down all the cells. Remove the supernatant after centrifugation. Add an appropriate amount of culture medium and gently blow to mix.
[0100] (3) GES-1 and BGC823 cells were cultured on a 15 mm diameter round transparent cell slide. When the cell density reached about 80%, the next step was carried out.
[0101] (4) GES-1 and BGC823 cells were washed twice with phosphate buffer, then calcium ion dye was added and incubated at 37°C for 1 h;
[0102] (5) GES-1 and BGC823 cells were transferred to new cell culture dishes, washed three times with phosphate buffer, and incubated in phosphate buffer for 30 min;
[0103] (6) Imaging was performed under a fluorescence microscope, with blue excitation light and green receiving light selected; the imaging interval was 3 s, and the final concentration was 5 μM. The green fluorescence intensity of the cells was recorded by imaging, and the change rate of calcium fluorescence was calculated and captured using an intensified CCD camera (ICCD200) and a MetaFluor imaging system (Universal Imaging);
[0104] (7) First, the intracellular Ca was detected in normal human gastric mucosal cells GES-1 by laser confocal calcium imaging. 2+ After the release of transient signals, the IP3 receptor agonist IP3 hexapotassium salt was administered, and the intracellular Ca was detected by laser confocal calcium imaging. 2+ The transient signal released and the previous Ca 2+ Next, the gastric cancer cells BGC823 that highly expressed IRBIT were pretreated with the endoplasmic reticulum calcium chelator TPEN, and then the intracellular Ca 2+ was detected by laser confocal calcium imaging using the IP3 receptor agonist IP3 hexapotassium salt. 2+ Then, gastric cancer cells BGC823 and gastric cancer cells BGC823 with knockdown of IRBIT gene expression were pretreated with endoplasmic reticulum calcium chelator TPEN, and then IP3 receptor agonist IP3 hexapotassium salt was used to detect intracellular Ca by laser confocal calcium imaging. 2+ The transient signals released were then compared and analyzed to infer the relationship between IRBIT and Ca 2+ The possible mechanism of released transient signals in gastric cancer progression.
[0105] 4. Experimental results:
[0106] Figure 6 A: Single-cell calcium imaging experiments using Fura-2 AM revealed that the addition of IP3 receptor agonist IP3 hexapotassium salt (IP3HPS, 100 μM) could trigger the intracellular Ca2+ expression in normal human gastric mucosal cells GES-1. 2+ Signal. Figure 6 B: GES-1 cells, using the endoplasmic reticulum calcium chelator TPEN to chelate endoplasmic reticulum Ca 2+ After IP3 hexapotassium salt was given, intracellular Ca 2+ signal, and then give 5 Ca2+ Detection of calcium signals indicates that the cells are alive and well. Figure 6 C: Gastric cancer cells BGC823, using the endoplasmic reticulum calcium chelator TPEN to chelate endoplasmic reticulum Ca 2+ After IP3 hexapotassium salt was added, intracellular Ca 2+ Signal. Figure 6 D: Gastric cancer cells BGC823 were used as the control group, and the endoplasmic reticulum calcium chelator TPEN was used to chelate endoplasmic reticulum Ca 2+ After IP3 hexapotassium salt was added, intracellular Ca 2+ Signal. Figure 6 E: After knockdown of IRBIT in gastric cancer cells BGC823, ER calcium chelator TPEN was used to chelate ER Ca 2+ After that, IP3 hexapotassium salt was given, and compared with the control group gastric cancer cell BGC823, the intracellular Ca2+ expression triggered by IP3 hexapotassium salt was significantly inhibited. 2+ Signal. Figure 6 F: Statistical chart of 6D and 6E. Figure 6 G: Western-blot experiments verified that IRBIT was knocked down in BGC823 cells, and IRBIT protein expression was reduced, indicating that IRBIT knockdown was successful.
[0107] In summary, the present invention has confirmed through a large amount of experimental data that the expression level of IRBIT in human gastric cancer cells and tissues is higher than that in normal gastric mucosal cells, and analysis shows that the expression level of IRBIT protein in gastric cancer tissue is negatively correlated with the clinical pathological characteristics and survival prognosis of patients; and through immunohistochemistry of a large sample of gastric cancer tissue chips, it was detected that the expression of IRBIT protein in gastric cancer tissue is higher than that in adjacent normal gastric tissue. IRBIT protein is highly expressed in gastric cancer tissue, and its expression level is positively correlated with tumor size, clinical stage and metastasis; IRBIT may regulate Ca in gastric cancer. 2+ signal, promoting the proliferation, migration and invasion of gastric cancer cells.
[0108] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.
Claims
1. Use of a reagent for detecting IRBIT protein or its encoding gene in the preparation of a product for gastric cancer diagnosis; the IRBIT protein or its encoding gene is used as a marker for gastric cancer diagnosis; IRBIT protein expression is upregulated in gastric cancer patients; in, Products for gastric cancer diagnosis include primers and probes for identifying genes encoding IRBIT proteins, or antibodies for identifying IRBIT proteins; The primers for identifying the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a back primer sequence as shown in SEQ ID NO.2.