Antiviral indolinyl compounds and uses thereof

Abstract

The present disclosure relates to indolinyl compounds. The disclosure further relates to compounds that inhibit the viral helicase-primer enzyme. The disclosure further relates to the use of a compound for the preparation of a medicament for the treatment of diseases and / or conditions by inhibition of the viral helicase-primer enzyme. The disclosure also relates to the use of those compounds for the treatment of viral infections. The present disclosure further relates to intermediates useful in the preparation thereof and pharmaceutical compositions containing those compounds.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 344,487, filed on May 20, 2022, which is incorporated herein in its entirety for all purposes.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted electronically in .XML file format, and the entire text is hereby incorporated by reference herein. The .XML copy was created on April 10, 2023, is named 1422-WO-PCT.xml and has a file size of 3,468 bytes. Background Art

[0006] Herpes viruses have a very high global prevalence and disease burden. Herpes viruses include herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), varicella zoster virus, Estein-Barr virus and cytomegalovirus. HSV-1 and HSV-2 are harmful human pathogens. HSV-1 is mainly transmitted by mouth-to-mouth contact to cause oral herpes, while HSV-2 is a sexually transmitted infection that causes genital herpes. These infections are lifelong and are characterized by periodic reactivation and viral shedding, which can cause symptoms such as painful blisters or ulcers and infect others. Most of the drugs currently available for treating these infections are based on nucleoside analogs, such as acyclovir, famciclovir, and valacyclovir. Although the severity and frequency of symptoms are effectively reduced, these compounds do not eliminate viral shedding and the risk of infection therefore. In addition, the dosage regimen is complicated and inappropriate.

[0007] Herpesvirus encodes its own helicase and primase for synthesizing viral DNA. The helicase-primase complex plays a key role in viral DNA replication. The helicase separates the viral DNA double helix, and the primase synthesizes RNA primers on single-stranded DNA, which initiate DNA synthesis guided by DNA polymerase (Kleymann G.2004).

[0008] New agents that are more effective and safer and have improved pharmacokinetics are needed. Inhibition of viral helicase-primase interferes with viral replication and thus allows the development of drugs with desired selectivity, potency, metabolic stability or reduced deleterious effects. Summary of the invention

[0009] The present disclosure relates to indolinyl compounds. The present disclosure also relates to compounds that inhibit viral helicase-primase. The present disclosure further relates to the use of compounds for treating and / or preventing diseases and / or conditions.

[0010] In one embodiment, provided herein is a compound of formula (I),

[0011]

[0012] or a pharmaceutically acceptable salt thereof, wherein

[0013] R 1 yes

[0014] R 2a , R 2b , and R 2c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, C 1-6 Haloalkoxy, or -SCF3;

[0015] R 3a and R 3b are independently H, halogen, C 1-6 Alkyl, or C 1-6 Haloalkyl;

[0016] or R 3a and R 3b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 3a and R 3b The cycloalkyl group formed may be optionally substituted by one to three Z 3 replace;

[0017] X a and X b Each independently is O or CR 7a R 7b ;

[0018] R 7a and R 7b Each independently is H, C 1-6 Alkyl, or C 1-6 Haloalkyl;

[0019] or R 7a and R 7b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a and R 7b The C 3-6The cycloalkyl group may optionally be substituted by one to three Z 7 replace;

[0020] R 4a , R 4b , and R 4c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, -SCF3, or optionally through Z 4 Substituted C 3-6 Cycloalkyl;

[0021] R 5 It is C 6-10 Aryl or heteroaryl; wherein R 5 The aryl or heteroaryl group may be optionally substituted by one to three Z groups which may be the same or different. 5 Replacement; R 5 The heteroaryl is a 5- to 10-membered heteroaryl having one to three heteroatoms each independently being N, O, or S;

[0022] R 6 It is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-8 Alkoxyalkyl, or C 3-6 Cycloalkyl, where R 6 The cycloalkyl group of 6 replace; and

[0023] Each Z 3 , Z 4 , Z 5 , Z 6 , and Z 7 are independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, or C 1-6 Haloalkoxy.

[0024] In some embodiments, provided herein is a pharmaceutical composition comprising a compound provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a compound provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier.

[0025] In some embodiments, the pharmaceutical compositions provided herein further comprise one or more (e.g., one, two, three, four, one or two, one to three, or one to four) additional therapeutic agents or pharmaceutically acceptable salts thereof. In some embodiments, the pharmaceutical compositions further comprise a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) additional therapeutic agents or pharmaceutically acceptable salts thereof.

[0026] In some embodiments, the present disclosure provides a method of inhibiting herpes virus helicase-primase in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound provided herein (e.g., a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf)), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition provided herein.

[0027] In some embodiments, the present disclosure provides a method of treating a patient suffering from a herpes virus-mediated condition, comprising administering to the patient a therapeutically effective amount of a compound provided herein (e.g., a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf)), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition provided herein. DETAILED DESCRIPTION

[0028] The present disclosure relates to compounds that inhibit herpes virus helicase primase. In one embodiment, the present disclosure relates to indolinyl compounds. The present disclosure further relates to the use of compounds for treating and / or preventing diseases and / or conditions by the compounds. The present disclosure also relates to compositions and methods for treating and / or preventing viral infections, the compositions and methods comprising a combination of a herpes virus helicase primase inhibitor and one or more additional therapeutic agents. The present disclosure also relates to compositions and methods for treating and / or preventing viral infections, the compositions and methods comprising a combination of a herpes virus helicase primase inhibitor and one or more additional therapeutic agents.

[0029] Patients infected with herpes viruses may benefit from treatment with a herpes virus helicase primase inhibitor and, optionally, one or more additional therapeutic agents.

[0030] Definition and general parameters

[0031] The following description is made with the understanding that the present disclosure is considered as an example of the subject matter requested, and is not intended to limit the appended claims to the specific embodiments described. The titles used throughout the present disclosure are provided for convenience and should not be interpreted as limiting the claims in any way. The embodiments described under any title may be combined with the embodiments described under any other title.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. It should be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "the compound" includes a plurality of such compounds and reference to "the assay" includes reference to one or more assays known to one of ordinary skill in the art and equivalents thereof, and so forth.

[0033] As used in this specification, the following words and phrases are generally intended to have the meanings set forth below, unless the context in which they are used indicates otherwise.

[0034] A dash ("-") that is not between two letters or symbols is used to indicate the point of attachment of a substituent. For example, -CONH2 is attached through a carbon atom. A dash before or at the end of a chemical group is for convenience; a chemical group may be depicted with or without one or more dashes without losing its usual meaning. A wavy line drawn through a line in a structure indicates the point of attachment of a group. Unless otherwise required chemically or structurally, the order in which chemical groups are written or named does not indicate or imply directionality. A solid line extending from the center of a ring indicates that the point of attachment of a substituent on the ring may be at any ring atom. For example, R in the following structure a Can be connected to any of the five carbon ring atoms or R a Can replace hydrogen attached to nitrogen ring atoms:

[0035]

[0036] For example, the prefix "C u-v " indicates that the group described below has u to v carbon atoms. For example, "C 1-6 "alkyl" indicates that the alkyl group has 1 to 6 carbon atoms. Similarly, the term "x- to y-membered" ring, where x and y are numerical ranges (e.g., "3- to 12-membered heterocyclyl"), refers to a ring containing x to y atoms (e.g., 3 to 12), of which up to 80% can be heteroatoms such as N, O, S, P, and the remaining atoms are carbon.

[0037] In addition, some commonly used alternative chemical names may or may not be used. For example, divalent groups such as divalent "alkyl", divalent "aryl", etc. may also be referred to as "alkylene / alkylenyl / alkylyl", "arylene / arylenyl / arylyl", etc., respectively.

[0038] "A compound disclosed herein" or "a compound of the present disclosure" or "a compound provided herein" or "a compound described herein" refers to a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf). Also included are specific compounds provided herein.

[0039] References herein to "about" values ​​or parameters include (and describe) embodiments for the values ​​or parameters themselves. In certain embodiments, the term "about" includes an indication of ±10%. In other embodiments, the term "about" includes an indication of ±5%. In certain other embodiments, the term "about" includes an indication of ±1%. In addition, the term "about X" includes a description of "X". In addition, the singular forms "a" and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "the compound" includes a plurality of such compounds, and reference to "the assay" includes reference to one or more assays and their equivalents known to those of ordinary skill in the art.

[0040] "Alkyl" refers to an unbranched or branched saturated hydrocarbon chain. As used herein, an alkyl group has 1 to 20 carbon atoms (i.e., C 1-20 alkyl), or 1 to 8 carbon atoms (i.e. C 1-8 alkyl), 1 to 6 carbon atoms (i.e., C 1-6 alkyl), 1 to 4 carbon atoms (i.e. C 1-4 alkyl), or 1 to 3 carbon atoms (i.e. C 1-3 Alkyl). Examples of alkyl include methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, and 3-methylpentyl. When an alkyl residue having a specific number of carbons is named by a chemical name or determined by a molecular formula, isomers at all positions having that number of carbons are encompassed. Thus, for example, "butyl" includes n-butyl (i.e., -(CH2)3CH3), sec-butyl (i.e., -CH(CH3)CH2CH3), isobutyl (i.e., -CH2CH(CH3)2), and tert-butyl (i.e., -C(CH3)3); and "propyl" includes n-propyl (i.e., -(CH2)2CH3) and isopropyl (i.e., -CH(CH3)2).

[0041] "Alkenyl" refers to a group having at least one carbon-carbon double bond and having 2 to 20 carbon atoms (i.e., C 2-20 alkenyl), 2 to 8 carbon atoms (i.e., C 2-8 alkenyl), 2 to 6 carbon atoms (i.e., C 2-6 alkenyl), or 2 to 4 carbon atoms (i.e. C 2-4 Examples of the alkenyl group include ethenyl, propenyl, butadienyl (including 1,2-butadienyl and 1,3-butadienyl).

[0042] "Alkynyl" refers to a group having at least one carbon-carbon triple bond and having 2 to 20 carbon atoms (i.e., C 2-20 Alkynyl), 2 to 8 carbon atoms (i.e., C 2-8 Alkynyl), 2 to 6 carbon atoms (i.e., C 2-6 Alkynyl), or 2 to 4 carbon atoms (i.e. C 2-4 The term "alkynyl" also includes groups having one triple bond and one double bond.

[0043] "Acyl" refers to a group -C(=O)R, wherein R is hydrogen, alkyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted as defined herein. Examples of acyl include formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethyl-carbonyl, and benzoyl.

[0044] "Alkoxy" refers to an alkyl group with an oxygen atom connecting the alkyl group to the point of attachment: alkyl-O-. Like alkyl, alkoxy will have any suitable number of carbon atoms, for example C 16 Alkoxy groups include, for example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, 2-butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, hexyloxy, and the like. Alkoxy groups may be further substituted with various substituents described herein. Alkoxy groups may be substituted or unsubstituted.

[0045] "Alkoxyalkyl" refers to an alkoxy group attached to an alkyl group, which is attached to the rest of the compound. Alkoxyalkyl has any suitable number of carbon atoms, for example, 2 to 6 (C 2-6 alkoxyalkyl), 2 to 5 (C 2-5 alkoxyalkyl), 2 to 4 (C 2-4 alkoxyalkyl), or 2 to 3 (C 2-3Alkoxyalkyl). The carbon number refers to the total number of carbons in the alkoxy and alkyl groups. For example, in some embodiments, a C6 alkoxyalkyl group refers to an ethoxy group (C2 alkoxy group) connected to a butyl group (C4 alkyl group), and in other embodiments, a n-propoxy group (C3 alkoxy group) is connected to an isopropyl group (C3 alkyl group). Alkoxy and alkyl groups are as defined above, wherein the alkyl group is divalent, and may include, but are not limited to, methoxymethyl (CH3OCH2), methoxyethyl (CH3OCH2CH2), and others.

[0046] "Amino" refers to -NR y R z , where R y and R z are independently selected from the group consisting of hydrogen, alkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, or heterocyclyl; each of which may be optionally substituted.

