Canine serum albumin recombinant protein and expression method thereof in hansenula polymorpha

Abstract

The invention discloses a method for constructing recombinant hansenula polymorpha for efficiently producing canine serum albumin and an expression method of the recombinant hansenula polymorpha. Based on a natural sequence of a canine serum albumin gene, a codon of the canine serum albumin gene is optimized, so that the canine serum albumin gene is more suitable for being expressed in hansenula polymorpha, an optimal promoter of the sequence expressed in hansenula polymorpha is further screened, and the copy number of the canine serum albumin in hansenula polymorpha is optimized. The yield of the canine serum albumin hansenula polymorpha strain obtained by recombinant transformation can reach 0.8-0.9 g / L after 6 days of high-density fermentation production in a fermentation tank.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to vector construction of recombinant canine serum albumin and expression thereof in Hansenula spp. Background Art

[0002] Canine serum albumin (CSA) is a single-chain protein composed of 584 amino acids with a molecular weight of about 66KDa. It is mainly used clinically before and after surgical operations to treat albumin loss caused by blood loss or traumatic shock, acute kidney disease, ascites, intracranial hypertension, gastrointestinal diseases, etc. It has a wide range of applications in the field of pet dog medicine. To date, the source of albumin for treating pet diseases still depends on human serum albumin and albumin extracted from animal blood. Studies have found that pets given human serum albumin have a 30% chance of causing serious side effects such as severe edema, inflammation, coagulation disorders, skin lesions, vomiting, high blood pressure, and even death; and the insufficient supply of animal serum, the complex source of serum, and the risk of virus transmission through blood have severely limited the industrial production of animal serum albumin. According to the analysis of the current status of China's pet industry, my country's pet industry is entering a period of rapid development. The urban pet (dog and cat) market size has increased from 22.1 billion yuan in 2011 to 269.9 billion yuan in 2022. Specifically, the domestic pet dog market size is larger than that of pet cats, and the pet dog market size has increased by 21.2% year-on-year.

[0003] The article Escherichia coli expression and purification of recombinant dog albumin, a cross-reactive animal allergen published in 2000 disclosed a method for expressing canine serum albumin in Escherichia coli; CN103613668B applied for by Changchun Sino Biotechnology Co., Ltd. in 2013 disclosed a method for expressing canine serum albumin and interferon fusion protein in Pichia pastoris, which is used to prolong the half-life of interferon and improve the biological activity of interferon, but did not mention the heterologous expression yield; Patent document WO2016152150A1 discloses a method for heterologously expressing serum albumin of mammals other than humans using Pichia pastoris as a host cell, and obtained through mass spectrometry and circular dichroism analysis that the animal serum albumin recombinantly expressed by Pichia pastoris is the same as the animal serum albumin derived from blood.

[0004] Comparing the research progress on heterologous expression of canine serum albumin in recent decades and the growing market demand for canine serum albumin, it is found that heterologous expression of canine serum albumin is still in the primary research stage and has not experienced explosive growth. Therefore, in order to further promote the demand for heterologous expression of canine serum albumin, seeking efficient microbial heterologous expression methods has become the focus of more researchers. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for expressing canine serum albumin in a Hansenula strain. To solve the above technical problem, the present invention adopts the following technical solution.

[0006] The present invention provides a recombinant Hansenula expressing canine serum albumin or a fusion protein containing canine serum albumin, characterized in that a gene element expressing canine serum albumin is integrated into the genome of Hansenula polymorpha;

[0007] Specifically, the gene elements are: a promoter element, a signal peptide, a canine serum albumin gene and a terminator element;

[0008] Preferably, the promoter is an endogenous promoter of Hansenula, specifically: glyceraldehyde-3-phosphate dehydrogenase gene promoter P GAP , plasma membrane ATPase gene promoter P PMA1 , translation elongation factor 1-α promoter P TEF1 , alcohol dehydrogenase gene promoter P ADH1 ; Inducible promoter: Maltase gene promoter P MAL , methanol oxidase gene promoter P MOX , formate dehydrogenase gene promoter P FMD , formaldehyde dehydrogenase gene promoter P FLD1 , dihydroxyacetone synthase gene promoter P DAS , isocitrate lyase gene promoter P ICL1 More preferably, the promoter is a sucrose-inducible promoter P MAL , P GAP , whose nucleotide sequence is at least 85% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the sequence of SEQ ID NO: 5 or SEQ ID NO: 3.

[0009] The canine serum albumin is the amino acid sequence shown in SEQ ID No. 1 or an amino acid sequence having more than 85% homology thereto.

[0010] In a specific embodiment, the nucleotide sequence encoding canine serum albumin is codon-optimized according to the codon usage frequency of Hansenula. Specifically, the optimized nucleotide sequence is as shown in SEQ ID No. 2, or a nucleotide sequence thereof having at least 85%, for example, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the nucleotide sequence shown in SEQ ID No. 2.

