A T7 RNA polymerase mutant and its application

By substituting specific amino acids and designing fusion proteins for T7 RNA polymerase, the problem of low efficiency in synthesizing chemically modified nucleic acid molecules by T7 RNA polymerase in existing technologies has been solved, and the ability to efficiently synthesize single-stranded DNA, fluorinated RNA, and perfluorinated DNA molecules has been achieved.

CN119530191BActive Publication Date: 2026-05-29HUNAN UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN UNIV
Filing Date
2024-08-21
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing T7 RNA polymerases exhibit low catalytic efficiency and are difficult to synthesize efficiently when synthesizing chemically modified nucleic acid molecules, especially full-length transcripts.

Method used

By substituting specific amino acids into wild-type T7 RNA polymerase, a T7 RNA polymerase mutant is formed, enhancing its ability to recognize and incorporate 2'-F-dNTPs and dNTPs. A tag and/or protease cleavage site are then attached to the amino and/or carboxyl terminus to form a fusion protein, thereby improving transcription efficiency.

Benefits of technology

It achieves the ability to efficiently synthesize single-stranded DNA molecules, fluorinated RNA molecules, and perfluorinated DNA molecules, while maintaining transcription efficiency comparable to that of wild-type when synthesizing conventional RNA molecules.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530191B_ABST
    Figure CN119530191B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of T7 RNA polymerase mutant and its application, the T7 RNA polymerase mutant has the following mutation relative to wild type T7 RNA polymerase: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;Or, at least one of the following mutations can also be based on the above-mentioned mutation: S43Y, G47A, S641A.The T7 RNA polymerase mutant provided by the present application can recognize and incorporate rNTPs, 2'-F-dNTPs and one or more nucleotide substrates of dNTPs, to efficiently synthesize single-stranded DNA molecules, fluorinated RNA molecules and perfluorinated DNA molecules in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a T7 RNA polymerase mutant and its applications. Background Technology

[0002] Single-stranded nucleic acid synthesis technology, as an indispensable foundational technology in synthetic biology, has a potential impact on fields such as molecular diagnostics and biomedicine comparable to the supporting role of sequencing technology in genomics. Solid-phase chemical synthesis methods are very mature and are currently the mainstream method for synthesizing short-chain oligonucleotides. However, they have disadvantages such as difficulty in synthesizing long-chain nucleotides, cumbersome experimental operations, large consumption of chemical reagents, and environmental unfriendliness.

[0003] Besides chemical methods, enzymatic methods are also an important method for synthesizing single-stranded nucleic acids. Among enzymatic synthesis methods, asymmetric PCR (aPCR) is simple and rapid, but it is prone to non-specific amplification and byproducts, resulting in impure products.

[0004] T7 RNA polymerase (T7 RNAP) is a single-subunit polymerase first isolated from *Escherichia coli* infected with bacteriophage T7 in 1970. As an important and efficient tool enzyme, it plays a crucial role in several key processes, including gene expression, transcriptional regulation, and RNA synthesis. Particularly in the field of RNA synthesis, T7 RNA polymerase can synthesize RNA molecules with specific sequences through in vitro transcription techniques, providing vital technical support for RNA structure and function studies, the development of RNA interference technology, and the research and development of RNA vaccines.

[0005] However, wild-type T7 RNA polymerase has limited functionality. Existing technologies have reported several substrate-specific modified T7 RNA polymerase mutants that can be used to synthesize modified nucleic acid molecules. However, these mutants still suffer from the following problems: incorporating more chemically modified nucleotide substrates at the C2' position leads to a significant decrease in catalytic efficiency. Especially when all nucleotides are chemically modified, the synthetic efficiency often reaches its lowest point, and the length of the synthesized product is also limited, making it difficult to synthesize full-length transcripts. Summary of the Invention

[0006] The purpose of this invention is to provide a T7 RNA polymerase mutant and its application. This T7 RNA polymerase mutant can be used to synthesize single-stranded DNA molecules, fluorinated RNA molecules, and perfluorinated DNA molecules in vitro, and has high transcription efficiency.