[0047] As used herein, "aryl" refers to a single all-carbon aromatic ring or a polycyclic all-carbon ring system, wherein at least one ring is aromatic. For example, in some embodiments, the aryl has 6 to 20 carbon atoms, 6 to 14 carbon atoms, or 6 to 12 carbon atoms. Aryl includes phenyl radicals. Aryl also includes polycyclic ring systems (e.g., ring systems comprising 2, 3, or 4 rings) having 9 to 20 carbon atoms (e.g., 9 to 16 carbon atoms), wherein at least one ring is aromatic, and wherein the other rings can be aromatic or non-aromatic (i.e., carbocyclic). Such polycyclic ring systems are optionally substituted with one or more (e.g., 1, 2, or 3) oxo groups on any carbocyclic portion of the polycyclic ring system. When valence requirements permit, the rings of the polycyclic ring system can be connected to each other via fusion, spiro, and bridging bonds. It is also understood that when referring to an aryl of a certain atomic range (e.g., a 6 to 10-membered aryl), the atomic range is for all ring atoms of the aryl. For example, a 6-membered aryl group would include phenyl, while a 10-membered aryl group would include naphthyl and 1,2,3,4-tetrahydronaphthyl. Non-limiting examples of aryl groups include, but are not limited to, phenyl, indenyl, naphthyl, 1,2,3,4-tetrahydronaphthyl, anthracenyl, and the like.

[0048] "Cyano" or "carbonitrile" refers to the group CN.

[0049] "Cycloalkyl" refers to a saturated or partially saturated cyclic alkyl group having a single ring or multiple rings, including fused, bridged, and spiro ring systems. The term "cycloalkyl" includes cycloalkenyl groups (i.e., cyclic groups having at least one double bond). As used herein, a cycloalkyl group has 3 to 20 ring carbon atoms (i.e., C 3-20 Cycloalkyl), 3 to 12 ring carbon atoms (i.e., C 3-12Cycloalkyl), 3 to 10 ring carbon atoms (i.e. C 3-10 Cycloalkyl), 3 to 8 ring carbon atoms (i.e. C 3-8 cycloalkyl), or 3 to 6 ring carbon atoms (i.e. C 3-6 Examples of the cycloalkyl group include cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.

[0050] "Fused" refers to a ring that is bound to an adjacent ring. In some embodiments, the fused ring system is a heterocyclyl. In some embodiments, the fused ring system is an oxabicyclohexyl. In some embodiments, the fused ring system is

[0051] "Bridged" refers to a ring fusion in which non-adjacent atoms on the ring are joined by a divalent substituent (e.g., an alkylene group, or an alkylene group containing one or two heteroatoms, or a single heteroatom). Quinuclidinyl and adamantyl are examples of bridged ring systems. In some embodiments, the bridged ring is a bicyclopentyl (e.g., bicyclo[1.1.1]pentyl), a bicycloheptyl (e.g., bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl), or a bicyclooctyl (e.g., bicyclo[2.2.2]octyl). In some embodiments, the bridged ring is a bicyclopentyl (e.g., bicyclo[1.1.1]pentyl), a bicycloheptyl (e.g., bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl), or a bicyclooctyl (e.g., bicyclo[2.2.2]octyl).

[0052] "Spiro" refers to a ring substituent joined by two bonds at the same carbon atom. Examples of spirogroups include 1,1-diethylcyclopentane, dimethyldioxolane, and 4-benzyl-4-methylpiperidine, wherein cyclopentane and piperidine are spiro substituents, respectively. In some embodiments, the spiro substituent is spiropentyl (spiro [ab] pentyl), spirohexyl, spiroheptyl, spirooctyl (e.g., spiro [2.5] octyl), spirononyl (e.g., spiro [3.5] nonyl), spirodecanyl (e.g., spiro [4.5] decyl), or spiroundecyl (e.g., spiro [5.5] undecyl). In some embodiments, the spiro substituent is

[0053] "Halogen" or "halo" includes fluoro, chloro, bromo, and iodo.

[0054] As used herein, "haloalkyl" refers to an alkyl group as defined herein, wherein one or more of the hydrogen atoms of the alkyl group are independently replaced by a halo substituent (which may be the same or different). 1-4 Haloalkyl is C 1-4 Alkyl, where C 1-4One or more hydrogen atoms of the alkyl group have been replaced by a halo substituent. Examples of haloalkyl groups include, but are not limited to, fluoromethyl, fluorochloromethyl, difluoromethyl, difluorochloromethyl, trifluoromethyl, 1,1,1-trifluoroethyl, and pentafluoroethyl.

[0055] "Haloalkoxy" refers to an alkoxy group in which some or all of the hydrogen atoms are replaced by halogen atoms. Like alkyl, haloalkoxy can have any suitable number of carbon atoms, for example, C 16 The alkoxy group may be substituted with 1, 2, 3, or more halogens. When all hydrogens are replaced with halogens, such as fluorine, the compound is fully substituted, such as perfluorinated. Haloalkoxy groups include, but are not limited to, trifluoromethoxy, 2,2,2, trifluoroethoxy, perfluoroethoxy, and the like.

[0056] As used herein, the term "heteroaryl" refers to a single aromatic ring or a polycyclic ring. The term includes a single aromatic ring having about 1 to 6 carbon atoms and about 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur in the ring. The sulfur and nitrogen atoms may also be present in oxidized form, provided that the ring is aromatic. Such rings include, but are not limited to, pyridyl, pyrimidinyl, oxazolyl, or furanyl. The term also includes polycyclic ring systems (e.g., ring systems containing 2 or 3 rings), wherein the heteroaryl as defined above may be fused with one or more heteroaryl groups (e.g., naphthyridinyl), carbocyclic rings (e.g., 5,6,7,8-tetrahydroquinolinyl), or aryl groups (e.g., indazolyl) to form a polycyclic ring. Such polycyclic rings may optionally be substituted with one or more (e.g., 1, 2, or 3) oxo groups on the carbocyclic portion of the polycyclic ring. It should be understood that the point of attachment of the heteroaryl polycyclic ring as defined above may be at any position of the ring, including the heteroaryl, aryl, or carbocyclic portion of the ring. Exemplary heteroaryl groups include, but are not limited to, pyridyl, pyrrolyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrazolyl, thienyl, indolyl, imidazolyl, oxazolyl, thiazolyl, furanyl, oxadiazolyl, thiadiazolyl, quinolyl, isoquinolyl, benzothiazolyl, benzoxazolyl, indazolyl, quinoxalyl, quinazolyl, 5,6,7,8-tetrahydroisoquinolylbenzofuranyl, benzimidazolyl, and thianaphthenyl.

[0057] As used herein, "heterocyclyl" or "heterocyclic ring" or "heterocycle" refers to a single saturated or partially unsaturated ring or a polycyclic ring. The term includes a single saturated or partially unsaturated ring (e.g., a 3-, 4-, 5-, 6-, or 7-membered ring) having about 1 to 6 carbon atoms and about 1 to 3 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur in the ring. The ring may be substituted with one or more (e.g., 1, 2, or 3) oxo groups, and the sulfur and nitrogen atoms may also be present in their oxidized forms. Such rings include, but are not limited to, azetyl, tetrahydrofuranyl, or piperidinyl. The term also includes polycyclic ring systems (e.g., ring systems containing 2 or 3 rings) in which a heterocyclic group (as defined above) may be attached to two adjacent atoms (fused heterocycles) with one or more heterocycles (e.g., decahydronaphthyridinyl), heteroaryl (e.g., 1,2,3,4-tetrahydronaphthyridinyl), carbocycles (e.g., decahydroquinolinyl), or aryl groups. It should be understood that the point of attachment of the heterocyclic polycyclic ring as defined above may be at any position of the ring, including the heterocyclic, heteroaryl, aryl, or carbocyclic portion of the ring. Exemplary heterocyclic rings include, but are not limited to, aziridinyl, azetyl, pyrrolidinyl, piperidinyl, homopiperidinyl, morpholinyl, thiolinyl, piperazinyl, tetrahydrofuranyl, dihydrooxazolyl, tetrahydropyranyl, tetrahydrothiopyranyl, 1,2,3,4-tetrahydroquinolinyl, benzoxazinyl, dihydrooxazolyl, chromanyl, 1,2-dihydropyridinyl, 2,3-dihydrobenzofuranyl, 1,3-benzodioxolyl, and 1,4-benzodioxanyl. Exemplary fused bicyclic heterocyclic rings include, but are not limited to

[0058]

[0059] "Hydroxy" or "hydroxyl" refers to the group -OH.

[0060] "Oxo" refers to the group (=O) or (O).

[0061] "Sulfonyl" refers to the group -S(O)2R c , where R c is an alkyl group, a heterocyclic group, a cycloalkyl group, a heteroaryl group, or an aryl group. Examples of the sulfonyl group are a methylsulfonyl group, an ethylsulfonyl group, a phenylsulfonyl group, and a toluenesulfonyl group.

[0062] Unless otherwise indicated, whenever a graphic representation of a group ends with a single bond to a nitrogen atom, the group represents an -NH2 group. Similarly, unless otherwise indicated, hydrogen atoms are implied and deemed to be present where necessary to complete the valence or provide stability, according to the knowledge of one of ordinary skill in the art.

[0063] The term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur. In addition, the term "optionally substituted" means that any one or more hydrogen atoms on the designated atom or group may or may not be replaced with a moiety other than hydrogen.

[0064] The term "substituted" means that any one or more hydrogen atoms on the specified atom or group are replaced by one or more substituents other than hydrogen, provided that the normal valence of the specified atom is not exceeded. The one or more substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, acyl, amino, amide, amidino, aryl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, guanidino, halo, haloalkyl, heteroalkyl, heteroaryl, heterocyclyl, hydroxyl, hydrazine, imino, oxo, nitro, alkylsulfinyl, sulfonic acid, alkylsulfonyl, thiocyanate, thiol, thione, or a combination thereof. Polymers or similar infinite structures obtained by defining substituents with infinitely additional other substituents (e.g., substituted aryl with substituted alkyl, the substituted alkyl itself substituted by substituted aryl, the substituted aryl further substituted by substituted heteroalkyl, etc.) are not intended to be included herein. Unless otherwise specified, the maximum number of consecutive substitutions in the compounds described herein is three. For example, a substituted aryl group substituted with two other substituted aryls in succession is limited to an aryl group substituted with [aryl group substituted with (substituted aryl)]. Similarly, the above definition is not intended to include disallowed substitution patterns (e.g., methyl groups substituted with 5 fluorines or heteroaryl groups with two adjacent oxygen ring atoms). Such disallowed substitution patterns are well known to those of ordinary skill in the art. When used to modify a chemical group, the term "substituted" may describe other chemical groups defined herein. For example, the term "substituted aryl" includes, but is not limited to, "alkylaryl". Unless otherwise specified, when a group is described as optionally substituted, any substituents of the group are themselves unsubstituted.

[0065] In some embodiments, the term "substituted alkyl" refers to an alkyl group having one or more substituents including hydroxy, halo, amino, alkoxy, cycloalkyl, heterocyclyl, aryl, and heteroaryl. In additional embodiments, "substituted cycloalkyl" refers to cycloalkyl having one or more substituents including alkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, amino, alkoxy, halo, oxo, and hydroxy; "substituted heterocyclyl" refers to heterocyclyl having one or more substituents including alkyl, amino, haloalkyl, heterocyclyl, cycloalkyl, aryl, heteroaryl, alkoxy, halo, oxo, and hydroxy; "substituted aryl" refers to aryl having one or more substituents including halo, alkyl, amino, haloalkyl, cycloalkyl, heterocyclyl, heteroaryl, alkoxy, and cyano; "substituted heteroaryl" refers to heteroaryl having one or more substituents including halo, amino, alkyl, haloalkyl, cycloalkyl, aryl, heterocyclyl, heteroaryl, alkoxy, and cyano, and "substituted sulfonyl" refers to heteroaryl having one or more substituents including halo, amino, alkyl, haloalkyl, cycloalkyl, aryl, heterocyclyl, heteroaryl, alkoxy, and cyano. "S(O)2R" refers to the group -S(O)2R, wherein R is substituted with one or more substituents including alkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl. In other embodiments, one or more substituents may be further substituted with halo, alkyl, haloalkyl, hydroxy, alkoxy, cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is substituted. In other embodiments, substituents may be further substituted with halo, alkyl, haloalkyl, alkoxy, hydroxy, cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is unsubstituted.