[0011] Specifically, the terminator is AOX1 terminator T AOX1 .

[0012] Preferably, multiple copies of the canine serum albumin expression element are used for expression in Hansenula, preferably 2-4 copies, such as 3 copies; different copies use the same or different promoters.

[0013] In a specific embodiment, the canine serum albumin expression element is integrated into the genome of Hansenula via the integrative vectors pPICZαA, pGAPzαA, and pPIC9K.

[0014] The invention provides a method for expressing recombinant canine serum albumin in Hansenula, which comprises culturing the recombinant Hansenula to produce the recombinant canine serum albumin.

[0015] The preferred expression conditions of the recombinant Hansenula expression strain in the present invention are: culture temperature 30°C-40°C, pH 5.0-7.0, preferably 35°C, 36°C, 37°C, 38°C; pH 5.0, pH 5.5, pH 6.0, pH 6.5, pH 7.0.

[0016] Preferably, it is induced expression, and the inducer used is a non-glucose sugar, preferably sucrose, maltose, etc., and more preferably the sucrose concentration used is 1%-8%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%; and the concentration of methanol is 0.1%-5%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%.

[0017] Furthermore, the method further comprises the steps of collecting the supernatant by centrifugation and separating or purifying the recombinant canine serum albumin.

[0018] More specifically, the culture method and conditions are as follows:

[0019] The fermentation starting medium is calculated based on a fermentation volume of 5L: containing yeast powder 100g, peptone 50g, glycerol 200g, basic salt (K2SO4 91g, MgSO4 75g, 85% H3PO4 140ml, KOH 25g), fully dissolved in 4L purified water, added to a 10L fermenter, the purified water is made up to 4.5L, sterilized at 121℃ for 30min, cooled to 30℃, and then 20ml of PTM1 trace element solution is added: CuSO4·5H2O 6.0g, KI 0.088g, MnSO4·H2O 3.0g, Na2MoO4·2H2O 0.2g, H3BO3 0.02g, CoCl2·6H2O 0.5g, ZnCl2 20.0g, FeSO4·7H2O 65.0g, Biotin 0.2g, leucine 0.04g, concentrated H2SO4 5.0ml, dilute to 1L with purified water, filter to sterilize with 0.22μm filter membrane; adjust pH to 5.6 with ammonia water, inoculate fermentation seed liquid, and make the fermentation volume to 5L;

[0020] The initial stirring speed is 400 rpm and the air flow rate is 0.5 Nm 3 / h, tank pressure 0.5bar, dissolved oxygen value is controlled to be ≧20% during fermentation. After the initial growth period is maintained for about 25h, bacterial liquid A 600nm When the concentration reaches 55-65, feed medium 50% glycerol (W / V) and 12 ml PTM1 are added at a flow rate of 12-18 ml / L / h, and the feeding growth phase begins. After 6-8 hours of culture, the bacterial solution A 600nm When it reaches 80-100, stop adding and adjust the pH value to 6.0 with ammonia water; after the dissolved oxygen starts to rise, start adding sucrose to enter the induced expression period. The initial sucrose flow acceleration rate is 10 ml / h. Samples are taken every hour and the concentration is measured by sucrose electrode (the sucrose flow acceleration is adjusted according to the dissolved oxygen change). The concentration is controlled at <5 g / L by adjusting the sucrose flow acceleration rate.

[0021] The beneficial effects of the invention are summarized as follows.

[0022] In large-scale industrial fermentation production, production costs and the safety of pharmaceutical proteins are crucial factors for market considerations. Hansen yeast is a biosafety microorganism (GRAS) with many advantages such as high efficiency, safety and economy; its protein glycosylation level is similar to that of mammalian cells, so that the protein preparations produced by Hansen yeast have good biological activity and low immunogenicity; it is the most heat-resistant yeast, and the maximum growth temperature can reach 50°C, so it can be fermented at a higher temperature, thereby reducing the condensation cost of industrial fermentation, which is suitable for large-scale industrial production. However, the technology of expressing canine serum albumin in Hansen yeast is still in the exploratory stage. The present invention optimizes the codon of the nucleotide sequence of canine serum albumin for the Hansen yeast expression system, and further replaces the promoter in Hansen yeast to efficiently and safely produce serum albumin dedicated to the pet dog market, realize the expression of serum albumin by constitutive promoter and sucrose inducible promoter alone or in combination, replace the traditional methanol inducible promoter, and further optimize the method of serum albumin copy number, and successfully achieve the efficient expression of pet dog serum albumin in Hansen yeast.

