A recombinant chondroitin 6-o-sulfotransferase mutant and its use in the synthesis of chondroitin sulfate c

Abstract

The application discloses a recombinant chondroitin 6-O-sulfotransferase mutant and application thereof in synthesis of chondroitin sulfate C, and belongs to the technical field of bioengineering. The modification method of the application designs the best mutant through rational protein engineering, modifies the protein structure of the Δ106RnCHST3, overcomes the problem of low natural activity of 6-O-sulfonation of the wild type Δ106RnCHST3, and obtains the best mutant Δ106RnCHST3 F210R / Y310F / A209L / A303S / I173L The sulfonation rate of 24h can reach 46%, which is 3 times higher than that of the wild type, and the industrialization of the biological enzyme preparation CSC is accelerated.

Description

Technical Field

[0001] This invention relates to a recombinant chondroitin 6-O-sulfotransferase mutant and its application in the synthesis of chondroitin sulfate C, belonging to the field of bioengineering technology. Background Technology

[0002] The structural feature of chondroitin sulfate C (CSC) lies in the protonation of the C-6 hydroxyl group of N-acetylgalactosamine and its modification with a sulfonic acid group. Its disaccharide unit is composed of GlcAβ1-3GalNAc(6S). In vascular diseases, chondroitin sulfate C exhibits anti-atherosclerotic, anticoagulant, and antithrombotic properties. In neurodevelopment, CS plays a major role in nerve signal transduction, improving central nervous system activity and promoting brain development. In osteoarthritis, it serves as an important molecule for cartilage repair and regeneration, and also acts as an antioxidant and anti-inflammatory drug.

[0003] There are currently three routes for synthesizing CSC: tissue extraction, chemical synthesis, and biosynthesis. (1) Tissue extraction is the main strategy for CSC production in factories. Industrially, animal tissues are usually used as raw materials to extract CSC. This process involves a series of complex and lengthy steps, which have drawbacks such as cumbersome steps, high energy consumption, and easy introduction of viruses. (2) Chemical synthesis has the disadvantages of limited CSC chain length and low molecular weight: Hsieh-Wilson et al. reported a method for synthesizing CSC tetrasaccharides, but this method has the problems of complex steps and harsh conditions. (3) The key limiting factor of biosynthesis is low enzyme activity: Kang Zhen et al. expressed chondroitin 6-O-sulfotransferase in Pichia pastoris GS115 recombinant strain and used the sulfotransferase secreted into the culture medium to catalyze the generation of CSC. The enzyme activity when chondroitin was used as a substrate was 0.20±0.01U / mg. However, the natural activity of chondroitin 6-O-sulfotransferase is low, which limits the development of biosynthesis of CSC. New methods still need to be developed to improve the sulfonation efficiency of chondroitin 6-O-sulfotransferase. Summary of the Invention

[0004] This invention provides a recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, which is obtained by truncating 106 amino acids at the N-terminus of chondroitin 6-O-sulfotransferase RnCHST3 (GenBank accession number EDL93054.1) derived from Norwegian rat (Rattus norvegicus). The recombinant chondroitin 6-O-sulfotransferase RnCHST is shown in SEQ ID NO.1.

[0005] In one embodiment, the mutant is obtained by mutating one or more of the amino acids at positions 143, 173, 209, 210, and 310 of the amino acid sequence as shown in SEQ ID NO.1.

[0006] In one embodiment of the present invention, the mutant is any one of the following (a) to (e):

[0007] (a) The phenylalanine at position 210 of chondroitin 6-O-sulfotransferase RnCHST3, as shown in SEQ ID NO.1, was mutated to arginine, resulting in the mutant shown in SEQ ID NO.2, named M1;

[0008] (b) The tyrosine residue at position 310 of chondroitin 6-O-sulfotransferase RnCHST3, as shown in SEQ ID NO.2, was mutated to phenylalanine to obtain the mutant shown in SEQ ID NO.3, named M2;

[0009] (c) The alanine at position 209 of chondroitin 6-O-sulfotransferase RnCHST3, as shown in SEQ ID NO.3, was mutated to leucine, and the mutant shown in SEQ ID NO.4 was named M3.