[0066] In some embodiments, substituted cycloalkyl, substituted heterocyclyl, substituted aryl, and / or substituted heteroaryl include cycloalkyl, heterocyclyl, aryl, and / or heteroaryl groups having substituents on the ring atoms that connect the cycloalkyl, heterocyclyl, aryl, and / or heteroaryl group to the rest of the compound. For example, in the following moiety, the cyclopropyl group is substituted with a methyl group:

[0067]

[0068] The disclosure exemplarily described herein may be suitably implemented in the absence of any element or elements, limitation or limitations not specifically disclosed herein. Thus, for example, the terms "comprising," "including," "containing," and the like should be interpreted broadly and without limitation. Furthermore, the terms and expressions employed herein are used as terms of description rather than limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the rights claimed in the present disclosure.

[0069] The compounds of the present disclosure may be in the form of pharmaceutically acceptable salts. The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids (including inorganic bases or acids and organic bases or acids). In the case where the compounds of the present disclosure contain one or more acidic or basic groups, the present disclosure also includes its corresponding pharmaceutically or toxicologically acceptable salts or its pharmaceutically available salts. Therefore, the compounds of the present disclosure containing acidic groups may be present on these groups and may be used according to the present disclosure as, for example, alkali metal salts, alkaline earth metal salts or ammonium salts. More precise examples of such salts include salts of sodium salts, potassium salts, calcium salts, magnesium salts, or ammonia or organic amines (e.g., ethylamine, ethanolamine, triethanolamine, amino acids, or other bases known to those of ordinary skill in the art). Compounds of the present disclosure containing one or more basic groups (i.e., protonated groups) may be present and may be used according to the present disclosure in the form of addition salts of inorganic or organic acids. Examples of suitable acids include hydrogen chloride, hydrogen bromide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, trimethylacetic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, maleic acid, malic acid, sulfamic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, and others known to those of ordinary skill in the art.

[0070] If the compounds of the present disclosure contain both acidic and basic groups in the molecule, then in addition to the salt forms mentioned, the present disclosure also includes inner salts or betaines (zwitterions). The respective salts can be obtained by conventional methods known to those skilled in the art, for example by contacting these with organic or inorganic acids or bases in solvents or dispersants, or by anion exchange or cation exchange with other salts.

[0071] The present disclosure also includes all salts of the compounds of the present disclosure which are not directly suitable for use as pharmaceuticals due to low physiological compatibility, but which can be used, for example, as intermediates in chemical reactions or for the preparation of pharmaceutically acceptable salts. Acids and bases that can be used to react with the base compound to form pharmaceutically acceptable salts (acid addition or base addition salts, respectively) are known to those of ordinary skill in the art. Similarly, methods for preparing pharmaceutically acceptable salts from the base compound (according to the disclosure) are known to those of ordinary skill in the art and are disclosed, for example, in Berge et al., Journal of Pharmaceutical Science, January 1977, Vol. 66, No. 1 and other sources.

[0072] In addition, the compounds disclosed herein may undergo tautomerism. When a compound or a prodrug thereof may undergo tautomerism (e.g., keto-enol tautomerism), the individual forms (such as, for example, keto and enol forms) and mixtures thereof in any ratio are within the scope of the present disclosure. The same applies to stereoisomers, such as, for example, enantiomers, cis / trans isomers, diastereomers, conformational isomers, etc.

[0073] The term "protecting group" refers to a portion of a compound that masks or alters the properties of a functional group or the properties of the compound as a whole. Chemical protecting groups and strategies for protecting / deprotecting groups are well known in the art (see, e.g., Protective Groups in Organic Chemistry, Theodora W. Greene, John Wiley & Sons, Inc., New York, 1991). Protecting groups are often used to mask the reactivity of certain functional groups to aid in the efficiency of a desired chemical reaction, e.g., to make and break chemical bonds in an orderly and planned manner. The term "deprotecting" refers to the removal of a protecting group.

[0074] One of ordinary skill in the art will understand that when a list of alternative substituents includes members that cannot be used to replace a particular group because of their valency requirements or other reasons, it is intended that the list be interpreted by one of ordinary skill in the art to include only those members of the list that are suitable for replacing the particular group.

[0075] In addition, the compounds of the present disclosure may exist in the form of solvates, for example these include solvate water, or pharmaceutically acceptable solvates such as alcohols, particularly ethanol. "Solvate" is formed by the interaction of a solvent and a compound.

[0076] In certain embodiments, optical isomers, racemates, or other mixtures thereof (e.g., non-racemic mixtures) or pharmaceutically acceptable salts or mixtures thereof of the compounds described herein are provided. If necessary, isomers can be separated by methods well known in the art (e.g., liquid chromatography). In these cases, single enantiomers or diastereomers (i.e., optically active forms) can be obtained by asymmetric synthesis or by splitting. Splitting can be accomplished, for example, by conventional methods, such as crystallization in the presence of a splitting agent, or chromatography using, for example, a chiral high pressure liquid chromatography (HPLC) column.

[0077] "Stereoisomer" refers to a compound composed of the same atoms bonded by the same bond but having different three-dimensional structures, and the compound is not interchangeable. The present invention contemplates various stereoisomers and mixtures thereof and includes "enantiomers", which refer to molecules of two stereoisomers that are non-superimposable mirror images of each other. "Diastereomers" are stereoisomers with at least two asymmetric atoms, but are not mirror images of each other. Unless otherwise indicated, this description is intended to include individual stereoisomers and mixtures. The determination method of stereochemistry and the separation method of stereoisomers are well known in the art (see, for example, Chapter 4 of Advanced Organic Chemistry, 4th edition, J. March, John Wiley and Sons, New York, 1992).

[0078] The compounds disclosed herein and their pharmaceutically acceptable salts may, in some embodiments, include one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms, which may be defined by absolute stereochemistry as (R)- or (S)-, or as (D)- or (L)- for amino acids. Some embodiments include all such possible isomers, as well as racemic, non-racemic, and optically pure forms thereof. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for preparing / isolating individual enantiomers include chiral synthesis or resolution of racemates (or racemates of salts or derivatives) from suitable optically pure precursors using, for example, chiral high-pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, unless otherwise specified, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included. When a compound is represented in its chiral form, it is understood that the embodiments encompass but are not limited to specific diastereoisomers or enantiomerically enriched forms. When chirality is not specified but exists, it is understood that the embodiments relate to specific diastereoisomers or enantiomerically enriched forms; or a racemic or non-eliminative mixture of such compound(s). As used herein, a "non-racemic mixture" is a mixture of stereoisomers in a ratio other than 1:1.

[0079] Compositions provided herein including compounds described herein or pharmaceutically acceptable salts, isomers, or mixtures thereof may include racemic mixtures, or mixtures containing an enantiomeric excess of one enantiomer or a single diastereomer or a diastereomeric mixture. All such isomeric forms of these compounds are expressly included herein, as if each and every isomeric form were specifically and individually listed.

[0080] Any formula or structure given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compound. An isotopically labeled compound has a structure depicted by a formula given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that may be incorporated into the compounds of the present disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as, but not limited to, 2 H (deuterium, D), 3 H (tritium), 11 C. 13 C. 14 C. 15 N.18 F. 31 P. 32 P. 35 S. 36 Cl, and 125 I. Various isotopically labeled compounds of the present disclosure, for example, compounds into which a radioactive isotope (e.g. 3 H. 13 C. and 14 C). Such isotopically labeled compounds can be used in metabolic studies, reaction kinetic studies, detection or imaging techniques (e.g., positron emission tomography (PET) or single photon emission computed tomography (SPECT)) including drug or substrate tissue distribution assays, or in radiotherapy of patients. Isotopically labeled compounds and prodrugs thereof disclosed herein can generally be prepared by carrying out the procedures disclosed in the following schemes or examples and preparations, and by substituting a readily available isotopically labeled reagent for a non-isotopically labeled reagent.

[0081] The present disclosure also includes "deuterated analogs" of compounds disclosed herein in which 1 to n hydrogens attached to carbon atoms are replaced by deuterium, wherein n is the number of hydrogens in the molecule. Such compounds may exhibit increased resistance to metabolism and are therefore useful for increasing the half-life of any compound of Formula (I) when administered to a mammal (e.g., a human). See, e.g., Foster, "Deuterium Isotope Effects in Studies of Drug Metabolism," Trends Pharmacol. Sci. 5(12): 524-527 (1984). Such compounds are synthesized by means well known in the art, such as by employing a starting material in which one or more hydrogens have been replaced by deuterium.

[0082] The deuterium-labeled or substituted therapeutic compounds of the present disclosure may have beneficial drug metabolism and pharmacokinetic (DMPK) properties, which are related to distribution, metabolism, and excretion (ADME). Substitution with heavier isotopes (e.g., deuterium) may provide certain therapeutic advantages due to greater metabolic stability, such as increased in vivo half-life, reduced dosage requirements, and / or improved therapeutic index. 18 F-labeled compounds can be used in PET or SPECT studies.

[0083] The concentration of this heavier isotope, specifically deuterium, can be defined by an isotopic enrichment factor. In the compounds of the present disclosure, any atom not specifically designated as a particular isotope is intended to represent any stable isotope of that atom. Unless otherwise stated, when a position is specifically designated as "H" or "hydrogen," that position is understood to have hydrogen at the natural abundance isotopic composition of hydrogen. Thus, in the compounds of the present disclosure, any atom specifically designated as deuterium (D) is intended to represent deuterium.

[0084] In addition, the present disclosure provides a pharmaceutical composition comprising a compound of the present disclosure, or a prodrug compound thereof, or a pharmaceutically acceptable salt or solvate thereof as an active ingredient and a pharmaceutically acceptable carrier.

[0085] "Pharmaceutical composition" refers to one or more active ingredients, and one or more inert ingredients constituting a carrier, as well as any product produced directly or indirectly by the combination, complexation, or aggregation of any two or more ingredients, or the dissociation of one or more ingredients, or other types of reactions or interactions of one or more ingredients. Therefore, the pharmaceutical composition of the present disclosure may encompass any composition made by mixing at least one compound of the present disclosure and a pharmaceutically acceptable carrier.

[0086] As used herein, "pharmaceutically acceptable carriers" include excipients or agents that are not harmful to the disclosed compounds or their uses, such as solvents, diluents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. The use of such carriers and agents for preparing compositions of pharmaceutically active substances is well known in the art (see, e.g., Remington's Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, PA, 17th edition (1985); and Modern Pharmaceutics, Marcel Dekker, Inc. 3rd edition (GS Banker and CT Rhodes, eds.).

[0087] "Treatment" or "treating" is a method for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results may include one or more of the following: a) inhibiting the disease or condition (e.g., reducing one or more symptoms caused by the disease or condition, and / or reducing the extent of the disease or condition); b) slowing or preventing the development of one or more clinical symptoms associated with the disease or condition (e.g., stabilizing the disease or condition, preventing or delaying the worsening or progression of the disease or condition, and / or preventing or delaying the spread of the disease or condition (e.g., metastasis)); and / or c) alleviating the disease, i.e., resolving clinical symptoms (e.g., improving the disease state, providing partial or total remission of the disease or condition, enhancing the effect of another drug, Delaying the progression of a disease, improving the quality of life, and / or prolonging survival. In some embodiments, the term "treatment" or "treating" means administering a compound or a pharmaceutically acceptable salt of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) for the following purposes: (i) delaying the onset of a disease, i.e., causing the clinical symptoms of the disease not to develop or delaying their development; (ii) inhibiting the disease, i.e., preventing the development of clinical symptoms; and / or (iii) alleviating the disease, i.e., causing the regression of clinical symptoms or their severity.

[0088] "Prevention" or "preventing" means any treatment of a disease or condition that results in clinical symptoms of the disease or condition not developing. In some embodiments, the compounds may be administered to a subject (including humans) who is at risk or has a family history of the disease or condition.

[0089] "Subject" refers to an animal, such as a mammal (including a human), that has been or will be the subject of treatment, observation, or experiment. The methods described herein can be used for human therapy and / or veterinary applications. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0090] The term "therapeutically effective amount" or "effective amount" of a compound described herein, or a pharmaceutically acceptable salt, tautomer, stereoisomer, mixture of stereoisomers, prodrug, or deuterated analog thereof means an amount sufficient to effectively treat to provide a therapeutic benefit (e.g., improve symptoms or slow disease progression) when administered to a subject. For example, a therapeutically effective amount can be an amount sufficient to reduce the symptoms of a disease or condition that is responsive to a herpes virus helicase-primase inhibitor. The therapeutically effective amount can vary depending on the subject and disease or condition being treated, the subject's weight and age, the severity of the disease or condition, and the mode of administration, which can be easily determined by those with ordinary knowledge in the art.