[0023] The expression levels of canine serum albumin recombinant bacteria under different promoters in Hansenula were significantly different: sucrose-inducible P MAL Promoter and constitutive P GAP The expression level of albumin in recombinant Hansenula spp. containing the constitutive P PMA1 promoter and methanol-inducible P MOX Promoter of recombinant Hansenula.

[0024] Optimization findings for different copy numbers and promoter combinations: P GAP The expression level of the promoter's multi-copy recombinant bacteria is better than that of a single copy, but the expression level of its two copies is similar to that of a single copy. MAL The expression levels of the recombinant bacteria with the promoter were basically the same; MAL The expression level of the promoter's multi-copy recombinant bacteria was significantly better than that of a single copy, but the expression level did not increase further when the copy number exceeded 2. GAP The expression levels of single-copy and multi-copy recombinant bacteria of the promoter were lower than those of P MAL promoter recombinant bacteria, but the sucrose-inducible promoter P MAL With constitutive promoter P GAP The highest expression level was obtained by combining three copies of the recombinant Hansenula S-(Mal-CSA)2-Gap-CSA. MAL The fermentation induction conditions of the recombinant Hansen yeast are simple and the cost is low, so it has significant fermentation advantages. MALThe recombinant canine serum albumin yeast cell line S-(Mal-CSA)2 can produce 0.8 g / L in 6 days of high-density fermentation in a fermenter; the sucrose-inducible promoter P MAL With constitutive promoter P GAP The three-copy recombinant Hansenula S-(Mal-CSA)2-Gap-CSA can produce 0.9 g / L in a fermenter at high density for 6 days.

[0025] Compared with Pichia pastoris, the present invention does not use methanol in the fermentation process, thus avoiding the toxicity of methanol and the explosion-proof problem in the fermentation process. Therefore, Hansenula expression of recombinant canine serum albumin has greater safety and cost advantages in large-scale production.

[0026] Instruction Manual

[0027] Figure 1 Schematic diagram of the canine serum albumin cloning vector.

[0028] Figure 2 SDS-PAGE electrophoresis of canine serum albumin regulated by different promoters. 1 and 2: S-Mal-CSA; 3 and 4: S-Gap-CSA; 5 and 6: S-Pma1-CSA; 7 and 8: S-Mox-CSA.

[0029] Figure 3 SDS-PAGE electrophoresis of canine serum albumin with different copy numbers. 1: S-(Gap-CSA)2, 2: S-(Gap-CSA)3, 3: S-(Mal-CSA)2, 4: S-(Mal-CSA)3, 5: S-(Mal-CSA)2-Gap-CSA, 6: S-Mal-CSA-(Gap-CSA)2.

[0030] Figure 4 The yield of canine serum albumin produced in a fermenter. 1 and 2: S-(Mal-CSA)2, 3 and 4: S-(Mal-CSA)2-Gap-CSA.

[0031] Figure 5 Canine serum albumin spectrum. DETAILED DESCRIPTION

[0032] To make the purpose, technical solutions and advantages of the embodiments of the present invention more clear, the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, but this does not constitute a limitation to the present invention.

[0033] Example 1. Codon Optimization of Canine Serum Albumin Nucleotide Sequence

[0034] The canine serum albumin gene is derived from animals, and its codons are similar to those of eukaryotes. However, there are still some differences in gene codon preferences between mammals and yeast, and this difference is likely to affect the stability and expression efficiency of animal serum albumin genes and their transcription products in yeast cells. In order to improve the fermentation yield of canine serum albumin, the inventors optimized codons for Hansenula sp. according to the published amino acid sequence of canine serum albumin gene (GenBank No.: CAB64867.1). The optimization principles include: a) selecting the codons with the highest or higher frequency of use according to the frequency table of the genetic code of Hansenula sp.; b) avoiding negative regulatory elements that have potential effects on gene transcription or protein translation, such as PolyAT region, PolyGC region, silencer region and internal splicing site, etc.; c) conducting a comprehensive analysis of the secondary structure of the canine serum albumin coding region to avoid the formation of complex RNA secondary structure and reduce the free energy of mRNA secondary structure; d) using a 5′UTR region that is completely consistent with the natural sequence downstream of the Pichia pastoris promoter as much as possible in the upstream of the coding region; e) eliminating commonly used restriction endonuclease recognition sites. Based on the above nucleotide sequence, without changing its amino acid sequence (see SEQ ID No. 1), we commissioned GeneWeiZ to artificially synthesize a new canine serum albumin sequence (SEQ ID No. 2).