[0010] (d) The alanine at position 303 of the chondroitin 6-O-sulfotransferase RnCHST3, as shown in SEQ ID NO.4, was mutated to serine, resulting in the mutant shown in SEQ ID NO.5, named M4;

[0011] (e) The isoleucine at position 173 of chondroitin 6-O-sulfotransferase RnCHST3, as shown in SEQ ID NO.5, was mutated to leucine, resulting in the mutant shown in SEQ ID NO.6, named M5.

[0012] In one embodiment, the amino acid sequence of the recombinant chondroitin 6-O-sulfotransferase mutant is as shown in any one of SEQ ID NO. 1 to 6.

[0013] The present invention also provides a gene encoding the above-mentioned recombinant chondroitin 6-O-sulfotransferase mutant.

[0014] The present invention also provides a recombinant vector carrying the above-mentioned genes.

[0015] In one embodiment, the recombinant vector uses pET-28a as the expression vector.

[0016] The present invention also provides microbial cells carrying the above-mentioned genes or the above-mentioned recombinant vectors.

[0017] In one embodiment, the microbial cells use prokaryotes or eukaryotes as expression hosts.

[0018] In one embodiment, the microbial cells use Escherichia coli Rosetta (DE3) as the expression host.

[0019] The present invention also provides a recombinant Escherichia coli expressing the above-mentioned recombinant chondroitin 6-O-sulfotransferase mutant.

[0020] In one embodiment, the recombinant Escherichia coli uses Escherichia coli Rosetta (DE3) as the expression host and pET-28a as the expression vector.

[0021] The present invention also provides a method for obtaining the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, the method comprising the following steps:

[0022] (1) Based on the amino acid sequence of recombinant chondroitin 6-O-sulfotransferase RnCHST3, the mutation site was determined; mutation primers were designed, and the vector carrying the recombinant chondroitin 6-O-sulfotransferase RnCHST3 gene was used as a template for mutation; and a plasmid vector with site mutation was constructed.

[0023] (2) Transform the site-mutated plasmid vector into the host cell;

[0024] (3) Select positive clones for fermentation culture and purify chondroitin 6-O-sulfotransferase RnCHST3.

[0025] In one embodiment, the host cell is Escherichia coli.

[0026] The present invention also provides the use of the recombinant Escherichia coli or the method in the production of chondroitin sulfate or chondroitin sulfate-containing products.

[0027] The present invention also provides a method for preparing CSC, wherein the method comprises adding the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, or the above-mentioned microbial cells, or the above-mentioned crude enzyme or pure enzyme of recombinant Escherichia coli to a reaction system containing chondroitin and 3'-phosphoadenosine-5'-phosphorylsulfate, and reacting to prepare the CSC.

[0028] In one embodiment, the final concentration of chondroitin in the reaction system is 5–20 g / L.

[0029] In one embodiment, the final concentration of the 3'-adenosine-5'-phosphosulfate in the reaction system is 5.1–20.4 g / L.

[0030] In one embodiment, the reaction conditions are: a reaction at pH 6.5–8.5 and 35–40°C for 24–48 hours.

[0031] The present invention also provides the use of the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, or the above-mentioned gene, or the above-mentioned recombinant vector, or the above-mentioned recombinant cell, or the above-mentioned recombinant Escherichia coli in the preparation of CSC products.

[0032] Beneficial effects:

[0033] (1) This invention provides a recombinant chondroitin 6-O-sulfotransferase RnCHST3 and its mutant for catalyzing the production of chondroitin sulfate C.

[0034] (2) The conversion rate of chondroitin 6-O sulfonyltransferase RnCHST3 mutant to chondroitin sulfate C by recombinant chondroitin 6-O sulfonyltransferase RnCHST3 of this invention is 3 times higher than that of recombinant chondroitin 6-O sulfonyltransferase RnCHST3. Under the conditions of 37℃ and pH 7.5, the sulfonation rate reaches 46% after 24 h of reaction. Using the method of this invention improves the production capacity per unit catalyst and the reaction efficiency of the catalyst, reduces the reaction cost, and accelerates the industrialization process of chondroitin sulfate C production by enzymatic conversion. Attached Figure Description

[0035] Figure 1 The reaction formula is for the sulfonation of chondroitin 6-O catalyzed by RnCHST3 to generate CSC.