[0091] Compound

[0092] In one embodiment, the present disclosure provides a compound of formula (I),

[0093]

[0094] or a pharmaceutically acceptable salt thereof, wherein

[0095] R 1 yes

[0096] R 2a , R 2b , and R 2c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, C 1-6 Haloalkoxy, or -SCF3;

[0097] R 3a and R 3b are independently H, halogen, C 1-6 Alkyl, or C 1-6 Haloalkyl;

[0098] or R 3a and R 3b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 3a and R 3b The cycloalkyl group formed may be optionally substituted by one to three Z 3 replace;

[0099] X a and X b Each independently is O or CR 7a R7b ;

[0100] R 7a and R 7b Each independently is H, C 1-6 Alkyl, or C 1-6 Haloalkyl;

[0101] or R 7a and R 7b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a and R 7b The C 3-6 The cycloalkyl group may optionally be substituted by one to three Z 7 replace;

[0102] R 4a , R 4b , and R 4c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, -SCF3, or optionally through Z 4 Substituted C 3-6 Cycloalkyl;

[0103] R 5 It is C 6-10 Aryl or heteroaryl; wherein R 5 The aryl or heteroaryl group may be optionally substituted by one to three Z groups which may be the same or different. 5 Replacement; R 5 The heteroaryl is a 5- to 10-membered heteroaryl having one to three heteroatoms each independently being N, O, or S;

[0104] R 6 It is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-8 Alkoxyalkyl, or C 3-6 Cycloalkyl, where R 6 The cycloalkyl group of 6 replace; and

[0105] Each Z 3 , Z 4 , Z 5 , Z 6 , and Z 7 are independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, or C 1-6 Haloalkoxy.

[0106] In some embodiments, the compound of formula (I) is a compound of formula (IIa)

[0107]

[0108] or a pharmaceutically acceptable salt thereof.

[0109] In some embodiments, the compound of formula (I) is a compound of formula (IIb)

[0110]

[0111] or a pharmaceutically acceptable salt thereof.

[0112] In some embodiments, the compound of formula (I) is a compound of formula (IIc)

[0113]

[0114] or a pharmaceutically acceptable salt thereof.

[0115] In some embodiments, the compound of formula (I) is a compound of formula (IId):

[0116]

[0117] or a pharmaceutically acceptable salt thereof.

[0118] In some embodiments, the compound of formula (I) is a compound of formula (IIe), or a pharmaceutically acceptable salt thereof

[0119]

[0120] Where R 7a1 and R 7b1 Each independently is H, C 1-6 Alkyl, or C 1-6 Haloalkyl; or R 7a1 and R 7b1 Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a1 and R 7b1 The C 3-6 The cycloalkyl group may optionally be substituted by one to three Z 7 replace.

[0121] In some embodiments, the compound of formula (I) is a compound of formula (IIf), or a pharmaceutically acceptable salt thereof

[0122]

[0123] Where R7a1 and R 7b1 Each independently is H, C 1-6 Alkyl, or C 1-6 Haloalkyl; or R 7a1 and R 7b1 Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a1 and R 7b1 The C 3-6 The cycloalkyl group may optionally be substituted by one to three Z 7 replace.

[0124] In some embodiments, the compound is of Formula (IIe) or Formula (IIf).

[0125] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein yes

[0126] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 1 yes In some embodiments, R 1 yes

[0127] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 2a is H. In some embodiments, R 2a Is halogen or C 1-6 In some embodiments, R 2a is F, Cl, or Br. In some embodiments, R 2a is F. In some embodiments, R 2a It is C 1-3 In some embodiments, R 2a It's methyl.

[0128] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 2b is H. In some embodiments, R 2b Is halogen or C 1-6In some embodiments, R 2b is F, Cl, or Br. In some embodiments, R 2b is F. In some embodiments, R 2b It is C 1-3 In some embodiments, R 2b It's methyl.

[0129] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 2c is H. In some embodiments, R 2c Is halogen or C 1-6 In some embodiments, R 2c is F, Cl, or Br. In some embodiments, R 2c is F. In some embodiments, R 2c It is C 1-3 In some embodiments, R 2c It's methyl.

[0130] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 3a is H. In some embodiments, R 3a It is C 1-6 In some embodiments, R 3a It is C 1-3 In some embodiments, R 3a It's methyl.

[0131] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 3b is H. In some embodiments, wherein R 3b It is C 1-6 In some embodiments, R 3b It is C 1-3 In some embodiments, R 3b It's methyl.

[0132] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 3a and R 3b Together with the carbon to which they are attached, they form C3-6 In some embodiments, R 3a and R 3b Together with the carbon to which they are attached they form a cyclopropyl group.

[0133] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 4a is H. In some embodiments, R 4a is halogen. In some embodiments, R 4a is F, Cl, or Br. In some embodiments, R 4a It's F.

[0134] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 4b is H. In some embodiments, R 4b is halogen. In some embodiments, R 4b is F, Cl, or Br. In some embodiments, R 4b It's F.

[0135] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 4c is H. In some embodiments, R 4c is halogen. In some embodiments, R 4c is F, Cl, or Br. In some embodiments, R 4c It's F.

[0136] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 5 is optionally substituted by one to three Z which may be the same or different 5 Substituted C 6-10 Aryl, each Z 5 are independently halogen, -CN, C 1-6 Alkyl, or C 1-6 In some embodiments, R 5 is phenyl optionally substituted with one to three halo groups. 5 is phenyl optionally substituted with one to three F. In some embodiments, R 5 It is phenyl,

[0137] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 5 is optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl; in some embodiments, R 5 is a heteroaryl group selected from the group consisting of thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyrrolyl, pyrazolyl, triazolyl, pyridinyl, pyrazinyl, and pyrimidinyl; R 5 The heteroaryl group may optionally be substituted by one to three Z groups which may be the same or different. 5 In some embodiments, R 5 is optionally substituted by one to three Z which may be the same or different 5 In some embodiments, R 5 is optionally substituted by one to three Z which may be the same or different 5 In some embodiments, R 5 is triazolyl or pyrazolyl, wherein the triazolyl or pyrazolyl is each optionally substituted by one to three Z which may be the same or different 5 In some embodiments, R 5 is thiazolyl, isothiazolyl, oxazolyl, or isoxazolyl; R 5 The thiazolyl, isothiazolyl, oxazolyl and isoxazolyl groups are each optionally substituted by one to three Z groups which may be the same or different. 5 In some embodiments, each Z 5 are independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, or C 1-6 In some embodiments, each Z 5 are independently halogen, C 1-3 Alkyl, -CN, or -OCH 3。 In some embodiments, Z 5 It's F.

[0138] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 5 Is pyridyl, In some embodiments, R 5 In some embodiments, R 5 yes In some embodiments, R 5 yes In some embodiments, R 5 yes In some embodiments, R 5 yes

[0139] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 7a and R 7b Each independently is H or C 1-6 In some embodiments, R 7a is H. In some embodiments, R 7a It is C 1-3 In some embodiments, R 7a In some embodiments, R 7b is H. In some embodiments, R 7b Yes-C 1-3 In some embodiments, R 7b It's methyl.

[0140] In some embodiments, the compound of Formula (IIe) or (IIf) or a pharmaceutically acceptable salt thereof is a compound wherein R 7a and R 7b Each independently is H or C 1-6 In some embodiments, R 7a1 is H. In some embodiments, R 7a1 It is C 1-3 In some embodiments, R 7a1 In some embodiments, R 7b1 is H. In some embodiments, R 7b1 It is C 1-3 In some embodiments, R 7b1 It's methyl.

[0141] In some embodiments, the compound of formula (I) or a pharmaceutically acceptable salt thereof is a compound wherein X a and X b It's O.

[0142] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 6 is H. In some embodiments, R6 It is C 1-6 Alkyl or C 1-6 In some embodiments, R 6 It is C 1-3 Alkyl or C 1-3 In some embodiments, R 6 is -CH3 optionally substituted with 1 to 3 halo groups. In some embodiments, R 6 is -CH3, -CHF2, -CH2F, -CF3, -CHCl2, or -CH2Cl. In some embodiments, R 6 It is -CH3.

[0143] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl, and R 6 It is C 1-6 Alkyl or C 1-6 Haloalkyl.

[0144] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is selected from thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyrrolyl, pyrazolyl, triazolyl, pyridinyl, pyrazinyl, and pyrimidinyl, optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl, and R 6 It is C 1-3 Alkyl or C1-3 Haloalkyl.

[0145] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5 substituted pyridyl, and R 6 It is -CH3, -CHF2, -CH2F, -CF3, -CHCl2 or -CH2Cl.

[0146] In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is a compound wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 Is pyridyl, And R 6 is -CH3 optionally substituted by 1 to 3 halo groups.

[0147] In some embodiments, the compound is a compound of formula (IIe), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5substituted heteroaryl, and R 6 It is C 1-6 Alkyl or C 1-6 Haloalkyl.

[0148] In some embodiments, the compound is a compound of formula (IIe), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is selected from thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyrrolyl, pyrazolyl, triazolyl, pyridinyl, pyrazinyl, and pyrimidinyl, optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl, and R 6 It is C 1-3 Alkyl or C 1-3 Haloalkyl.

[0149] In some embodiments, the compound is a compound of formula (IIe), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5 substituted pyridyl, and R 6 It is -CH3, -CHF2, -CH2F, -CF3, -CHCl2, or -CH2Cl.

[0150] In some embodiments, the compound is a compound of formula (IIe), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively5 Is pyridyl, And R 6 is -CH3 optionally substituted by 1 to 3 halo groups.

[0151] In some embodiments, the compound is a compound of formula (IIf), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl, and R 6 It is C 1-6 Alkyl or C 1-6 Haloalkyl.

[0152] In some embodiments, the compound is a compound of formula (IIf), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c are each independently H or halogen, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 is selected from thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyrrolyl, pyrazolyl, triazolyl, pyridinyl, pyrazinyl, and pyrimidinyl, optionally substituted by one to three Z which may be the same or different 5 substituted heteroaryl, and R 6 It is C 1-3 Alkyl or C 1-3 Haloalkyl.

[0153] In some embodiments, the compound is a compound of formula (IIf), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4cH, R respectively 5 is optionally substituted by one to three Z which may be the same or different 5 substituted pyridyl, and R 6 It is -CH3, -CHF2, -CH2F, -CF3, -CHCl2, or -CH2Cl.

[0154] In some embodiments, the compound is a compound of formula (IIf), or a pharmaceutically acceptable salt thereof, wherein R 1 yes R 2a , R 2b , and R 2c Each independently is H or F, R 3a and R 3b H, R respectively 4a , R 4b , and R 4c H, R respectively 5 Is pyridyl, And R 6 is -CH3 optionally substituted by 1 to 3 halo groups.

[0155] In some embodiments, the present disclosure provides a compound selected from the group consisting of:

[0156]

[0157]

[0158]

[0159] and or a pharmaceutically acceptable salt thereof.

[0160] In some embodiments, the present disclosure provides a compound selected from the group consisting of:

[0161]

[0162]

[0163] and or a pharmaceutically acceptable salt thereof.

[0164] In some embodiments, the present disclosure provides a racemic mixture comprising a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides a racemic compound comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides a non-racemic mixture comprising a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides a non-racemic compound comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof.

[0165] Those skilled in the art will appreciate that the groups disclosed herein (e.g., R 1 ) can be combined with each of the remaining groups (e.g., R 2a , R 2b , R 2c , R 3a , R 3b Any other embodiment combination of the present invention (e.g., etc.) to produce the complete compound of formula (I) or any formula described herein, or a pharmaceutically acceptable salt, stereoisomer, mixture of stereoisomers, or tautomer thereof, each of which is considered to be within the scope of the present disclosure.

[0166] Compositions and kits

[0167] The compounds or pharmaceutically acceptable salts thereof provided herein are usually administered in the form of pharmaceutical compositions. Therefore, pharmaceutical compositions are also provided herein, which include one or more compounds or pharmaceutically acceptable salts, isomers, or mixtures thereof provided herein, and one or more pharmaceutically acceptable vehicles selected from carriers, adjuvants, and excipients. The compounds or pharmaceutically acceptable salts thereof provided herein may be the sole active ingredient or one of the active ingredients of the pharmaceutical composition. Suitable pharmaceutically acceptable vehicles may include, for example, inert solid diluents and fillers, diluents, including sterile aqueous solutions and various organic solvents, penetration enhancers, solubilizers, and adjuvants. Such compositions are prepared in a manner well known in the pharmaceutical field. See, for example, Remington's Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, Pa., 17th edition (1985); and Modern Pharmaceutics, Marcel Dekker, Inc. 3rd edition (GS Banker and CT Rhodes, ed.).