[0007] Therefore, in a first aspect, the present invention provides a T7 RNA polymerase mutant, which is any one of the proteins described in a1-a3 below:

[0008] a1: A protein containing the following amino acid substitutions based on the wild-type T7 RNA polymerase with the amino acid sequence shown in SEQ ID NO: 1:

[0009] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0010] a2: A protein obtained by substituting the protein described in a1 with amino acids containing one or any combination of two or more of the following groups:

[0011] S43Y;

[0012] G47A;

[0013] S641A;

[0014] a3: A fusion protein obtained by attaching a tag and / or protease cleavage site to the amino terminus and / or carboxyl terminus of the protein described in a1 or a2, wherein the tag and protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

[0015] According to the technical solution of this application, by substituting the above-mentioned amino acids into the wild-type T7 RNA polymerase shown in SEQ ID NO: 1, the T7 RNA polymerase mutant can be made to have the ability to recognize and incorporate 2'-F-dNTPs and dNTPs efficiently, and has the same transcription efficiency of conventional RNA molecules as the wild type.

[0016] In some embodiments, the T7 RNA polymerase mutant is b1 or b2.

[0017] b1: A protein based on the wild-type T7 RNA polymerase with the amino acid sequence shown in SEQ ID NO: 1, containing any of the following amino acid substitutions:

[0018] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0019] S43Y, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0020] G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0021] S43Y, G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0022] P266L, S430P, N433T, S633P, Y639F, S641A, V689Q, V783M, F849I, F880Y;

[0023] b2: A fusion protein obtained by attaching a tag and / or protease cleavage site to the protein described in b1 at the amino terminus and / or carboxyl terminus, wherein the tag and protease cleavage site do not affect the function of the T7 RNA polymerase mutant.

[0024] In a second aspect, the present invention provides a coding gene that encodes the T7 RNA polymerase mutant.

[0025] In a third aspect, the present invention provides a vector comprising the coding gene described in the second aspect of the present invention.

[0026] In some embodiments, the vector is selected from one of the group consisting of plasmids, bacteriophages, kinases, artificial chromosomes, plant cell viruses, mammalian cell viruses, or retroviruses.

[0027] In a fourth aspect, the present invention provides a host cell that expresses the T7 RNA polymerase mutant described in the first aspect of the present invention, and / or contains the coding gene described in the second aspect of the present invention, and / or contains the vector described in the third aspect of the present invention.

[0028] In some embodiments, the host cell is a prokaryotic cell, yeast cell, insect cell, or mammalian cell.

[0029] In a fifth aspect, the present invention provides a method for preparing the T7 RNA polymerase mutant, comprising: expressing the T7 RNA polymerase mutant in a host cell as described in the fourth aspect of the present invention, and isolating and purifying the T7 RNA polymerase mutant.

[0030] In a sixth aspect, the invention provides the T7 RNA polymerase mutant described in the first aspect of the invention, and / or the coding gene described in the second aspect of the invention, and / or the vector described in the third aspect of the invention, and / or the use of the host cell described in the fourth aspect of the invention in the synthesis of nucleic acid molecules.

[0031] In some embodiments, the nucleic acid molecule is modified; the modification includes fluorine substitution.

[0032] In some embodiments, the nucleic acid molecule is single-stranded.

[0033] In some embodiments, the nucleic acid molecule is DNA or RNA.

[0034] A seventh aspect of the present invention provides a method for synthesizing nucleic acid molecules, comprising providing a system including a template, a substrate, and a T7 RNA polymerase mutant as described in the first aspect of the present invention, wherein the nucleic acid molecule is synthesized by transcription under the catalysis of the T7 RNA polymerase mutant; wherein the substrate is selected from at least one of dNTPs (2'-deoxyribonucleoside triphosphate), rNTPs (ribonucleoside triphosphate), and 2'-F-dNTPs (2'-fluororibonucleoside triphosphate).

[0035] In some embodiments, the transcription reaction conditions include incubation at 30–37°C; for example, the incubation temperature can be about 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, etc.

[0036] In some implementations, the incubation time is 2 to 6 hours; for example, it can be about 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, etc.

[0037] In some embodiments, the nucleic acid molecule is modified; the modification includes fluorine substitution.

[0038] In some embodiments, the nucleic acid molecule is single-stranded.

[0039] In some embodiments, the nucleic acid molecule is DNA or RNA.

[0040] Compared with the prior art, the technical solution of the present invention has at least the following advantages:

[0041] (1) The T7 RNA polymerase mutant provided by the present invention can recognize and incorporate one or more nucleotide substrates among rNTPs, 2'-F-dNTPs and dNTPs to efficiently synthesize single-stranded DNA molecules, fluorinated RNA molecules and perfluorinated DNA molecules.