[0035] Example 2: Construction of Hansenula integrative vectors with different promoters

[0036] The steps for constructing the canine serum albumin (CSA) gene integration vector are as follows: using yeast plasmid pGAPzαA (purchased from Invitrogen) as a template, designing vector backbone primers BB-F:TCGAATAATAACTGTT ATTTTTCAGTGTTC and BB-R:GTTTGTAGCCTTAGACATGACTG, using the above primers to PCR amplify the plasmid backbone sequence, and the amplified fragment is named F-BB; using the primers P described in Table 1 GAP -F, P GAP -R PCR amplification of yeast constitutive promoter FP GAP Sequence (SEQ ID No.3), the amplified fragment was named FP GAP; Use the primers Signal-F and Signal-R described in Table 1 to PCR amplify the yeast signal peptide sequence, and the amplified fragment is named F-SP; Use the primers CSA-F and CSA-R described in Table 1 to PCR amplify the canine serum albumin sequence, and the amplified fragment is named F-CSA. The four fragments obtained by the above amplification were mixed in a ratio of 1:1:1:1, and 10μl seamless cloning enzyme (purchased from ABclonal) was added. Finally, sterile water was added to a total volume of 20μl, and the connection was carried out at 50℃ for 1-2h. The connection product was transferred into Escherichia coli DH5α, cultured at 37℃ overnight, and a single clone was selected for PCR sequencing verification. The verified correct vector was named pWSJ01-P GAP -CSA-T AOX1 The plasmid schematic diagram is as follows Figure 1 shown.

[0037] The vector pWSJ01-P obtained in the above construction GAP -CSA-T AOX1 Based on this, different types of promoter sequences were further replaced, including constitutive promoters: P PMA1 , Inducible promoter: Sucrose inducible promoter P MAL , methanol-inducible promoter P MOX The steps for replacing the promoter of canine serum albumin vector are as follows: use primers pWSJ-CSA-R: ATGAGATTTTCCTTCAATTTTTACTGC and pWSJ-CSA-F: TCGAATAATAACTGTTATTTTTCAGTGTTC to amplify the PWSJ plasmid backbone containing canine serum albumin; the amplified fragment is named F-PWSJ-CSA; use primers P in Table 1 PMA1 -F, P PMA1 -R PCR amplification of constitutive promoter FP PMA1 (SEQ ID No.4); using primer P in Table 1 MAL -F, P MAL -R PCR amplification of sucrose-inducible promoter FP MAL (SEQ ID No.5); using primer P in Table 1 MOX -F, P MOX -R PCR amplification of methanol-inducible promoter FP MOX(SEQ ID No.6); the amplified canine serum albumin vector was mixed with the above three promoter fragments in a ratio of 1:1, and connected at 50°C for 1-2h using seamless cloning enzyme. The ligation products were respectively transferred into Escherichia coli DH5α, and verified and sequenced using verification primers test-F: CATGACATTAACCTATAAAAATAGGCG and test-R: TCTTT TCTCGAGAGATACCCCTTCPCR. The vectors with correct sequencing were named: pWSJ02-P MAL -CSA-T AOX1 、pWSJ03-P PMA1 -CSA-T AOX1 、pWSJ04-P MOX -CSA-T AOX1 .

[0038] Table 1 Cloning vector primers

[0039]

[0040] Example 3 Construction of Hansenula cell line expressing canine serum albumin

[0041] 3.1 Plasmid extraction and restriction digestion of recombinant expression vector

[0042] Pick the four E. coli colonies containing the recombinant expression construct plasmid obtained by transformation in Example 1, extract the plasmid after amplification, and use restriction endonuclease BglⅡ or SacⅡ, 37C enzyme digestion for 2-4 hours to linearize it. The reaction product after enzyme digestion is extracted once with an equal volume of phenol: chloroform (1:1, v / v), and then precipitated with ethanol to recover the DNA. After precipitation at -20℃ for more than 2 hours, centrifuge at 14000rpm for 10 minutes, wash twice with ice-cold 70% ethanol, and dry until there is no ethanol. Dissolve the DNA with a certain volume of sterile water, and measure the OD 260 DNA was quantified to a concentration of about 100 ng / μl for linearized fragments and stored in a -20°C refrigerator for future use.

[0043] Pick a single clone of Hansen yeast NCYC495 preserved in this laboratory, inoculate it into a test tube containing 5 ml YPD (1% yeast extract, 2% peptone, 2% glucose) medium, and grow it overnight at 37°C and 200 rpm. Take 0.5 ml of the above culture and add it to 500 ml fresh YPD medium, culture it at 37°C and 200 rpm until OD600 = 1.3-1.5, centrifuge it at 4°C and 5000 rpm for 5 min, discard the supernatant, resuspend the cells with 200 ml 0.1 M phosphate buffer (containing 25 mM DTT, pH 7.5), mix it well, incubate it at 37°C for 30 min, centrifuge it at 5000 rpm for 10 min, discard the supernatant, and resuspend the cells in 20 ml 1 M sorbitol pre-cooled in an ice bath. Centrifuge at 4°C and 5000 rpm for 5 min, discard the supernatant, repeat the above steps once, and finally resuspend the cells in 1 ml of 1M sorbitol pre-cooled on ice, keep on ice, and prepare for transformation.