[0168] In one aspect, provided herein is a pharmaceutical composition comprising a compound provided herein (i.e., a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf)) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a compound provided herein or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier.

[0169] In some embodiments, the pharmaceutical compositions provided herein further comprise one or more (i.e., one, two, three, four; one or two; one to three; or one to four) additional therapeutic agents or pharmaceutically acceptable salts thereof. In some embodiments, the pharmaceutical compositions further comprise a therapeutically effective amount of one or more (i.e., one, two, three, four; one or two; one to three; or one to four) additional therapeutic agents or pharmaceutically acceptable salts thereof.In some embodiments, one of the plurality of therapeutic agents is selected from complementary receptor 2 antagonists; Duffy antigen chemokine receptor modulators; envelope glycoprotein GP350 modulators; glucocorticoid receptor agonists; helicase inhibitors; helicase-primase inhibitors; HIV gp160 protein inhibitors; HIVgp41 protein inhibitors; HIV-1 reverse transcriptase inhibitors; HLA class I antigen A-2α modulators; HLA class I antigen A-24α modulators; human cytomegalovirus glycoprotein B modulators; human cytomegalovirus glycoprotein H modulators; human cytomegalovirus glycoprotein inhibitors; human cytomegalovirus glycoprotein L modulators; immunoglobulin G agonists; interferon alpha 2 ligands; interferon gamma receptor antagonists; latent membrane protein 1 modulators; latent membrane protein 2 modulators ; Latent membrane protein 2 stimulator; Progesterone receptor agonist; Secretory protein BARF1 modulator; Serine threonine protein kinase UL97 modulator; T cell surface glycoprotein CD8 stimulator; Thymidine kinase inhibitor; Trans-acting transcription protein ICP4 modulator; Transferase inhibitor; Non-specific gene inhibitor; Adenosine homocysteinease inhibitor; Basigin inhibitor; Basigin modulator; CCR5 chemokine modulator; CD4 agonist; CD4 modulator; CD89 agonist; CMV 65kDa matrix phosphoprotein modulators; CRISPR-associated endonuclease Cas9 modulators; cyclin-dependent kinase inhibitors; cyclin-dependent kinase inhibitors; cyclin-dependent kinase 9 inhibitors; DNA polymerase inhibitors; DNA primase inhibitors; endonuclease modulators; Estein-Barr nuclear antigen 1 inhibitors; Estein-Barr nuclear antigen 1 modulators; Estein-Barr nuclear antigen 1 stimulators; fatty acid synthase inhibitors; herpes virus envelope glycoprotein B stimulators; herpes virus envelope glycoprotein D inhibitors; herpes virus envelope glycoprotein D modulators; HIV gp120 protein inhibitors; HLA class I antigen A-11α modulators; Hsp 90 inhibitors; human cytomegalovirus glycoprotein B inhibitors; human cytomegalovirus glycoprotein B modulators; human cytomegalovirus glycoprotein inhibitors; hyaluronidase inhibitors; immunoglobulin agonists; interferon α1 ligands; interferon α2 ligands; interferon α ligand inhibitors; interferon α ligand modulators; interferon β ligands; large terminase protein inhibitors; LAT gene inhibitors; NAD-dependent deacetylase longevity protein (sirtuin) modulators; nicotinic acetylcholine receptor antagonists; NKG2D ligand modulators; nucleotidyl transferase inhibitors; protein Jumonji inhibitors; ribonuclease stimulators; serine threonine protein kinase UL97 inhibitors; syntaxin 5 inhibitors; TAT protein modulators; T cell surface glycoprotein CD8 stimulators; TLR-4 agonists; and viral ribonucleotide reductase inhibitors.In some embodiments, one of the plurality of therapeutic agents is selected from famciclovir, acyclovir, and valacyclovir.

[0170] In some embodiments, provided herein are pharmaceutical compositions comprising a therapeutically effective amount of a compound provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0171] The pharmaceutical composition can be administered in a single dose or multiple doses. The pharmaceutical composition can be administered by various methods, including, for example, rectal, buccal, intranasal, and transdermal routes. In certain embodiments, the pharmaceutical composition can be administered by intra-arterial injection, intravenous, intraperitoneal, parenteral, intramuscular, subcutaneous, oral, topical, or as an inhalant.

[0172] One mode of administration is parenteral, such as by injection. Forms that can be incorporated into the pharmaceutical compositions described herein for administration by injection include, for example, aqueous or oily suspensions, or emulsions with sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or sterile aqueous solutions, and similar pharmaceutical vehicles. In some embodiments, the compounds disclosed herein or pharmaceutically acceptable salts thereof and the pharmaceutical compositions disclosed herein are administered by subcutaneous injection.

[0173] The pharmaceutical composition of the present disclosure may be in the form of a sterile injectable preparation, such as a sterile injectable aqueous or oily suspension. This suspension may be formulated using suitable dispersants or wetting agents and suspending agents as mentioned herein according to known techniques. The sterile injectable preparation may also be a sterile injectable solution or suspension in a parenterally acceptable non-toxic diluent or solvent (e.g., a solution in 1,3-butanediol) or prepared as a lyophilized powder. Acceptable vehicles and solvents that may be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, conventionally sterile fixed oils may be used as solvents or suspension media. For this purpose, any mild fixed oil may be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids (e.g., oleic acid) may be used in the same manner to prepare injectables.

[0174] In some embodiments, the sterile injectable preparation disclosed herein can also be a sterile injectable solution or suspension prepared from a lyophilized powder dissolved in a non-toxic diluent or solvent acceptable to the parenteral, such as a solution in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils can be used as solvents or suspension media conventionally. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids (such as oleic acid) can be used to prepare injectables in the same manner.

[0175] Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, and solutes that make the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents. In certain embodiments, the suspension is a microsuspension. In certain embodiments, the suspension is a nanosuspension.

[0176] In some embodiments, formulations suitable for parenteral administration (e.g., intramuscular (Im) and subcutaneous (SC) administration) will include one or more excipients. The excipient should be compatible with the other ingredients of the formulation and harmless to the recipient thereof. Examples of suitable excipients are well known to those with ordinary knowledge in the art of parenteral formulations and can be found, for example, in Handbook of Pharmaceutical Excipients (Rowe, Sheskey and Quinn, eds.), 6th edition, 2009. Examples of solubilizing excipients in parenteral formulations (e.g., SC or IM formulations) include, but are not limited to, polysorbates (e.g., polysorbate 20 or 80) and poloxamer (e.g., poloxamer 338, 188, or 207). In some embodiments, the compounds disclosed herein or pharmaceutically acceptable salts thereof and the pharmaceutical compositions disclosed herein are administered with an implant.

[0177] Oral administration can be another way to administer the compound provided herein or its pharmaceutically acceptable salt. Administration can be via, for example, capsules or enteric coated tablets. When manufacturing a pharmaceutical composition comprising at least one compound provided herein or its pharmaceutically acceptable salt, isomer, or mixture, the active ingredient (e.g., compound provided herein) is usually diluted by an excipient and / or encapsulated in such a carrier in the form of a capsule, sachet, paper, or other container. When an excipient is used as a diluent, it can be in the form of a solid, semisolid, or liquid material, which acts as a vehicle, carrier, or medium for the active ingredient. Therefore, the pharmaceutical composition can be in the following forms: tablets, pills, powders, lozenges, capsules, cachets, elixirs, suspensions, emulsifiers, solutions, syrups, aerosols (as solids or in liquid media), ointments containing, for example, up to 10% by weight of an active compound, soft and hard gelatin capsules, sterile injectable solutions, and sterile packaged powders.

[0178] Some examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose, or any combination thereof. The pharmaceutical composition may additionally include lubricants such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifiers and suspending agents; preservatives such as methyl and propylhydroxy-benzoates; sweeteners; and flavoring agents; or any combination thereof.

[0179] Pharmaceutical compositions comprising at least one compound described herein or a pharmaceutically acceptable salt, isomer, or mixture thereof can be formulated to provide rapid, sustained, or delayed release of active ingredients (e.g., compounds provided herein) after administration to a subject by using procedures known in the art. Controlled release drug delivery systems for oral administration include osmotic pump systems and elution systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Examples of controlled release systems are given in the following: U.S. Patent Nos. 3,845,770; 4,326,525; 4,902,514; and 5,616,345. Another formulation used in the methods of the present disclosure uses a transdermal delivery device ("patch"). Such transdermal patches can be used to provide continuous or discontinuous infusions of compounds provided herein in controlled amounts. The construction and use of transdermal patches for delivering medicaments are well known in the art. See, eg, US Patent Nos. 5,023,252; 4,992,445; and 5,001,139. ​​Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.

[0180] To prepare solid compositions (e.g., tablets), the principal active ingredient may be mixed with a pharmaceutical excipient to form a solid preformulated composition containing a homogeneous mixture of a compound described herein or a pharmaceutically acceptable salt, isomer, or mixture thereof. When referring to these preformulated compositions as homogeneous, the active ingredient is dispersed evenly throughout the composition so that the composition can be readily subdivided into equally effective unit dosage forms, such as tablets, pills, and capsules.

[0181] The tablet or pill of the compound or its pharmaceutically acceptable salt provided herein can be coated or otherwise mixed to provide a dosage form with the advantage of prolonged effect or to protect it from gastric acid conditions. For example, a tablet or pill may include an inner dose and an outer dose component, the latter being in the form of an envelope covering the former. These two components may be separated by an enteric layer, which is used to resist disintegration in the stomach and allows the inner component to pass completely into the duodenum or delay release. Various materials may be used for such enteric layers or enteric coatings, such materials including a mixture of several polymeric acids and polymeric acids with materials such as shellac, cetyl alcohol, and cellulose acetate.

[0182] Pharmaceutical compositions for inhalation or insufflation may include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents, or mixtures thereof, and powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. In some embodiments, the composition is administered by oral or nasal respiratory route to achieve local or systemic effects. In other embodiments, the composition in a pharmaceutically acceptable solvent may be atomized by the use of an inert gas. The atomized solution may be inhaled directly from the atomizing device, or the atomizing device may be connected to a mask curtain, or an intermittent positive pressure respirator. Solutions, suspensions, or powder compositions may be administered from a device that delivers the formulation in an appropriate manner, preferably orally or nasally.

[0183] In one embodiment, provided herein is a kit comprising a compound provided herein (i.e., a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf)) or a pharmaceutically acceptable salt, stereoisomer, prodrug, or solvate thereof, and suitable packaging. In some embodiments, the kit further comprises instructions for use. In some embodiments, the kit comprises a compound provided herein (i.e., a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf)) or a pharmaceutically acceptable salt, stereoisomer, prodrug, or solvate thereof, and a label and / or instructions for use of the compound in the treatment of an indication (including a disease or condition described herein).

[0184] In some embodiments, the kit further comprises one or more (ie, one, two, three, four; one or two; one to three; or one to four) additional therapeutic agents or pharmaceutically acceptable salts thereof.

[0185] In one embodiment, provided herein is an article of manufacture comprising a compound described herein or a pharmaceutically acceptable salt, isomer, or mixture thereof in a suitable container. In some embodiments, the container can be a vial, a jar, an ampoule, a preloaded syringe, or an intravenous bag.

[0186] method

[0187] The methods provided herein can be applied to cell colonies in vivo or in vitro. "In vivo" means in a living individual, such as in an animal or human. In this case, the methods provided herein can be used therapeutically in an individual. "Ex vivo" means outside a living individual. Examples of ex vivo cell colonies include in vitro cell culture and biological samples, including body fluids or tissue samples obtained from an individual. Such samples can be obtained by methods well known in the art. Exemplary biological fluid samples include blood, cerebrospinal fluid, urine, and saliva. Exemplary tissue samples include tumors and biopsies thereof. In this case, the present disclosure can be used for various purposes, including therapeutic and experimental purposes. For example, the present disclosure can be used in vitro to determine the most preferred scheduling and / or administration of compounds as disclosed herein for a given cell type, individual, and other parameters. Information collected from such use can be used for experimental purposes or in clinics to be set up in vivo treatment plans. Other ex vivo uses to which the present disclosure can be applied are described below or will become apparent to those with ordinary knowledge in the art. The selected compounds can be further characterized to examine safety or tolerable doses in human or non-human subjects. Such properties can be tested using routine methods known to those of ordinary skill in the art.