[0042] (2) In terms of transcribing conventional RNA molecules using rNTPs as substrates, the T7 RNA polymerase mutant provided by the present invention has a transcription efficiency comparable to that of wild-type T7 RNA polymerase. Attached Figure Description

[0043] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. In the drawings:

[0044] Figure 1SDS-PAGE gel electrophoresis analysis results of the T7 RNA polymerase prepared in Example 1;

[0045] Figure 2 The normalized value of fluorescence intensity emitted by T7 RNA polymerase after transcription of fluorescent RNA and binding to ligand HBC 4 hours later (E x / E m (488 / 530); where None represents the blank control and WT represents wild-type T7 RNA polymerase;

[0046] Figure 3 Characterization of the activity of T7 RNA polymerase mutant in synthesizing long and complex 2'-fluoropyrimidine-modified RNA molecules; (a) 1% agarose gel electrophoresis characterization of the transcribed 2'-fluoropyrimidine-modified RNA product by T7 RNA polymerase mutant; (b) relative values ​​of the grayscale analysis of the Runoff bands in each lane in Figure a. The grayscale value of the WT band at 37℃ was set as the baseline value of 100, and the grayscale values ​​of other lanes were all used as references to obtain their relative values; None represents the blank control, and WT represents wild-type T7 RNA polymerase.

[0047] Figure 4 : 1% agarose gel electrophoresis characterization of the T7 RNA polymerase mutant's activity in synthesizing fluorine-modified RNA; lanes 1-6 represent QM-F-M6, QM-F-M6-AG, QM-F-M6-Y, QM-F-M6-YAG, QM-F-M6-A, and QM-F-M6-YA mutants, respectively; WT represents wild-type T7 RNA polymerase; None represents blank control.

[0048] Figure 5 Fluorescence emission spectrum (E) of T7 RNA polymerase mutant after transcription of G-quadruplex (DNA) for 90 min and binding to the small molecule ThT. x / E m (425 / 495). None represents the blank control, where no polymerase was added; WT(rN) represents the positive control, where wild-type T7 RNA polymerase transcribes G-quadruplexes (RNA) using four rNTPs as substrates.

[0049] Figure 6 Characterization results of the in vitro DNA synthesis ability of T7 RNAP mutants; where lane 4 represents QM-F-M6 and lane 5 represents QM-F-M6-S641A. Detailed Implementation

[0050] Exemplary embodiments of the present disclosure will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

[0051] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, this invention can be implemented using any prior art methods, apparatus, and materials similar to or equivalent to those described in the embodiments of this invention, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention.

[0052] In this article, "amino acid substitution" refers to replacing one amino acid in a polypeptide or protein with another amino acid.

[0053] In this document, amino acid substitutions are indicated by a first letter followed by a number followed by a second letter. The first letter indicates the amino acid being substituted; the number indicates the position of the substituted amino acid, numbered sequentially from the first N-terminal amino acid of SEQ ID NO: 1 towards the C-terminus; the second letter indicates the amino acid used to replace the amino acid indicated by the first letter. For example, P266L indicates that proline (P) at position 266 is replaced by leucine (L).

[0054] In this article, the standard single-letter or three-letter codes for natural amino acids are used:

[0055] Alanine (Ala, A) Arginine (Arg, R)

[0056] Asparagine (Asn, N) Aspartic acid (Asp, D)

[0057] Cysteine ​​(Cys, C) Glutamate (Glu, E)

[0058] Glutamine (Gln, Q) Glycine (Gly, G)

[0059]

[0060] As used herein, the term "vector" refers to a nucleic acid medium in which polynucleotides can be inserted. When a vector allows the expression of a protein encoded by the polynucleotides inserted therein, the vector is called an expression vector. This vector can be used to express the carried genetic material elements in host cells through transformation, transduction, or transfection. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, granules, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and multivacuolar papillomaviruses (such as SV40). A vector may contain multiple elements for controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain an origin of replication.

[0061] In this document, "host cell" refers to a cell in which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include the initially transformed cell and its derived progeny (regardless of passage number). Progeny may not be identical to the parent cell in terms of nucleic acid contents, but may contain mutations. This document includes mutant progeny with the same function or biological activity as screened or selected from the original transformed cells. Host cells are any type of cell system capable of generating the fusion protein of this invention. Host cells include mammalian cultured cells such as CHO cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, bacterial cells such as Escherichia coli, insect cells, and plant cells, and also include cells contained in transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0062] In some embodiments, a T7 RNA polymerase mutant is provided, whose amino acid sequence is based on the amino acid sequence shown in SEQ ID NO: 1, and contains the following group of amino acid substitutions:

[0063] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y.