[0044] 3.3 Electrotransformation of Hansenula cells

[0045] The linearized plasmid obtained in the above step: pWSJ01-P GAP -CSA-T AOX1 、pWSJ02-P MAL -CSA-T AOX1 、pWSJ03-P PMA1 -CSA-T AOX1 、pWSJ04-P MOX -CSA-T AOX1 .

[0046] 15 μl of recombinant Hansen yeast expression plasmid and 30 μl of bacterial solution were added in a ratio of plasmid: bacterial cell = 1:2, and the mixture was mixed by pipetting and blowing, and placed in an ice bath for transformation; the electroporation cup that had been soaked in alcohol and irradiated with ultraviolet light and refrigerated at -20°C was taken out, and the plasmid bacterial mixture was added; the electroporation was performed under the conditions of voltage 1500V, resistance 150Ω, and capacitance 50μF; after the electroporation, 1 ml of pre-cooled 1M sorbitol solution was quickly added, gently mixed, and then transferred to an EP tube; the electroporated bacterial cells were placed in a 37°C water bath for 2 hours, and gently inverted 3 times every 15 minutes; the bacterial solution that had been incubated for 2 hours was centrifuged at 5000rpm for 10 minutes, and the supernatant was discarded; the bacterial cells were resuspended with 200 μl of 1M sorbitol solution, and the plasmid pWSJ01-P was transferred. GAP -CSA-T AOX1 、pWSJ03-P PMA1 -CSA-T AOX1 The yeast cells were spread on YPD plates containing 0.4 mg / ml G418; the plasmid pWSJ02-P MAL -CSA-T AOX1 、pWSJ04-PMOX -CSA-T AOX1 The yeast cells were spread on YPD plates containing 100 mg / ml Zeocin and cultured upside down at 37°C for 3-7 days.

[0047] 3.4 Subculture and stabilization of recombinant Hansenula expression strains

[0048] Pick a single colony of the recombinant strain grown on the Zeocin resistance plate, streak it on a YPD solid plate containing 100 mg / ml Zeocin, and culture it at 37°C for 24-48 hours until a single colony grows. The single colony is streaked again on a YPD solid medium containing 100 mg / ml Zeocin, and so on. Passage 10 times in a row and preserve the strain. The preservation system is YPD bacterial solution: 60% glycerol = 1:1. Preserve the strain according to the required amount, usually 500μl bacterial solution + 500μl 60% glycerol;

[0049] The recombinant Hansen yeast expression strain that was passaged 10 times was inoculated into 5 ml YPD liquid medium without Zeocin resistance, cultured at 37 ° C, 200 rpm shaking for 24 hours, and then transferred to 50 ml YPD liquid medium at a ratio of 1:100. Similarly, it was continuously passaged 5 times in YPD liquid medium without Zeocin resistance, and the supernatant was taken each time to detect the expression of canine albumin. Finally, Hansen yeast that stably expressed canine serum albumin was obtained, and was named S-Mox-CSA and S-Mal-CSA. In the same treatment method, a single clone of the recombinant strain grown on the G418 resistance plate was picked, and it was passaged 10 times on the YPD plate containing 0.4 mg / ml G418, and after passaged 5 times on the liquid medium without G418 resistance, Hansen yeast strains that can stably express canine serum albumin were obtained, and were named S-Pma1-CSA and S-Gap-CSA, respectively.

[0050] Example 4 Canine serum albumin shake flask expression screening

[0051] Single colonies of constitutively expressed recombinant Hansen yeast S-Pma1-CSA and S-Gap-CSA were picked and inoculated into 5 ml YPD liquid culture medium, cultured at 37°C 200 rpm for 24 h, transferred to 30 ml YPD culture medium at a 1% inoculation rate, cultured in a shaking incubator at 37°C 200 rpm for 72 h, and then sampled.

[0052] Single colonies of inducibly expressed recombinant Hansen yeast S-Mox-CSA and S-Mal-CSA were picked, and S-Mox-CSA was inoculated into 5 ml of BMGY liquid medium, cultured at 37°C, 200 rpm for 24 h, and the bacteria in BMGY were collected by centrifugation (5,000 g, 5 min), washed twice with sterile water (precooled) and collected by centrifugation (5,000 g, 5 min), and resuspended in 50 mL of BMMY medium until OD 600 =1, shake flask fermentation, add 0.5% methanol every 12h, and take samples for electrophoresis detection. After the recombinant Hansen yeast S-Mal-CSA was cultured in YPD medium for 24-48h, it was transferred to YP medium containing 2% sucrose for fermentation for 72h.