[0188] In one embodiment, the present disclosure provides a method of treating or preventing herpes virus infection in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound provided herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition provided herein.

[0189] In some embodiments, the methods provided herein further comprise administering a therapeutically effective amount of one, two, three, or four additional therapeutic agents or pharmaceutically acceptable salts thereof.

[0190] The disclosure further relates to the compounds disclosed herein for use in treating and / or preventing diseases and / or conditions by inhibiting herpes virus helicase primase by the compounds. In addition, the disclosure relates to the use of a compound disclosed herein for the preparation of a medicament for treating and / or preventing herpes virus-related diseases and / or conditions by inhibiting herpes virus helicase primase by the compounds. In certain embodiments, herpes virus-related diseases or conditions are alleviated by inhibiting herpes virus helicase primase. In certain embodiments, the disclosure relates to the use of a compound disclosed herein for the preparation of a medicament for treating and / or preventing HSV-1 or HSV-2 related diseases and / or conditions by inhibiting herpes virus helicase primase by the compounds.

[0191] The medicaments as referred to herein can be prepared by conventional procedures comprising combining a compound according to the present disclosure and a pharmaceutically acceptable carrier.

[0192] In some embodiments, provided herein is a method of inhibiting a herpes virus helicase primase, comprising administering to a patient in need thereof (e.g., a patient suffering from a herpes virus-related disease or condition) a therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, or a composition comprising a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof.

[0193] In some embodiments, provided herein is a method of inhibiting HSV-1 or HSV-2 helicase primase, comprising administering to a patient in need thereof (e.g., a patient suffering from a disease or condition associated with HSV-1 or HSV-2) a therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, or a composition comprising a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof. In some embodiments, provided herein is a method of inhibiting HSV-1 or HSV-2 helicase primase, comprising administering to a patient in need thereof (e.g., a patient suffering from a disease or condition associated with HSV-1 or HSV-2) a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, or a composition comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof.

[0194] In some embodiments, provided herein is a method of reducing viral proliferation, comprising contacting the virus with a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, and inhibiting the helicase primase in the virus. In some embodiments, provided herein is a method of reducing herpes virus proliferation, comprising contacting the virus with a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, and inhibiting the helicase primase in the virus. In some embodiments, provided herein is a method of reducing HSV-1 or HSV-2 proliferation, comprising contacting the virus with a compound or a pharmaceutically acceptable salt disclosed herein, and inhibiting the helicase primase in the virus.

[0195] In some embodiments, provided herein is a method for treating a condition induced, aggravated or accelerated by herpes virus, comprising administering to a patient (to a patient in need thereof) a therapeutically effective amount of a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, or a composition comprising a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof. In some embodiments, provided herein is a method for treating a condition induced, aggravated or accelerated by HSV-1 or HSV-2, comprising administering to a patient (to a patient in need thereof) a therapeutically effective amount of a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, or a composition comprising a compound of formula (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof. In some embodiments, the condition is genital herpes, cold sores, HSV keratitis, HSV encephalitis, or disseminated HSV. In some embodiments, the condition is genital herpes.

[0196] In some embodiments, provided herein is a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in treating viral infections. In some embodiments, provided herein is a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in treating viral infections caused by herpes viruses. In some embodiments, provided herein is a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in treating viral infections caused by HSV-1 or HSV-2.

[0197] In some embodiments, provided herein is a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in the preparation of a medicament for preventing / treating viral infection. In some embodiments, provided herein is a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in the preparation of a medicament for preventing / treating viral infection caused by herpes virus. In some embodiments, provided herein is a compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for use in the preparation of a medicament for preventing / treating viral infection caused by HSV-1 or HSV-2.

[0198] In some embodiments, provided herein are compounds of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or pharmaceutically acceptable salts thereof, for use in therapy. In some embodiments, provided herein are compounds of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or pharmaceutically acceptable salts thereof, for use in methods of treating viral infections caused by HSV-1 or HSV-2.

[0199] Application

[0200] The compounds of the present disclosure or their pharmaceutically acceptable salts (also referred to herein as active ingredients) can be administered by any route applicable to the condition to be treated. Suitable routes include oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal, and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal, and epidural), etc. It will be understood that the preferred route may vary with, for example, the condition of the recipient. The advantages of certain compounds disclosed herein or their pharmaceutically acceptable salts are that they are orally bioavailable and can be administered orally.

[0201] The compounds of the present disclosure, or pharmaceutically acceptable salts thereof, can be administered to an individual for a desired period of time or duration according to an effective dosing regimen, such as at least about one day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about one week, at least about 2 weeks, at least about 3 weeks, at least about one month, at least about 2 months, at least about 3 months, at least about 6 months, or at least about 12 months or longer. In some embodiments, the compound or pharmaceutically acceptable salt thereof is administered on a daily or intermittent schedule during the life of the individual.

[0202] The specific dosage level of the compound of the present disclosure or its pharmaceutically acceptable salt for any particular object will depend on various factors, including the activity of the specific compound adopted, age, body weight, overall health, sex, diet, administration time, administration route, and excretion rate, drug combination, and the severity of the specific disease in the object receiving therapy. For example, the dosage can be expressed as milligrams (mg / kg) of the compound provided herein or its pharmaceutically acceptable salt per kilogram of object body weight. A dosage between about 0.1 and 150 mg / kg may be appropriate. In some embodiments, about 0.1 and 100 mg / kg may be appropriate. In other embodiments, a dosage between 0.5 and 60 mg / kg may be appropriate. When adjusting the dosage between objects with a wide range of size differences, it is particularly useful to standardize according to the object weight, such as when using drugs in both children and adult humans, or when converting the effective dose in a non-human object (e.g., dog) into a dosage suitable for a human object.

[0203] The dose may also be described as the total amount of a compound described herein or a pharmaceutically acceptable salt thereof administered per dose. The dose or administration frequency of a compound of the present disclosure or a pharmaceutically acceptable salt thereof may be adjusted during the course of treatment based on the judgment of the administering physician.

[0204] The compounds of the present disclosure or their pharmaceutically acceptable salts can be administered to an individual (e.g., human) in a therapeutically effective amount. In some embodiments, the compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or its pharmaceutically acceptable salt is administered once a day, once a week, once a month, once every two months, once every three months, or once every six months. In some embodiments, the compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or its pharmaceutically acceptable salt is administered once a day. In some embodiments, the compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or its pharmaceutically acceptable salt is administered once a week. In some embodiments, the compound of formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or its pharmaceutically acceptable salt is administered once a month. In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or a pharmaceutically acceptable salt thereof is administered once every two months. In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or a pharmaceutically acceptable salt thereof is administered once every three months. In some embodiments, the compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) or a pharmaceutically acceptable salt thereof is administered once every six months.

[0205] The compound or its pharmaceutically acceptable salt provided herein can be administered by any available route and means, for example, administered orally or parenterally (for example, intravenously). The therapeutically effective amount of the compound or its pharmaceutically acceptable salt may include about 0.00001 mg / kg body weight to about 10 mg / kg body weight per day, for example about 0.0001 mg / kg body weight to about 10 mg / kg body weight per day, or for example about 0.001 mg / kg body weight to about 1 mg / kg body weight per day, or for example about 0.01 mg / kg body weight to about 1 mg / kg body weight per day, or for example about 0.05 mg / kg body weight to about 0.5 mg / kg body weight per day. In some embodiments, the therapeutically effective amount of the compound or its pharmaceutically acceptable salt provided herein includes about 30 μg to about 300 μg per day, about 0.3 mg to about 30 mg per day, or about 30 mg to about 300 mg per day, or about 300 mg to about 1000 mg per day.

[0206] The compounds of the present disclosure or their pharmaceutically acceptable salts may be combined with one or more additional therapeutic agents at any dose of the compounds of the present disclosure or their pharmaceutically acceptable salts (e.g., 1 mg to 1000 mg of the compound). A therapeutically effective amount may include about 0.1 mg per dose to about 1000 mg per dose, such as about 50 mg per dose to about 500 mg per dose, or such as about 100 mg per dose to about 400 mg per dose, or such as about 150 mg per dose to about 350 mg per dose, or such as about 200 mg per dose to about 300 mg per dose, or such as about 0.01 mg per dose to about 1000 mg per dose, or such as about 0.01 mg per dose to about 100 mg per dose, or such as about 0.1 mg per dose to about 100 mg per dose, or such as about 1 mg per dose to about 100 mg per dose, or such as about 1 mg per dose to about 10 mg per dose, or such as about 1 mg per dose to about 1000 mg per dose. Other therapeutically effective amounts of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, are about 50, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mg per dose. Other therapeutically effective amounts of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, are about 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, or about 1000 mg per dose.

[0207] In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 1000 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 900 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 800 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 700 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 600 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 500 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 400 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 300 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 200 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 100 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 75 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 50 mg.In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 25 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 20 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 15 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is from about 1 mg to about 10 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 1 mg to about 5 mg.

[0208] In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 275 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, or about 1050 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 5 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 100 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 150 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 200 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 250 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 300 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 350 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 400 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 450 mg.In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 500 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 550 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 600 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 650 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 700 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 750 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 800 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 850 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 900 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 950 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 1000 mg. In some embodiments, the therapeutically effective amount of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, is about 1050 mg.When administered orally, the total weekly dose for a human subject may be between about 1 mg and 1,000 mg / week, between about 10 to 500 mg / week, between about 50 to 300 mg / week, between about 75 to 200 mg / week, or between about 100 to 150 mg / week. In some embodiments, the total weekly dose for a human subject may be about 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mg / week administered in a single dose. In some embodiments, the total weekly dose for a human subject of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, may be about 100 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 150 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 200 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 250 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 300 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 350 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 400 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 450 mg administered in a single dose.In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 500 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 600 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 700 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 800 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 900 mg administered in a single dose. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 1000 mg administered in a single dose.

[0209] When administered orally, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be between about 500 mg and 1,000 mg / month, between about 600 and 900 mg / month, or between about 700 and 800 mg / month. In some embodiments, the total weekly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mg / week administered as a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 500 mg administered in a single dose. In some embodiments, the total monthly dose for a human subject may be about 550 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 600 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 650 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 700 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 750 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 800 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 850 mg administered in a single dose.In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 900 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 950 mg administered in a single dose. In some embodiments, the total monthly dose of a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf), or a pharmaceutically acceptable salt thereof, for a human subject may be about 1000 mg administered in a single dose.

[0210] A single dose can be administered hourly, daily, weekly, or monthly. For example, a single dose can be administered once every 1 hour, 2, 3, 4, 6, 8, 12, 16, or once every 24 hours. A single dose can also be administered once every 1 day, 2, 3, 4, 5, 6, or once every 7 days. A single dose can also be administered once every 1 week, 2, 3, or once every 4 weeks. In certain embodiments, a single dose can be administered once a week. A single dose can also be administered once a month. In some embodiments, a compound or a pharmaceutically acceptable salt thereof provided herein is administered once a day with the methods disclosed herein. In some embodiments, a compound or a pharmaceutically acceptable salt thereof provided herein is administered twice a day with the methods disclosed herein.

[0211] In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once a day as disclosed herein. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once a week as disclosed herein. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once a month as disclosed herein. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once every two months as disclosed herein. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once every three months as disclosed herein. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered once every six months as disclosed herein.

[0212] In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 100 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 150 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 200 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 250 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 300 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 350 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 400 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 450 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are administered orally once a week in a single dose of about 500 mg. In some embodiments, a compound provided herein, or a pharmaceutically acceptable salt thereof, is administered orally once per week in a single dose of about 600 mg.

[0213] In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 500 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 550 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 600 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 650 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 700 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 750 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 800 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 850 mg. In some embodiments, the compounds provided herein or their pharmaceutically acceptable salts are orally administered once a month in a single dose of about 900 mg. In some embodiments, the compound provided herein or its pharmaceutically acceptable salt is administered orally once a month in a single dose of about 950 mg. In some embodiments, the compound provided herein or its pharmaceutically acceptable salt is administered orally once a month in a single dose of about 1000 mg.