[0064] In some embodiments, a T7 RNA polymerase mutant is provided, whose amino acid sequence is based on the amino acid sequence shown in SEQ ID NO: 1, and contains the following group of amino acid substitutions:

[0065] P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y;

[0066] Furthermore, it contains any one or any combination of two or more of the following amino acid substitutions:

[0067] S43Y;

[0068] G47A;

[0069] S641A.

[0070] It should be noted that fusion proteins are typically obtained by attaching tags and / or protease cleavage sites to the amino and / or carboxyl ends of proteins, for the purpose of facilitating expression, purification, or isolation. When the T7 RNA polymerase mutant provided by this invention is coupled with the aforementioned tags and / or protease cleavage sites, its function is generally unaffected by the coupled tags or protease cleavage sites. In this case, the fusion protein obtained by coupling the tags and / or proteases is also within the scope of protection of this invention. As an example, commonly used tags can be selected from HIS-Tag (histidine tag), GST-Tag (glutathione thiotransferase tag), MBP-Tag (maltose-binding protein tag), NusA-Tag (transcription termination / anti-termination protein tag), etc.

[0071] In some embodiments, the T7 RNA polymerase mutants shown in Table 1 are provided, where "mutation site" refers to the mutation site present in the wild-type T7 RNA polymerase shown in SEQ ID NO: 1.

[0072] Table 1

[0073]

[0074] With the mutation sites and sequences of the T7 RNA polymerase mutant disclosed in the specific embodiments of this application, those skilled in the art can construct an expression vector containing it under laboratory conditions using conventional cloning methods (e.g., PCR); or, they can directly entrust a gene synthesis company to synthesize it, thereby obtaining an expression vector of the T7 RNA polymerase mutant.

[0075] In some implementations, the T7 RNA polymerase mutant can be obtained by starting with the sequence of wild-type T7 RNA polymerase and using "large primer PCR technology" through multiple rounds of PCR cloning. In a single PCR, one or more sites can be mutated; thus, the target sequence can be obtained through multiple rounds of PCR. For example, QM-F-M6 contains nine mutation sites and requires five consecutive large primer PCR processes for construction. A detailed explanation is provided using one of the large primer PCR mutations (P266L, S633P, Y639F) as an example. The specific experimental steps are as follows:

[0076] Using the expression vector of wild-type T7 RNA polymerase as a template, primers as shown in Table 2 were designed and synthesized, where bold underlined text represents mutation sites.

[0077] Table 2 Primer sequences

[0078]

[0079] The large primer PCR amplification method mainly involves two rounds of PCR amplification. The specific operation steps for each round of amplification are as follows.

[0080] First round of PCR: Add samples according to the PCR reaction solution formula shown in Table 3. Then perform PCR amplification to obtain PCR products called "large primers".

[0081] Table 3. PCR reaction solution formulation (total volume 25 μL)

[0082] Components Final concentration or volume <![CDATA[2×KOD One TM PCR Master Mix]]> 1× Plasmid template: pGEX-6p-1-GST-T7 RNAP(WT) 1ng / μL Upstream primer (P266L-F) 0.3μM Downstream primer (S633P / Y639F-R) 0.3μM DEPC water Up to 25μL

[0083] Second round of PCR: Samples were added according to the PCR reaction solution formula shown in Table 4. PCR amplification was then performed to obtain the PCR amplification product of the mutant plasmid: a double-stranded DNA molecule containing the complete plasmid sequence and three mutation sites (P266L, S633P, Y639F).

[0084] Table 4. PCR reaction solution formulation (total volume 25 μL)

[0085]

[0086]

[0087] The template plasmid in the PCR amplification product was digested using SpeedyCut DpnI fast digester, and then the purified PCR amplification product was transformed into E. coli DH5α competent cells. After antibiotic selection, plasmid extraction, and sequencing, positive clones that correctly expressed the target protein were obtained.