[0036] Figure 2 The 24-hour sulfonation rate of the multimutant is given. Detailed Implementation

[0037] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to these embodiments.

[0038] Reagents and materials:

[0039] Prime STAR Max DNA polymerase, BamHI, HindIII, NdeI and XhoI endonucleases, DNA marker and other enzyme reagents were purchased from TaKaRa (Dalian).

[0040] The ClonExpress one-step directional cloning kit and gel extraction kit were purchased from Vazyme Biotech (Nanjing).

[0041] The plasmid extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0042] All analytical grade reagents were purchased from Sinopharm Group.

[0043] Culture medium:

[0044] LB medium (g / L): yeast extract 5g, NaCl 10g, peptone 10g; bring to the appropriate volume with deionized water, sterilize at 121°C for 20 min before use; solid medium requires the addition of about 2% agar powder before sterilization.

[0045] TB medium (g / L): glycerol 4, yeast extract (Angel 802) 24, tryptone 12, KH2PO4 2.31, K2HPO4·3H2O 16.42; bring to the appropriate volume with deionized water, sterilize at 121℃ for 15-20 min before use.

[0046] In vitro catalytic reaction of chondroitin sulfate 6-O-sulfotransferase:

[0047] Preparation of reaction solution: 20 mmol / L Tris pH 7.5 prepared at 37℃ was used as the reaction solvent. Crude enzyme solution prepared by cell disruption with a final concentration of 20 g / L was added. The final concentration of chondroitin dissolved in the reaction solution was controlled to be 15 g / L, and the final concentration of 3'-adenosine-5'-phosphosulfate dissolved in the reaction solution was controlled to be 15.3 g / L.

[0048] CSC's testing methods:

[0049] The sulfonation efficiency of CSC was defined as the ratio of the content of CSC disaccharide (Di-6S) to the total content of Di-6S and chondroitin disaccharide (Di-0S). HPLC separation and detection were performed, and quantitative analysis was conducted by calculating the peak area ratio of Di-6S and Di-0S. 1 mL of fermentation broth was taken, and 20 μL of 20 mg / mL chondroitin lyase ABC I was added. The mixture was incubated at 37°C for 12 h to completely lyse the disaccharide. The protein was inactivated by boiling in a water bath for 10 min, centrifuged at 12,000 × g for 20 min, and then filtered through a MW3000 ultrafiltration tube to remove impurities. The purified disaccharide was filtered through a 0.22 μm filter membrane and then analyzed by HPLC.

[0050] The HPLC detection conditions are as follows:

[0051] A Pro Pac SAX-10 column (size: 4.0×250mm) was used. Mobile phase A: 10mmol / L Tris (pH adjusted to 3.5 with dilute hydrochloric acid), mobile phase B: 10mmol / L Tris + 1mol / L sodium chloride solution (pH adjusted to 3.5 with dilute hydrochloric acid), flow rate: 1.0mL / min, detector: UV detector, detection wavelength: 232nm, column temperature: 40℃, injection volume: 10μL, gradient elution was used.

[0052] Table 1 Gradient elution method using enzymatic hydrolysis liquid phase.

[0053]

[0054] Calculation of sulfonation rate: The sulfonation efficiency of CSC is calculated according to the ratio of the content of CSC disaccharide (Di-6S) to the total amount of Di-6S and chondroitin disaccharide (Di-0S).

[0055] Example 1: Construction and expression of the truncated body Δ106RnCHST3

[0056] (1) GenBank accession number EDL93054.1 was given to Suzhou Genewise Biotechnology Co., Ltd. for codon optimization and artificial synthesis. The synthesized nucleotide sequence, as shown in SEQ ID NO.7, was ligated and assembled into the pET28a(+) plasmid between the BamHI and HindIII restriction sites to obtain the pET28a(+)-RnCHST3 plasmid.

[0057] (2) Using pET28a(+)-RnCHST3 obtained in step (1) as a template, primers for the Δ106RnCHST3 truncated variant, which is shortened by 106 amino acids from the N end, were designed: F: CGGATCCGAATTCCTCGGTATCGCTCCGGCTATGGAAG; R: GAATTCGGATCCGCGACCCATTTGC; The truncated variant was constructed by whole plasmid PCR.