[0214] The frequency of dosage of the disclosed compound or its pharmaceutically acceptable salt will be determined by the needs of individual patients, and can be, for example, once a day, once a week, once a month, once every two months, once every three months, or once every six months. As long as it is required to treat herpes virus infection (including HSV-1 and HSV-2 infection) or any other indication described herein, the compound or its pharmaceutically acceptable salt is continuously administered. For example, the compound or its pharmaceutically acceptable salt can be administered to humans suffering from herpes virus infection (including HSV-1 and HSV-2 infection) for the duration of human life.

[0215] Administration can be intermittent, wherein the patient receives a daily dose of a compound of the present disclosure or a pharmaceutically acceptable salt thereof during a period of several days or more, and then the patient does not receive a daily dose of the compound or a pharmaceutically acceptable salt thereof during a period of several days or more. For example, the patient may receive a dose of the compound or a pharmaceutically acceptable salt thereof every other day or three times a week. Again, for example, the patient may receive a dose of the compound or a pharmaceutically acceptable salt thereof every day for a period of 1 to 14 days, then the patient does not receive a dose of the compound or a pharmaceutically acceptable salt thereof during a period of 7 to 21 days, and then the patient receives a daily dose of the compound or a pharmaceutically acceptable salt thereof again during a subsequent period (e.g., 1 to 14 days). When treating the patient as required clinically, the alternating period of administering the compound or its pharmaceutically acceptable salt, followed by not administering the compound or its pharmaceutically acceptable salt, may be repeated.

[0216] The compounds of the present invention or their pharmaceutically acceptable salts, or the pharmaceutical compositions of the present invention can be administered one, two, three, or four times a day using any of the above-mentioned suitable modes. In addition, administration of the compound or its pharmaceutically acceptable salt or treatment with the compound or its pharmaceutically acceptable salt can last for several days; for example, for a treatment cycle, the treatment will usually last for at least 7 days, 14 days, or 28 days. The treatment cycle of herpes virus infection (including HSV-1 and HSV-2 infection) is well known. In some embodiments, the treatment cycle often alternates between cycles with a rest period of about 1 to 28 days, usually about 7 days or about 14 days. In other embodiments, the treatment cycle can also be continuous.

[0217] The effective dosage of the active ingredient employed may vary depending on the particular compound employed, the mode of administration, the condition to be treated, and the severity of the condition to be treated. Such dosages can be readily determined by one of ordinary skill in the art.

[0218] combination

[0219] In some embodiments, a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) provided herein, or a pharmaceutically acceptable salt thereof, is administered in combination with one or more additional therapeutic agents to treat or prevent a disease or condition disclosed herein. In some embodiments, the one or more additional therapeutic agents are one, two, three, or four additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are one additional therapeutic agent. In some embodiments, the one or more additional therapeutic agents are two additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are three additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are four additional therapeutic agents.

[0220] In some embodiments, the pharmaceutical compositions provided herein have a compound of Formula (I), (IIa), (IIb), (IIc), (IId), (IIe), or (IIf) provided herein, or a pharmaceutically acceptable salt thereof, and one or more additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are one, two, three, or four additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are one additional therapeutic agent. In some embodiments, the one or more additional therapeutic agents are two additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are three additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents are four additional therapeutic agents.

[0221] In some embodiments, the one or more additional therapeutic agents include, for example, DNA polymerase inhibitors, such as brincidofovir; protein Jumonji inhibitors, such as ML-324, dimethyloxaloylglycine; interferon α2 ligand modulators, such as interferon α-2b, Recombinant human interferon α-2b biosimilars, Nicotinic acetylcholine receptor antagonists, such as RPI-MN; virus-specific T cell therapy, such as off-the-shelf single virus-specific T cell (VST) therapy, ALVR-108, multi-virus-specific T cell TI1; other drugs used to treat herpes virus infection, such as BOR-15001L7, lidocaine, Bryostatin-23; or any combination thereof.

[0222] In some embodiments, the one or more additional therapeutic agents include, for example, an anti-herpes virus envelope glycoprotein D antibody, such as m27f; a progestin receptor agonist, such as levonorgestrel; or an HIV-1 reverse transcriptase inhibitor, such as tenofovir; or any combination thereof.

[0223] In some embodiments, the one or more additional therapeutic agents include, for example, endonuclease modulators, such as meganucleases; interferon alpha ligands / interferon gamma receptor antagonists, such as or any combination thereof;

[0224] In some embodiments, the one or more additional therapeutic agents include, for example, CCR5 chemokine modulators; DNA polymerase inhibitors; DNA primase inhibitors; fatty acid synthase inhibitors; glucocorticoid receptor agonists; helicase inhibitors; herpes virus envelope glycoprotein D inhibitors; Hsp 90 inhibitors; human cytomegalovirus glycoprotein inhibitors; hyaluronidase inhibitors; interferon α1 ligands; interferon α2 ligands; interferon β ligands; T cell surface glycoprotein CD8 stimulators; or cyclin-dependent kinase inhibitors, or any combination thereof.

[0225] In some embodiments, the one or more additional therapeutic agents include, for example, DNA primase-helicase inhibitors, such as amenamevir, pritelivir, IM-250; DNA polymerase inhibitors, polymerase inhibitors, such as famciclovir, penciclovir, valaciclovir, acyclovir, foscarnet sodium; CCR5 chemokine modulators / human cytomegalovirus glycoprotein inhibitors, such as MB-66; Hsp 90 inhibitors, such as BJ-B11; glucocorticoid receptor agonists, such as hydrocortisone; interferon alpha 1 ligand modulators, such as interferon alpha 1b, recombinant human interferon alpha 1b; interferon alpha 2 ligand modulators, such as recombinant human interferon alpha-2b, KW-045; interferon beta ligand modulators, such as interferon beta-1a (RebiSmart TM ); anti-HSV envelope glycoprotein D antibodies, such as UB-621; T cell surface glycoprotein CD8 stimulators, such as immunogenic peptides, fatty acid synthase inhibitors, such as TVB-2640; anti-herpes simplex virus monoclonal antibodies, such as HDIT-101; or other drugs used to treat herpes simplex virus infection, such as idoxuridine, BTL-TML-HSV, docosin, MAR-8644, MAR-8658, NV-HHV-101, PRL-01, HN-0037; or any combination thereof.

[0226] In some embodiments, the one or more additional therapeutic agents include, for example, a hyaluronidase inhibitor, such as astodrimer (SPL-7013); a live attenuated HSV vaccine, such as RVx-101 HSV-1; a live attenuated HSV vaccine having deletions in UL20 and UL53, such as VC2; a live attenuated HSV vaccine with a mutation in the R2 coding region of UL37, such as R2; an HSV-2 subunit trivalent vaccine (containing gC2, gD2, gE2), such as an HSV-2 trivalent vaccine; or any combination thereof.

[0227] In some embodiments, the one or more additional therapeutic agents include, for example, a live attenuated recombinant vaccine, such as AuroVax; an HSV-2 replication-deficient vaccine with deletions of UL5 and UL29, such as HSV-529; an mRNA vaccine targeting HSV-2 disease, such as mRNA-1608; or any combination thereof.

[0228] In some embodiments, the one or more additional therapeutic agents include, for example, a CD4 agonist; a CD89 agonist; a Duffy antigen chemokine receptor modulator; a herpes virus envelope glycoprotein D inhibitor; an HIV gp120 protein inhibitor; an HIV gp160 protein inhibitor; an HIV gp41 protein inhibitor; an immunoglobulin G agonist; a nicotinic acetylcholine receptor antagonist; a TAT protein modulator; a T cell surface glycoprotein CD8 stimulator; or a TLR-4 agonist; or any combination thereof.

[0229] In some embodiments, the one or more additional therapeutic agents include, for example, nicotinic acetylcholine receptor antagonists, such as RPI-78M; anti-herpes simplex virus monoclonal antibodies, such as HDIT-101; anti-herpes virus envelope glycoprotein D antibodies, such as UB-621; TLR-4 agonists, such as IDC-G103 vaccines; inactivated HSV-1 and HSV-2 vaccines, such as Live inactivated HSV-1 and HSV-2 vaccines, such as Theravax-HSV-2 vaccine; formalin-inactivated herpes virus (FI-HSV2) vaccine; or subunit vaccines based on RBT-26 T cells; DNA vaccines, such as pDNA / rVSV vector vaccines; or other drugs used to treat HSV-2, such as EBT-105, Alloferon TM ; or any combination thereof.

[0230] In some embodiments, one or more additional therapeutic agents include, for example, HIV gp120 / gp160 / gp41 protein inhibitors, such as riffitimsin; hyaluronidase inhibitors, such as astragalactone (SPL-7013); CD4 agonists / T cell surface glycoprotein CD8 vaccines, such as GENO-2; TAT protein modulators, such as Vaccine; CD89 agonist / Duffy antigen chemokine receptor modulator / immunoglobulin G agonist, such as glycoprotein D + liposome-encapsulated glycoprotein D booster vaccine; or vaccine, such as Profavax-HSV-2 vaccine; HSV-2 mRNA vaccine; glycoprotein D DNA vaccine; or any combination thereof.

[0231] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA vaccine, such as the HSV-2 vaccine Admedus; an RNA vaccine, such as GSK-4108771A; a live attenuated virus vaccine, such as EXD-12; a live attenuated delta-gD2-based virus vaccine; a vaccine, such as the NE-gD2 intranasal nanoemulsion NE matrix adjuvant HSV-2 vaccine; or other drugs for the treatment of HSV-2, such as EBT-105, Alyferon TM ; or any combination thereof.

[0232] In some embodiments, the one or more additional therapeutic agents include, for example, antimicrobial peptides; CD4 modulators; CRISPR-associated nuclease Cas9 modulators; cyclin-dependent kinase 9 inhibitors; DNA polymerase inhibitors; nicotinic acetylcholine receptor antagonists; TAT protein modulators; thymidine kinase inhibitors; or viral envelope protein inhibitors; or any combination thereof.

[0233] In some embodiments, one or more additional therapeutic agents include, for example, DNA polymerase inhibitors / thymidine kinase inhibitors, such as acyclovir; CRISPR-associated nuclease Cas9 modulators, such as EBT-104; nicotinic acetylcholine receptor antagonists, such as RPI-78M; cyclin-dependent kinase 9 inhibitors, such as FIT-039; other drugs for HSV-1 treatment, such as ZEP-3Na, MXB-009; CD4 modulator peptide vaccines, such as CEL-1000; vaccines, such as inactivated HSV-1 and HSV-2 vaccines, such as (anti-herpes vaccine); live inactivated HSV-1 and HSV-2 vaccines, such as Theravax-HSV-1 vaccine; or viral envelope protein inhibitors, such as MXB-005; or a combination thereof.

[0234] In some embodiments, the one or more additional therapeutic agents include, for example, a TAT protein modulator, such as vaccine; or a vaccine, such as Profavax-HSV-1 vaccine; or a combination thereof.

[0235] In some embodiments, the one or more additional therapeutic agents include, for example, a live attenuated viral vaccine, such as EXD-12; or a live attenuated delta-gD2-based viral vaccine; or a combination thereof.

[0236] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA polymerase inhibitor; a herpes virus envelope glycoprotein D inhibitor; or an interferon α2 ligand; or a combination thereof.

[0237] In some embodiments, the one or more additional therapeutic agents include, for example, DNA polymerase inhibitors, such as famciclovir, penciclovir; interferon α2 ligand modulators, such as Antibodies against herpes virus envelope glycoprotein D, such as UB-621; or other drugs used to treat genital herpes, such as interferon gamma, Alloferon TM , ZEP-3Na; or a combination thereof.

[0238] In some embodiments, the one or more additional therapeutic agents include, for example, vaccines, such as the NE-gD2 intranasal nanoemulsion NE matrix adjuvant vaccine; or other drugs used to treat and prevent genital herpes, such as SQX-77, anti-STI antibodies; or combinations thereof.

[0239] In some embodiments, the one or more additional therapeutic agents include, for example, a SAPN (self-assembling protein nanoparticle) based herpes vaccine.