[0053] Take 10 ml of the fermentation solution, centrifuge at 12000 rpm for 10 min, take the supernatant, and perform SDS-PAGE detection. The expression results are as follows: Figure 2 As shown in the results, the expression levels of different promoters of canine serum albumin were significantly different, containing P MAL Promoter and P GAP The expression level of albumin in recombinant Hansenula spp. containing the promoter was significantly higher than that in PMA1 and P MOX Promoter of recombinant Hansenula.

[0054] Example 5 Optimization of copy number of canine serum albumin genome

[0055] In order to further improve the yield of canine serum albumin expressed in Hansenula, the inventors optimized the copy number of canine serum albumin on the Hansenula genome and the combination of promoters with different strengths. According to the results of serum albumin expression of different promoters in Example 4, the following steps were optimized for the expression of canine serum albumin: As shown in Table 2, vectors containing different copy numbers were constructed.

[0056] 5.1 Construction of two-copy canine serum albumin vector

[0057] The plasmid vector pWSJ01-P constructed in Example 2 was digested with restriction endonuclease BglⅡ. GAP -CSA-T AOX1 The primers GAP-2-F and GAP-2-R in Table 2 were used to PCR amplify the canine serum albumin expression element (including promoter GAP-signal peptide-albumin-terminator) that was constructed in Example 2 and inserted into the vector after restriction digestion. The insertion method was the same as that in Example 2-seamless cloning. The vector successfully constructed after sequencing verification was named pWSJ05-(P GAP -CSA-T AOX1 )2.

[0058] The same construction method was used to digest pWSJ02-P with BglⅡ. MAL -CSA-T AOX1 Primers Mal-2-F and Mal-2-R were used to amplify canine albumin expression elements by PCR, and seamless clone enzyme ligation and verification were performed. The vector with correct sequencing was named: pWSJ06-(P MAL -CSA-T AOX1 )2.

[0059] 5.2 Construction of three-copy canine serum albumin vector:

[0060] The vector pWSJ05-(P GAP -CSA-T AOX1 )2, primers GAP-2-F and GAP-2-R in Table 2 were used to PCR amplify the canine albumin expression element, and the PCR amplified products were respectively inserted into the vectors after the above restriction digestion. The insertion method was the same as that in Example 2-seamless cloning. The vector successfully constructed by sequencing verification was named pWSJ07-(P GAP -CSA-T AOX1 )3.

[0061] BglⅡ single restriction enzyme digestion of pWSJ06-(P MAL -CSA-T AOX1 )2, primers Mal-2-F and Mal-2-R were used to amplify canine albumin expression elements by PCR, and seamless cloning enzyme ligation and verification were performed. The vector with correct sequencing was named: pWSJ08-(P MAL -CSA-T AOX1 )3.

[0062] The vector template pWSJ05-(P GAP -CSA-T AOX1 )2; Use primers Mal-3-F and Mal-3-R in Table 2 to clone single copy pWSJ02-P MAL -CSA-T AOX1 The vector was used as a template to PCR amplify the canine albumin expression element FP MAL -CSA; insert the amplified target fragment into the vector after restriction digestion by seamless cloning, and the vector verified by sequencing is named: pWSJ09-P MAL -CSA-T AOX1- (P GAP -CSA-T AOX1 )2.

[0063] The vector template pWSJ06-(P MAL -CSA-T AOX1 )2, using primers GAP-3-F and GAP-3-R in Table 2, with two copies of pWSJ01-P GAP -CSA-T AOX1 The vector was used as a template to amplify the canine albumin expression element by PCR. The target fragment obtained by amplification was seamlessly cloned and inserted into the vector after restriction digestion. The vector verified by sequencing was named as: pWSJ010-(P MAL -CSA-T AOX1 )2-P GAP -CSA-T AOX1 .

[0064] 5.3. Construction of multi-copy canine serum albumin Hansenula cell line

[0065] The constructed vector pWSJ05-(P GAP -CSA-T AOX1 )2. pWSJ06-(P MAL -CSA-T AOX1 )2、pWSJ07-(P GAP -CSA-T AOX1 )3. pWSJ08-(P MAL -CSA-T AOX1 )3. pWSJ09-P MAL -CSA-T AOX1- (P GAP -CSA-T AOX1 )2. pWSJ010-(P MAL -CSA-T AOX1 )2-P GAP -CSA-T AOX1 The vector was linearized and transferred into Hansenula according to the method in Example 2. The new Hansenula strains obtained were named as: S-(Gap-CSA)2, S-(Mal-CSA)2, S-(Gap-CSA)3, S-(Mal-CSA)3, S-Mal-CSA-(Gap-CSA)2, S-(Mal-CSA)2-Gap-CSA. Finally, the multi-copy strains and single-copy strains were fermented in shake flasks according to the culture conditions in Example 3. The SDS-PAGE electrophoresis results are as follows: Figure 3 As shown: For a single promoter, P MAL The promoter is significantly better than P GAP promoter. However, three copies of P MALThe expression level of the promoter recombinant bacteria was similar to that of the two-copy recombinant bacteria. The expression level of the combined promoter recombinant bacteria S-(Mal-CSA)2-Gap-CSA in the shake flask was slightly higher than that of P MAL The promoter has 2 copies in recombinant bacteria S-(Mal-CSA)2.