[0058] Construct the PCR amplification system: 25 μL Prime STAR Max DNA polymerase, 1 μL of each primer for each truncated variant, 1 μL template (RnCHST3), and 22 μL water; PCR reaction conditions were: ① 94℃ for 3 min; ② 98℃ for 10 s; ③ 58℃ for 5 s; ④ 72℃ for 10 s / kb; ⑤ Repeat steps ② to ④ 29 times; ⑥ 72℃ for 5 min; ⑦ Incubate at 12℃. The above reaction system was incubated at 37℃ for 1 h to digest the plasmid template (digestion system: DpnI 1 μL, above reaction PCR product 44 μL, 10×T Buffer 5 μL). After digestion, the digestion product was introduced into E. coli Rosetta competent cells by chemical transformation. The specific steps of chemical transformation are as follows: (1) 10 μL of homologous recombination product was introduced into 100 μL of E. coli Rosetta (DE3) competent cells; (2) Ice bath for 10 min; (3) Heat shock in a 42℃ water bath for 1 min 30 s, and then quickly placed in ice for 4 min; (4) 600 μL of antibiotic-free LB medium was added and mixed, and cultured at 37℃ and 200 rpm for 1 h; (5) Centrifuged at 5000 rpm for 2 min to collect the bacteria; (6) The supernatant was removed, and the remaining 100-200 μL was pipetted and mixed and spread onto LB plates containing 0.05 mg / mL kanamycin and cultured at 37℃ for about 12 h. (7) Select a single clone and incubate it in LB containing 0.05 mg / mL kanamycin. After incubation at 37°C for 12 h at 200 rpm, send it to the company for sequencing. The one with correct sequencing is the positive transformant.

[0059] (3) Single colonies of the prepared genetically engineered strain E. coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 and E. coli Rosetta(DE3)-pET28a(+)-RnCHST3 were inoculated into 30 mL of fresh LB medium containing Kan and Cm resistance, respectively, and cultured at 37 °C with shaking for 10 h. Then, they were transferred to 150 mL of TB medium (containing Kan and Cm resistance) at a 1% (v / v) inoculation rate and cultured at 37 °C and 200 rpm until OD... 600 The concentration of the enzyme was 0.6-0.8. IPTG was added to a final concentration of 60 mg / L for induction at 16℃ for 18 h. After induction, the cells were centrifuged at 8000 rpm for 5 min at 4℃. The cells were washed several times with PBS buffer, resuspended at 10 mg / mL, and sonicated for 10 min (100W, 2 s sonication, 1.5 s interval). The cells were then centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was collected as the crude enzyme solution.

[0060] (4) In a 20 mM Tris-HCl pH 7.5 system, chondroitin and PAPS were added to a final concentration of 15 g / L. The reaction was catalyzed for 24 h at 37 °C using crude enzyme solution after cell disruption at a final concentration of 20 g / L. 1 mL of fermentation broth was taken, and 20 μL of 20 g / L chondroitin lyase ABC I was added. The mixture was incubated at 37 °C for 12 h to completely lyse the lysate into a disaccharide. The protein was inactivated by boiling in a water bath for 10 min. After centrifugation at 12,000 × g for 20 min, impurities were removed by ultrafiltration through a MW3000 ultrafiltration tube. The purified disaccharide was then filtered through a 0.22 μm filter membrane and analyzed by HPLC. The results showed that, compared to the original RnCHST3, the truncated form Δ106RnCHST... WT The catalytic efficiency was improved by 51%, achieving a sulfonation rate of 11% in 24 hours.

[0061] Example 2: Construction of single mutants and multiple mutants

[0062] (1) Construction of single mutants

[0063] Primers for the mutant site of RnCHST3 were designed, as shown in Table 2. The mutant was constructed by whole plasmid PCR (the whole plasmid used here was the pET-28a(+) plasmid containing the wild-type gene Δ106RnCHST3).