[0088] Therefore, through the aforementioned round of "large primer PCR," an expression vector for T7 RNA polymerase containing three mutation sites (P266L, S633P, and Y639F) can be obtained. Using this expression vector as a template, subsequent rounds of large primer PCR are performed sequentially using a similar method to finally obtain the expression vector pGEX-6p-1-GST-QM-F-M6 for QM-F-M6. Similarly, using a similar method, the T7 RNA polymerase mutants in other embodiments of the present invention can be cloned.

[0089] The T7 RNA polymerase mutant provided in the embodiments of the present invention can be used as a tool enzyme for synthesizing nucleic acid molecules. In some embodiments, a method for synthesizing nucleic acid molecules is provided, comprising providing a system including a template, a substrate, and the T7 RNA polymerase mutant described in the first aspect of the present invention, wherein the nucleic acid molecule is synthesized by transcription under the catalysis of the T7 RNA polymerase mutant; wherein the substrate is selected from at least one of dNTPs (2'-deoxyribonucleoside triphosphate), rNTPs (ribonucleoside triphosphate), and 2'-F-dNTPs (2'-fluororibonucleoside triphosphate).

[0090] The template can be designed or selected based on the sequence of the desired nucleic acid molecule. The substrate can be specifically selected according to the type of nucleic acid molecule to be synthesized. For example, dNTPs can be used to synthesize single-stranded DNA molecules; rNTPs can be used to synthesize RNA molecules; substrates containing 2'-F-dNTPs can be used to synthesize DNA or RNA molecules with fluorine substitution at some sites; and substrates consisting entirely of 2'-F-dNTPs can be used to synthesize perfluorinated DNA molecules.

[0091] Unless otherwise specified, the instruments and reagents used in the following examples can be obtained from conventional commercial channels.

[0092] Example 1: Expression and purification of T7 RNA polymerase mutant

[0093] The expression vectors for the T7 RNA polymerase mutants shown in Table 1 are provided as follows: pGEX-6P-1-GST-QM-F-M6, pGEX-6P-1-GST-QM-F-M6-Y, pGEX-6P-1-GST-QM-F-M6-A, pGEX-6P-1-GST-QM-F-M6-YA, and pGEX-6P-1-GST-QM-F-M6-S641A; the plasmid backbone of the expression vector is pGEX-6P-1GST.

[0094] The above expression vectors were transformed into Escherichia coli BL21(DE3) and induced to express. The specific steps included:

[0095] Pick a single colony and place it in 4 mL of liquid LB medium, then add 4 μL of Amp. + The solution (100 mg / mL) was incubated at 37°C for 10 h. 4 mL of the shaken bacterial culture was then inoculated into 400 mL of 2×YT liquid medium, along with 400 μL of ampicillin. + The solution (100 mg / mL) was incubated in a 37°C incubator at 250 rpm for 2 hours until the bacterial cell OD reached its maximum. 600 When the cell lysis temperature reached approximately 0.6–0.8, 80 μL of 0.5 M IPTG was added for induction at low temperature (15°C, 200 rpm) for 16 h. Afterwards, the cells were centrifuged at 8000 rpm for 10 min using a large high-speed centrifuge, the supernatant was discarded, and the bacterial pellet was collected. Once the cells were collected, they were thoroughly resuspended in 4°C pre-chilled PBS buffer and then sonicated on ice until the sample was clear and completely lysed. Subsequently, the cells were centrifuged at low temperature for 15 min, and the cell lysis supernatant was filtered through a 0.45 μM filter into a clean 50 mL pre-chilled centrifuge tube.

[0096] Gently shake the high-affinity GST purification medium to fully resuspend it. Pipette an appropriate amount of slurry into a gravity column and wash the high-affinity GST purification medium with 10 column volumes of pre-chilled PBS buffer. Add the prepared cell lysis supernatant to the chromatography column. After all the lysis buffer has eluted, wash the column with PBS buffer (at least 10 column volumes) to remove contaminating proteins, and verify with Coomassie Brilliant Blue.

[0097] Equilibrate the column with 10 column volumes of PreScission Protease digestion buffer. The PreScission Protease digestion buffer consists of 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, and pH 7.5. Prepare PreScission Protease: Use approximately 2 U of PreScission Protease (purchased from Beyotime Biotechnology Co., Ltd.) per 100 μg of GST-tagged protein, and dilute it with PreScission digestion buffer to the same volume as the gel column. After thoroughly mixing 1 mL of diluted PreScission Protease with the purification medium, incubate the gravity column at 4°C overnight for digestion.