[0066] Table 2 Primers for inserting Hansenula into vector

[0067]

[0068]

[0069] Example 6: Fermentation production of canine serum albumin

[0070] Fermentation seed solution: Take frozen glycerol bacteria of S-(Mal-CSA)2 and S-(Mal-CSA)2-Gap-CSA, streak on YPD plates until single colonies grow, inoculate single colonies into 20 ml YPD medium, and culture at 30°C, 200 rpm shaking for 20-24 h. OD 600 After the test is qualified, 10 ml of each was transferred into a 500 ml bottle of YPD medium and cultured at 30°C and 200 rpm for 20-24 hours until OD 600 About 10-15, after passing the test, it can be used as fermentation seed liquid.

[0071] Fermentation process: The fermentation starting medium contains 100g yeast powder, 50g peptone, 200g glycerol, basic salt (K2SO491g, MgSO475g, 85% H3PO4140ml, KOH25g), 4L purified water is fully dissolved, added to a 10L fermentation tank, the purified water is adjusted to 4.5L, 121℃, 30min sterilization, cooled to 30℃, and then 20ml PTM1 trace element solution (CuSO4·5H2O6.0g, KI0.088g, MnSO4·H2O3.0g, Na2MoO4·2H2O0.2g, H3BO30.02g, CoCl2·6H2O0.5g, ZnCl220.0g, FeSO4·7H2O65.0g, Biotin 0.2g, leucine 0.04g, concentrated H2SO4 5.0ml, purified water to 1L, 0.22μm filter membrane sterilization), ammonia water to adjust pH 5.6, inoculate 500ml fermentation seed liquid, the fermentation volume is 5L. The initial stirring speed is 400rpm, the air flow rate is 0.5Nm 3 / h, tank pressure 0.5bar, dissolved oxygen value is controlled to be ≧20% during fermentation. After the initial growth period is maintained for about 25h, bacterial liquid A 600nmWhen the dissolved oxygen reaches about 60, the dissolved oxygen starts to rise rapidly, and the feed medium (50% glycerol (W / V), 12ml PTM1) is added at a flow rate of 12-18ml / L / h. This is the time to enter the fed-batch growth phase. After about 6-8h of culture, the bacterial solution A 600nm When the pH reaches about 90, stop adding and adjust the pH value to 6.0 with ammonia water. After the dissolved oxygen starts to rise, start adding sucrose to enter the induction expression period. The initial sucrose flow rate is 10 ml / h. Samples are taken every hour and the concentration is measured by sucrose electrode (the sucrose flow acceleration is adjusted according to the change of dissolved oxygen). The concentration is controlled at <5 g / L by adjusting the sucrose flow rate.

[0072] Centrifugation and expression detection: After 5-7 days of induction, the cells were placed in the tank and samples were taken every 12 hours to detect OD. 600 Value and wet weight of bacteria. Wet bacteria were collected by centrifugation at 5000 rpm for 30 min at 4°C and frozen at -20°C for later use. In addition, 10 ml of fermentation broth was transferred to a 50 ml centrifuge tube and centrifuged at 10,000 rpm for 10 min. The supernatant was taken and the expression of canine serum albumin was detected using a canine serum albumin detection kit (purchased from Jiangsu Jingmei Biotechnology Co., Ltd.) and detected by SDS-PAGE electrophoresis. The results are as follows: Figure 4 As shown in the figure, the canine serum albumin production of recombinant Hansenula S-(Mal-CSA)2 can reach 0.8 g / L after 144 h of fermentation; the canine serum albumin production of recombinant Hansenula S-(Mal-CSA)2-Gap-CSA can reach 0.9 g / L after 144 h of fermentation.

Claims

1. A recombinant Hansenula expressing canine serum albumin or a fusion protein comprising canine serum albumin, characterized in that: In Hansenula polymorpha ( Hansenula polymorpha ) has a gene element for expressing canine serum albumin integrated into its genome.