[0064] Table 2. Primer sequence list for mutants

[0065]

[0066] (2) Constructing the PCR reaction system: PCR was performed according to the method in Example 1. The above reaction system was incubated at 37℃ for 1 h to digest the plasmid template (digestion system: DpnI 1 μL, PCR product of the above reaction 44 μL, 10×T Buffer 5 μL). After digestion, the digestion product was introduced into E. coli Rosetta competent cells by chemical transformation. The specific steps of chemical transformation are as follows: (1) 10 μL of homologous recombination product was introduced into 100 μL of E. coli Rosetta (DE3) competent cells; (2) Ice bath for 10 min; (3) Heat shock in a 42℃ water bath for 1 min 30 s, and then quickly placed in ice for 4 min; (4) 600 μL of antibiotic-free LB medium was added and mixed, and cultured at 37℃ and 200 rpm for 1 h; (5) Centrifuged at 5000 rpm for 2 min to collect the bacteria; (6) The supernatant was removed, and the remaining 100-200 μL was pipetted and mixed and spread onto LB plates containing 0.05 mg / mL kanamycin and cultured at 37℃ for about 12 h. (7) Select a single clone and incubate it in LB containing 0.05 mg / mL kanamycin. After incubation at 37°C for 12 h at 200 rpm, send it to the company for sequencing. The one with correct sequencing is the positive transformant.

[0067] (3) Construction of multiple mutants: The construction method is the same as that for single mutants, using the single mutant Δ106RnCHST3 obtained in the first round. F210R (Amino acid sequence as shown in SEQ ID NO.2), named Δ106RnCHST3 M1 (M1); Using M1 as a template, a second round of combination is performed to obtain Δ106RnCHST3. F210R / Y310F (Amino acid sequence as shown in SEQ ID NO.3), named Δ106RnCHST3 M2 (M2); then, using M2 as a template, combination mutations were performed with the remaining sites to obtain the mutant Δ106RnCHST3. F210R / Y310F / A209L (Amino acid sequence as shown in SEQ ID NO.4), named Δ106RnCHST3 M3 (M3); then, using M3 as a template, combination mutations were performed with the remaining sites to obtain the mutant Δ106RnCHST3. F210R / Y310F / A209L / A303S (Amino acid sequence as shown in SEQ ID NO.5), named Δ106RnCHST3 M4 (M4); then, using M4 as a template, a combination mutation was performed to obtain the mutant Δ106RnCHST3. F210R / Y310F / A209L / A303S / I173L (Amino acid sequence as shown in SEQ ID NO.6), named Δ106RnCHST3 M5 (M5).

[0068] Recombinant strain E. coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 was prepared separately. M1 , E.coli Roset ta(DE3)-pET28a(+)-Δ106RnCHST3 M2 , E.coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 M3 , E.coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 M4 , E.coli Rosetta(DE3)-pET28a(+)-Δ106Rn CHST3 M5 .

[0069] Example 3: Determination of the 24-hour sulfonation rate improvement of the mutant

[0070] In a 20 mM Tris-HCl pH 7.5 system, chondroitin and 15.3 g / L PAPS were added to a final concentration. The reaction was catalyzed for 24 h at 37 °C using a crude enzyme solution (final concentration 20 g / L) after cell disruption. The preparation method of the crude enzyme solution was the same as in Example 1. 1 mL of fermentation broth was taken, and 20 μL of 20 g / L chondroitin lysin ABC I (Sigma-Aldrich; catalog number: C2905) was added. The mixture was incubated at 37 °C for 12 h to completely lyse the lysin into a disaccharide. The protein was inactivated by boiling in a water bath for 10 min. After centrifugation at 12,000 × g for 20 min, impurities were removed by ultrafiltration through a MW3000 ultrafiltration tube. The purified disaccharide was filtered through a 0.22 μm filter membrane and analyzed by HPLC. The conversion of chondroitin 6-O sulfonation catalyzed by the wild type and five mutants was compared after 24 h. Figure 2 As shown in the figure. The results showed that the 24h sulfonation rate of the optimal five mutant M5 was 46%, which was 3 times higher than that of the wild-type enzyme Δ106RnCHST3(WT) (11%).