[0098] The next day, the column was washed with PreScission Protease digestion buffer, and the flow-through was collected in pre-chilled, clean 1.5 mL centrifuge tubes. The flow-through was dropped into Coomassie Brilliant Blue and the color was compared until it matched the color of the blank control. The flow-through protein was then mixed thoroughly with an equal volume of 80% glycerol, aliquoted, and stored at -80°C.

[0099] Finally, soak the purification medium column overnight in GST column treatment solution (300mM NaCl, 20mM Tris 8.0, 1.5g reduced glutathione, adjusted to 500mL). Then wash N column volumes, adding flow-through solution until Coomassie Brilliant Blue does not change color (if the protein is still difficult to wash away, wash with 6M guanidine hydrochloride for one column volume, then quickly rinse with water). Finally, store the column in 20% ethanol PBS buffer.

[0100] like Figure 1 As shown, the molecular weight and purity of the obtained T7 RNA polymerase were characterized by SDS-polyacrylamide gel electrophoresis. Lane 11 was QM-F-M6, lane 32 was QM-F-M6-Y, lane 34 was QM-F-M6-A, lane 35 was QM-F-M6-YA, lane 12 was QM-F-M6-S641A, and lane 13 was wild-type T7 RNA polymerase. M represents PageRuler Unstained Protein Ladder (10kDa to 200kDa).

[0101] Electrophoresis results showed that the bright band of the T7 RNA polymerase mutant was located near the 100 kDa standard band, consistent with the expected molecular weight of 99 kDa. Most proteins showed no extraneous bands, and although a few showed faint extraneous bands, their concentrations were low and did not affect subsequent experiments.

[0102] Example 2: Characterization of the transcriptional activity of T7 RNA polymerase mutants for conventional RNA molecules

[0103] (1) Preparation of dsDNA-1 transcription template

[0104] In a 50 μL system, equal amounts of sense-1 and antisense-1 DNA (as shown in Table 5) were added to a final concentration of 20 μM. Then, 12.5 μL of 10 mM MgCl2 and 17.5 μL of DEPC water were added to make up the final concentration. The solution was mixed thoroughly using a mixer and then placed in a PCR instrument for annealing and hybridization to obtain double-stranded DNA molecules, which were then used as dsDNA transcription templates and stored at -20℃.

[0105] Table 5 dsDNA-1 transcription template sequence

[0106]

[0107] (2) Fluorescent RNA transcription and fluorescence monitoring experiments

[0108] In a 20 μL reaction system, add 1 μL of dsDNA-1 transcription template (final concentration 1 μM), 4 μL of 5× transcription reaction buffer, 1 μM of T7 RNA polymerase, 2 μL of rNTPs (final concentration 2.5 mM), and 10 μM of HBC530 dye. Finally, add DEPC water to a final volume of 20 μL (a blank control group without T7 RNA polymerase was also included). After mixing and centrifugation, take 20 μL of the sample and measure the fluorescence intensity using a microplate reader. The reaction temperature was set at 37℃, the excitation wavelength at 488 nm, and the absorption wavelength at 530 nm. Data was read every 30 seconds. The results are as follows: Figure 2 The fluorescence values ​​shown represent the values ​​after 4 hours of transcription, indicating that the QM-F-M6 mutant has RNA transcription efficiency comparable to that of wild-type T7 RNA polymerase.

[0109] Example 3: Characterization of the transcriptional activity of T7 RNA polymerase mutants on 2'-F modified RNA molecules.

[0110] (1) Preparation of dsDNA-2 transcription template

[0111] Templates for in vitro transcription were prepared using PCR technology. Specifically, a DNA fragment containing the T7 promoter, T7 terminator, and transcript coding sequence (as shown in SEQ ID NO: 16) from the laboratory plasmid pET-28a(+)-4pepper was amplified using forward and reverse primers. The PCR reaction system (200 μL) consisted of: 0.3 μM forward and reverse primers (as shown in Table 6), 100 μL of 2×PrimeSTAR Mix DNA polymerase, 1 ng / μL of template plasmid, and DEPC water to make up the difference. After mixing all components, PCR amplification was performed. The PCR amplification product was purified using an agarose gel DNA recovery kit to obtain the dsDNA-2 transcription template.