2. The recombinant Hansenula according to claim 1, characterized in that The gene elements are: promoter element, signal peptide, canine serum albumin gene and terminator element in sequence; Preferably, the promoter is an endogenous promoter of Hansenula, specifically: glyceraldehyde-3-phosphate dehydrogenase gene promoter P GAP , plasma membrane ATPase gene promoter P PMA1 , translation elongation factor 1-α promoter P TEF1 , alcohol dehydrogenase gene promoter P ADH1 ; Inducible promoter: Maltase gene promoter P MAL , methanol oxidase gene promoter P MOX , formate dehydrogenase gene promoter P FMD , formaldehyde dehydrogenase gene promoter P FLD1 , dihydroxyacetone synthase gene promoter P DAS , isocitrate lyase gene promoter P ICL1 More preferably, the promoter is a sucrose-inducible promoter P MAL , P GAP , whose nucleotide sequence is at least 85% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the sequence of SEQ ID NO:5 or SEQ ID NO:3; The canine serum albumin is the amino acid sequence shown in SEQ ID No. 1 or an amino acid sequence having more than 85% homology thereto.

3. The recombinant Hansenula according to claim 1, characterized in that The coding nucleotide sequence of canine serum albumin is codon-optimized according to the codon usage frequency of Hansenula. Specifically, the optimized nucleotide sequence is shown in SEQ ID No. 2, or a nucleotide sequence thereof having at least 85%, for example, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the nucleotide sequence shown in SEQ ID No.

2.

4. The recombinant Hansenula according to claim 1, characterized in that The terminator is AOX1 terminator T AOX1 .

5. The recombinant Hansenula according to claim 1, characterized in that Multiple copies of the canine serum albumin expression element are used for expression in Hansenula, preferably 2-4 copies, such as 3 copies; different copies use the same or different promoters.

6. The recombinant Hansenula according to claim 5, characterized in that The canine serum albumin expression element is integrated into the genome of Hansenula via the integration vectors pPICZαA, pGAPzαA and pPIC9K.

7. A method for expressing recombinant canine serum albumin in Hansenula, characterized in that: The recombinant Hansenula according to any one of claims 1 to 6 is cultured to produce recombinant canine serum albumin.

8. The expression method according to claim 7, characterized in that: It is an induced expression, and the inducer used is a non-glucose sugar, preferably sucrose, maltose, etc., and more preferably the sucrose concentration used is 1%-8%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%; and the methanol concentration is 0.1%-5%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%; The expression conditions are as follows: culture temperature 30°C-40°C, pH 5.0-7.0, preferably 35°C, 36°C, 37°C, 38°C; pH is preferably pH 5.0, pH 5.5, pH 6.0, pH 6.5, pH 7.

0.

9. The expression method according to claim 7 or 8, characterized in that: The method also includes the steps of collecting the supernatant by centrifugation and separating or purifying the recombinant canine serum albumin.

10. The expression method according to claim 7 or 8, characterized in that: The culture method and conditions are as follows: The fermentation starting medium is calculated based on a fermentation volume of 5 L: containing 100 g yeast powder, 50 g peptone, 200 g glycerol, basal salts (91 g K2SO4, 75 g MgSO4, 140 ml 85% H3PO4, 25 g KOH), fully dissolved in 4 L purified water, added to a 10 L fermenter, the volume was made up to 4.5 L with purified water, sterilized at 121 ° C for 30 min, cooled to 30 ° C and then added with 20 ml PTM1 trace element solution: 6.0 g CuSO4·5H2O, 0.088 g KI, 3.0 g MnSO4·H2O, 0.2 g Na2MoO4·2H2O, 0.02 g H3BO3, 0.5 g CoCl2·6H2O, 20.0 g ZnCl2, 65.0 g FeSO4·7H2O, 0.2 g, leucine 0.04 g, concentrated H2SO4 5.0 ml, purified water to 1 L, sterilized by filtration with 0.22 μm filter membrane; pH 5.6 adjusted with ammonia water, inoculated with fermentation seed liquid, and the fermentation volume was 5 L; The initial stirring speed was 400 rpm and the air flow rate was 0.5 Nm 3 / h, tank pressure 0.5 bar, dissolved oxygen value was controlled to be ≧20% during fermentation. After the initial growth phase was maintained for about 25 h, the A600nm of the bacterial solution reached 55-65, and 50% glycerol (W / V) of the feed medium and 12 ml PTM1 were added at a flow rate of 12-18 ml / L / h, and the feeding growth phase began. After 6-8 h of cultivation, the A600nm of the bacterial solution reached 80-100, and the feeding was stopped. The pH value was adjusted to 6.0 with ammonia water. After the dissolved oxygen began to rise, sucrose was added, and the induced expression phase began. The initial sucrose flow acceleration rate was 10 ml / h, and samples were taken every hour. The concentration was measured by sucrose electrode (the sucrose flow acceleration was adjusted according to the dissolved oxygen change), and the concentration was controlled at <5 g / L by adjusting the sucrose flow acceleration rate.

Images