[0071] Table 3 Transformation rates of different mutants

[0072]

[0073] Example 4: Characterization of kinetic parameters of wild type and five mutants

[0074] To evaluate the mutants, this invention measured the mutant wild-type Δ106RnCHST3 and the pentamutant Δ106RnCHST3. M5 Dynamic parameters at 37℃.

[0075] The positive transformants containing M5 from the recombinant strain prepared in Example 2 were inoculated into LB medium and cultured at 37°C until OD500. 600 Enzyme expression was induced by adding IPTG to a final concentration of 60 mg / L when the pH was between 0.6 and 0.8. The induction temperature was 16℃, and the induction time was 18 h, yielding a culture medium. The culture medium was centrifuged at 8000 rpm for 5 min at 4℃, and the bacterial cells were collected. The same procedure was performed to obtain the wild-type enzyme.

[0076] To prepare a nickel ion affinity chromatography column, first, using a constant flow pump at 4°C, flush the column with ultrapure water (approximately 6–12 column volumes). Then, equilibrate the column with 10 mL of binding buffer A. Once the pH of the effluent from the bottom of the column matches that of the low-salt buffer pumped into the column (approximately 5 column volumes of buffer are required), add the obtained crude enzyme solution to the column. First, wash with binding buffer A to reach baseline equilibration, then elute with elution buffer B (20 mM sodium phosphate, 0.5 mM NaCl, 500 mM imidazole). This method yields Δ106RnCHST3 and Δ106RnCHST3. M5 Pure enzymes.

[0077] The kinetic parameters of the enzyme were determined by measuring the initial rate of the enzymatic reaction at different substrate concentrations over 60 min. These parameters are shown in Table 3. The catalytic constant (k) is compared with that of the WT. cat / K m In comparison, M5 improves the catalytic constant of PAPS by 6 orders of magnitude and the catalytic constant of chondroitin by 3 orders of magnitude.

[0078] Table 4 Characterization of dynamic parameters

[0079]

[0080] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A chondroitin 6-O-sulfotransferase mutant, characterized in that, The mutant is selected from any one of (a) to (e): (a) Mutate the phenylalanine at position 210 of chondroitin 6-O-sulfotransferase RnCHST3, whose amino acid sequence is shown in SEQ ID NO.1, to arginine; (b) Mutate the tyrosine residue at position 310 of chondroitin 6-O-sulfotransferase RnCHST3, whose amino acid sequence is shown in SEQ ID NO.2, to phenylalanine; (c) Mutate alanine at position 209 of chondroitin 6-O-sulfotransferase RnCHST3, whose amino acid sequence is shown in SEQ ID NO.3, to leucine; (d) Mutate the alanine at position 303 of chondroitin 6-O-sulfotransferase RnCHST3, whose amino acid sequence is shown in SEQ ID NO.4, to serine; (e) Mutate isoleucine at position 173 of chondroitin 6-O-sulfotransferase RnCHST3, whose amino acid sequence is shown in SEQ ID NO.5, to leucine.

2. The gene encoding the chondroitin 6-O-sulfotransferase mutant of claim 1.

3. A recombinant vector carrying the gene of claim 2.

4. Microbial cells carrying the gene of claim 2 or the recombinant vector of claim 3.

5. Recombinant Escherichia coli, characterized in that, The chondroitin 6-O-sulfotransferase mutant of claim 1 was expressed.

6. The recombinant Escherichia coli according to claim 5, characterized in that, by Escherichia coli Rosetta(DE3) was used as the expression host, and pET-28a was used as the expression vector.

7. A method for preparing chondroitin sulfate C, characterized in that, The chondroitin 6-O-sulfotransferase mutant of claim 1, or the microbial cells of claim 4, or the recombinant Escherichia coli of claim 5 or 6, is added to a reaction system containing chondroitin and 3'-adenosine-5'-phosphosulfate for reaction.

8. The method according to claim 7, characterized in that, The reaction is carried out at pH 6.5–8.5 and 35–40 °C for 24–48 h.

9. The use of the chondroitin 6-O-sulfotransferase mutant of claim 1, or the gene of claim 2, or the recombinant vector of claim 3, or the microbial cell of claim 4, or the recombinant Escherichia coli of any one of claims 5-6 in the preparation of chondroitin sulfate C.

Images