[0112] Table 6 Primer sequences

[0113] name Sequence (5'-3') SEQ ID NO: upstream primer TAATACGACTCACTATAGGGGAATTGTGAGCGG 17 Downstream primer CAAAAAACCCCTCAAGACCCGTTTAGAGGC 18

[0114] (2) In vitro transcription reaction system

[0115] In a 40 μL reaction system, add 1 μM dsDNA-2 transcription template, 1× transcription reaction buffer, 1 μM mutant QM-F-M6, 2.5 mM rATP, 2.5 mM rGTP, 2.5 mM 2'-F-dCTP, and 2.5 mM 2'-F-dUTP, and finally bring the volume to 40 μL with DEPC water. After mixing, divide the mixture into two groups of 20 μL each, and incubate at 30℃ and 37℃ for 4 h respectively. After terminating the reaction at 70℃ for 10 min, add 0.25 U DNase I to each group to digest the template DNA. Add 3 μL of 6× DNA Loading buffer to each group, and then load 10 μL of the sample. Perform electrophoresis on a 1% agarose gel at room temperature. The results are shown below. Figure 3 As shown, the QM-F-M6 mutant demonstrates comparable, and even slightly superior, efficiency in the synthesis of chemically modified RNA molecules compared to the positive control. Therefore, the successful construction of the QM-F-M6 mutant provides a highly efficient new tool for the in vitro isothermal enzymatic synthesis of non-natural fluorinated RNA molecules. This breakthrough overcomes the limitations of existing T7 RNA polymerase mutants in synthesizing long-chain chemically modified molecules.

[0116] Example 4: Characterization of the transcriptional activity of T7 RNA polymerase mutants for perfluorinated DNA molecules.

[0117] In a 20 μL reaction system, add 1 μM dsDNA-2 transcription template, 1× transcription reaction buffer, 1 μM T7 RNA polymerase, and 2.5 mM 2'-F-dNTPs, and finally bring the volume to 20 μL with DEPC water. Mix well and incubate at 37°C for 4 h. After terminating the reaction by incubation at 70°C for 10 min, add 0.25 U DNase I to each group to digest the template DNA. Add 3 μL of 6× DNA Loading buffer to each group, and then load 10 μL of the sample. Perform electrophoresis on a 1% agarose gel at room temperature. The results are shown below. Figure 4 As shown.

[0118] Generally, incorporating more chemically modified nucleotide substrates at the C2' position leads to a significant decrease in catalytic efficiency. This is especially true when all nucleotides are chemically modified, where the synthesis efficiency often reaches its lowest point. However, the experimental results in this example demonstrate that the QM-F-M6 and QM-F-M6-YA mutants possess high perfluorinated DNA molecule synthesis capabilities.

[0119] Example 5: Characterization of the transcriptional activity of T7 RNA polymerase mutants on single-stranded DNA molecules

[0120] (1) As shown in Table 7, in a 20 μL reaction system, add 1 μM T7 RNA polymerase, 2.5 mM dNTPs, 1× transcription reaction buffer, and 600 nM double-stranded DNA transcription template, and finally add DEPC water to make up to 20 μL. After four hours of in vitro transcription, incubate at 80℃ for 20 min to terminate the reaction. Then add 10 μM ThT dye and K to the reaction solution. + (Final concentrations were 1 mM, 10 mM, 20 mM, 50 mM, 80 mM, and 100 mM, respectively), and the fluorescence spectrum was scanned using a microplate reader with an excitation wavelength of 429 nm. Results are as follows: Figure 5 As shown, the fluorescence signal increased with increasing potassium ion concentration, eventually plateauing at 80 mM. Once all aptamers had folded correctly and bound to the small molecule, increasing the potassium ion concentration did not lead to further aptamer folding and small molecule binding, thus the fluorescence signal reached a stable state. Furthermore, the mutant QM-F-M6 exhibited ten times greater efficiency in synthesizing DNA G-quadruplexes than the positive control (wild-type T7 RNA polymerase), demonstrating its superior performance under specific conditions.

[0121] Table 7 Formulation of Fluorescence Kinetics Reaction Solution

[0122] Components Added amount T7 RNA polymerase 1μM Double-stranded DNA template 500nM 5× Transcription Reaction Buffer 1× dNTPs 2.5mM ThT 10μM <![CDATA[K + ]]> 100mM DEPC water Add to 20μL

[0123] (2) The total volume of each reaction solution was set at 20 μL. The preparation process was to be carried out on ice. The reaction solution formula is shown in Table 8. Wild-type T7 RNA polymerase and rNTP substrate were added to the positive control group; the blank control group was the same as the positive control group except that no polymerase was added; different T7 RNA polymerase mutants and chemically modified substrates required for specific experiments were added to the experimental groups.

[0124] Table 8. Formula for in vitro transcription reaction solution

[0125] Components Final concentration or volume T7 RNA polymerase 1μM Double-stranded DNA template 500nM 5× Transcription Reaction Buffer 1× dNTPs 2.5mM DEPC water Add to 20μL

[0126] In vitro transcription: After vortexing and centrifuging the mixed reaction solution, incubate at 37°C for 4 hours. After transcription, incubate at 80°C for 20 minutes to inactivate the polymerase and terminate the reaction. Add 3 μL of 6×DNA Loading buffer to each group, and then load 10 μL of the sample. Perform electrophoresis on a 1% agarose gel at room temperature. The results are shown below. Figure 6 As shown, QM-F-M6 and QM-F-M6-S641A have the function of synthesizing DNA in vitro.

[0127] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A T7 RNA polymerase mutant, characterized in that, The T7 RNA polymerase mutant is the protein described below: Proteins derived from the wild-type T7 RNA polymerase with the amino acid sequence shown in SEQ ID NO: 1, with the following amino acid substitutions: P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; The amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO: 2; The T7 RNA polymerase mutant can be used to synthesize nucleic acid molecules with fluorine substitutions.

2. A T7 RNA polymerase mutant, characterized in that, The T7 RNA polymerase mutant is the protein described below: Proteins derived from the wild-type T7 RNA polymerase with the amino acid sequence shown in SEQ ID NO: 1, with the following amino acid substitutions: S43Y, G47A, P266L, S430P, N433T, S633P, Y639F, V689Q, V783M, F849I, F880Y; The amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO:

8.

3. A T7 RNA polymerase mutant, characterized in that, The T7 RNA polymerase mutant is the protein described below: Proteins derived from the wild-type T7 RNA polymerase with the amino acid sequence shown in SEQ ID NO: 1, with the following amino acid substitutions: P266L, S430P, N433T, S633P, Y639F, S641A, V689Q, V783M, F849I, F880Y; The amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO:

10.

4. A gene encoding a gene, characterized in that, The encoding gene encodes the T7 RNA polymerase mutant according to any one of claims 1-3.

5. A carrier, characterized in that, The vector contains the coding gene as described in claim 4.

6. The carrier according to claim 5, characterized in that, The vector is selected from one of the following groups: plasmid, bacteriophage, granule, artificial chromosome, plant cell virus, mammalian cell virus or retrovirus.

7. A host cell, characterized in that, The host cell expresses the T7 RNA polymerase mutant according to any one of claims 1-3, or contains the encoding gene according to claim 4, or contains the vector according to claim 5 or 6.

8. The method for preparing the T7 RNA polymerase mutant according to any one of claims 1-3, characterized in that, include: The host cell of claim 7 is made to express the T7 RNA polymerase mutant, and the T7 RNA polymerase mutant is isolated and purified.

9. The use of the T7 RNA polymerase mutant of claim 1 or 2 in the synthesis of nucleic acid molecules with fluorine substitution.

10. The application as described in claim 9, characterized in that, The nucleic acid molecule is either DNA or RNA.

11. The application as described in claim 9, characterized in that, The nucleic acid molecule is single-stranded.

12. A method for synthesizing nucleic acid molecules with fluorine substitution, characterized in that, include: A system comprising a template, a substrate, and the T7 RNA polymerase mutant of claim 1 or 2 is provided, wherein the fluorine-substituted nucleic acid molecule is synthesized by transcription under the catalysis of the T7 RNA polymerase mutant; wherein the substrate is selected from at least one of dNTPs, rNTPs, and 2'-F-dNTPs.

13. The method for synthesizing a nucleic acid molecule with fluorine substitution as described in claim 12, characterized in that, The transcription reaction conditions include incubation at 30-37°C.

14. The method for synthesizing a nucleic acid molecule with fluorine substitution as described in claim 12 or 13, characterized in that, The nucleic acid molecule is either DNA or RNA.

15. The method for synthesizing a fluorine-substituted nucleic acid molecule as described in claim 12 or 13, characterized in that, The nucleic acid molecule is single-stranded.

16. The method for synthesizing a nucleic acid molecule with fluorine substitution as described in claim 13, characterized in that, The incubation time is 2-6 hours.