[0240] In some embodiments, the one or more additional therapeutic agents include, for example, CMV 65kDa lower matrix phosphoprotein modulators; DNA polymerase inhibitors; G protein coupled receptor homolog US28 antagonists; herpes virus envelope glycoprotein B stimulators; HLA class I antigen A-11α modulators; HLA class I antigen A-2α modulators; HLA class I antigen A-24α modulators; human cytomegalovirus glycoprotein B inhibitors; human cytomegalovirus glycoprotein B modulators; human cytomegalovirus glycoprotein H modulators; human cytomegalovirus glycoprotein inhibitors; large terminase protein inhibitors; ribonuclease stimulators; serine threonine protein kinase UL97 modulators; syntaxin 5 inhibitors; transferase inhibitors; or viral ribonucleotide reductase inhibitors, or a combination thereof.

[0241] In some embodiments, the one or more additional therapeutic agents include, for example, DNA polymerase inhibitors, such as ganciclovir, fomivirsen, fovicisin sodium, valganciclovir; DNA polymerase inhibitors / serine / threonine protein kinase UL97 modulators, such as filociclovir; G protein-coupled receptor homolog US28 antagonists, such as SYN-002; large terminase protein inhibitors, such as AIC-387, AIC-476; serine / threonine protein kinase UL97 inhibitors, such as Marili maribavir; viral ribonucleotide reductase inhibitors, such as didox; ribonuclease stimulators, such as ranpirnase; HLA class I antigen A-11α modulators / HLA class I antigen A-2α modulators / HLA class I antigen A-24α modulators, such as allogeneic anti-CMV-TCR-T cell therapy, YT-CMV-22, YT-CMV-27 and YT-CMV-45; human cytotoxic glycoprotein B inhibitors, such as CMV-345; other drugs used to treat CMV, such as USC-505, USC-596, CMV pp65, and ppM83 derived peptides, artemifone (BAY-44-9585), PG-36, CMX-16669, HN-0141, ALVR-105, NPP-669, CMVpH4 human immunoglobulin, Cytovir TM , antiviral cytotoxic T cell therapy, CMV TCR transduced T cells, and adimlecleucel, or polyclonal antibodies, e.g. or a combination thereof.

[0242] In some embodiments, the one or more additional therapeutic agents include, for example, a syntaxin-5 inhibitor, such as Retro-94; a large terminase protein inhibitor, such as letermovir; a DNA polymerase inhibitor, such as valganciclovir; an anti-CMV antibody, such as BT-084 ( CP); human cytomegalovirus glycoprotein B and glycoprotein H regulator vaccine, such as mRNA-1647; CMV 65kDa matrix phosphoprotein vaccine, such as IRB-12022; or vaccine, such as mRNA-based vaccine; BD-03 plasmid DNA vaccine; V-212 heat-treated varicella-zoster virus vaccine; protein subunit vaccine, such as VBI-1501A; CMV-MVA pentamer vaccine (RhUL128C-MVA); CMV-MVA triple vaccine; VLP-based vaccine SPYVLP-102; or any combination thereof.

[0243] In some embodiments, the one or more additional therapeutic agents include, for example, a human cytomegalovirus glycoprotein inhibitor, such as CMV-IVIG; an additional drug for the treatment or prevention of CMV, such as an artemisinin derivative, NPC-21; a herpes virus envelope glycoprotein B stimulator vaccine, such as HB-101; a CMV matrix phosphoprotein modulator vaccine at 65 kDa, such as AVX-601; a vaccine, such as a CMV vaccine; a CMV pp65 peptide vaccine; V-160; or a multispecific cytotoxic T cell therapy; or any combination thereof.

[0244] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA polymerase inhibitor, such as ganciclovir, fomivirsen, valganciclovir, foscarnet.

[0245] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA polymerase inhibitor; a helicase inhibitor; an immunoglobulin agonist; an interferon α2 ligand; an interferon α ligand modulator; an interferon β ligand; or a TLR-4 agonist; or any combination thereof.

[0246] In some embodiments, the one or more additional therapeutic agents include, for example, DNA polymerase inhibitors, such as penciclovir, famciclovir, valacyclovir, acyclovir, USC-373; DNA primase inhibitors / helicase inhibitors, such as amoxicillin; interferon α2 ligand modulators, such as interferon α-2b, Pegylated interferon alpha-1b, Interferon alpha-2a, Interferon beta ligand modulators, such as RebiSmart TM ; immunoglobulin agonists, e.g. Zoster immune globulin-VF; vaccines, such as varicella vaccine (live attenuated); MMRV vaccine; herpes zoster vaccine; herpes zoster recombinant adjuvanted vaccine; or drugs used to treat varicella zoster virus infection, such as HerpeCide TM ; or any combination thereof.

[0247] In some embodiments, the one or more additional therapeutic agents include, for example, a vaccine, e.g. (MeMuRu-OKA); protein subunit TLR-4 agonist vaccines, such as CRV-101; vaccines based on VZV ORF29 mutants; varicella vaccine (live attenuated); varicella (chickenpox) vaccine Sinovac; vaccine (VZV-OKA strain); attenuated recombinant subunit vaccine containing gE, such as GSK-137173A; protein subunit vaccine, such as SP-0204; pneumococcal conjugate vaccine, such as SP-0202; triple live attenuated vaccine, such as MM- Adenovirus vector vaccines, such as VTP-400; recombinant varicella zoster virus vaccine; recombinant herpes zoster vaccine; inactivated varicella zoster vaccine; live attenuated virus vaccines, such as NBP-608, II, VZV-7D; or anti-varicella zoster virus antibodies, e.g. or any combination thereof.

[0248] In some embodiments, the one or more additional therapeutic agents include, for example, a drug for treating or preventing varicella zoster virus infection, such as OV-02; or a vaccine, such as EG-HZ; or any combination thereof.

[0249] In some embodiments, the one or more additional therapeutic agents include, for example, an interferon α2 ligand; a DNA polymerase inhibitor; a transferase inhibitor; a CRISPR-associated nuclease Cas9 modulator; a LAT gene inhibitor; or a gene inhibitor; or any combination thereof.

[0250] In some embodiments, the one or more additional therapeutic agents include, for example, DNA polymerase inhibitors, such as acyclovir, ganciclovir; interferon α2 ligand modulators, such as interferon α-2b, CRISPR-associated endonuclease Cas9 modulators / gene inhibitors, such as CRISPR / Cas9 gene therapy targeting HSV-1; LAT gene inhibitors, such as IFNγ / LAT siRNA gene therapy (rdHSV1 vector, herpes simplex dermatitis); additional drugs for the treatment of herpetic keratitis, such as EKC-Cide TM ; or any combination thereof.

[0251] In some embodiments, one or more additional therapeutic agents include, for example, Basigin inhibitors; envelope glycoprotein GP350 modulators; Estein-Barr nuclear antigen 1 inhibitors; Estein-Barr nuclear antigen 1 stimulators; HLA class I antigen A-11α modulators; HLA class I antigen A-2α modulators; HLA class I antigen A-24α modulators; human cytomegalovirus glycoprotein B modulators; human cytomegalovirus glycoprotein H modulators; human cytomegalovirus glycoprotein L modulators; latent membrane protein 1 modulators; latent membrane protein 2 stimulators; NKG2D ligand modulators; or secretory protein BARF1 modulators; or any combination thereof.

[0252] In some embodiments, one or more additional therapeutic agents include, for example, NKG2D ligand modulators, such as pamidronic acid; Estein-Barr nuclear antigen 1 inhibitors, such as VK-2019, anti-Estein-Barr virus (EBV) peptides; HLA class I antigen A-11α / HLA class I antigen A-2α / HLA class I antigen A-24α modulators, such as allogeneic anti-EBV-TCR-T cells, YT-EBV-44; additional drugs for EBV treatment, such as ALVR-105, antiviral cytotoxic T cell therapy; Estein-Barr nuclear antigen / latent membrane protein 1 and protein 2 / secretory protein BARF1 modulators, such as baltaleucel-T (CMD-003); or mRNA vaccines, such as mRNA-1195; or any combination thereof.

[0253] In some embodiments, one or more additional therapeutic agents include, for example, a basigin modulator, such as an EBV gH / gL / gp42 vaccine; a basigin modulator / envelope glycoprotein GP350 modulator / human cytomegalovirus glycoprotein B modulator / human cytomegalovirus glycoprotein H modulator / human cytomegalovirus glycoprotein L modulator, such as an mRNA-1189 vaccine; a vaccine, such as an EBV gH / gL vaccine; P-989; an mRNA vaccine; or an EBV cancer vaccine (mRNA, LPP nanoparticles); or any combination thereof.

[0254] In some embodiments, the one or more additional therapeutic agents include, for example, an EBV-VLP2 stimulator, such as an MVA-based vaccine; a multispecific cytotoxic T cell therapy; or a vaccine, such as an EBV-VLP vaccine; or any combination thereof.

[0255] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA polymerase inhibitor.

[0256] In some embodiments, the one or more additional therapeutic agents include, for example, a DNA polymerase inhibitor, such as brofovir; a drug for the treatment of herpes virus type 6, such as ALVR-105; a multispecific cytotoxic T cell therapy; or an HHV-6B glycoprotein complex gH / gL / gQ1 / gQ2 subunit vaccine; or any combination thereof.

[0257] Examples

[0258] The following examples are included to illustrate specific embodiments of the present disclosure. It should be understood by those of ordinary skill in the art that the techniques disclosed in the following examples represent techniques that fully function in the implementation of the present disclosure, and therefore may be considered to constitute specific modes of its implementation. However, it should be understood by those of ordinary skill in the art in view of the present disclosure that these examples are exemplary and not exhaustive. Many changes may be made in the specific embodiments disclosed, and still obtain similar or similar results without departing from the spirit and scope of the present disclosure.

[0259] The compounds disclosed herein can be prepared according to the procedures of the following processes and examples using appropriate materials, and are further illustrated by the following specific examples. In addition, by utilizing the procedures described herein in conjunction with the common knowledge in the art, additional compounds of the present disclosure claimed herein can be easily prepared. The examples further illustrate the details for preparing the compounds disclosed herein. Those with common knowledge in the art will easily understand that the conditions of the following preparation procedures and known variations of the procedures can be used to prepare these compounds. In order to synthesize the compounds of the embodiments described in this disclosure, the inspection of the structure of the compound to be synthesized will provide the identification of each substituent. In some cases, according to the examples herein, the identification of the final product can make the identification of the necessary starting materials obvious through the inspection process. The compound can be isolated in the form of its pharmaceutically acceptable salt (such as these above-mentioned salts). The compounds described herein are generally stable and can be isolated at room temperature and pressure.

[0260] The following shows the preparation instructions of the compounds disclosed herein. Unless otherwise indicated, the variables have the same meanings as described above. The examples presented below are intended to illustrate specific embodiments of the present disclosure. Suitable starting materials, building blocks, and reagents employed in the syntheses described below may be purchased, for example, from AbovChem, Acros Organics, Astatech, Combi Blocks, Oakwood Chemical, or Sigma-Aldrich, or may be routinely prepared by procedures described in the literature, such as "March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure", 5th edition, John Wiley & Sons, or T. Eicher, S. Hauptmann, "The Chemistry of Heterocycles; Structures, Reactions, Synthesis and Application", 2nd edition, Wiley-VCH 2003; Fieser et al., "Fiesers' Reagents for organic Synthesis", John Wiley & Sons 2000.

[0261] List of abbreviations and acronyms

[0262] Abbreviation / Acronym Meaning

[0263] Ac Acetate

[0264] AcOH Acetic acid

[0265] aq. Aqueous solution

[0266] Argon

[0267] Bn Benzyl

[0268] BnSH Benzyl mercaptan

[0269] Boc tert-Butyloxycarbonyl

[0270] Boc2O Di-tert-butyl dicarbonate

[0271] Bu4N Tetrabutylammonium

[0272] DCM Dichloromethane

[0273] DIEA or DIPEA N,N-diisopropylethylamine

[0274] DMAP 4-dimethylaminopyridine

[0275] DMF N,N-Dimethylformamide

[0276] DMSO Dimethyl sulfoxide

[0277] eq. or equiv equivalent

[0278] Et Ethyl

[0279] Et3N Triethylamine

[0280] EtOAc Ethyl acetate

[0281] h or hr(s) (multiple) hours

[0282] HPLC High Pressure Liquid Chromatography

[0283] i-Pr Isopropyl

[0284] LCMS Liquid chromatography mass spectrometry

[0285] Me Methyl

[0286] MeOH Methanol

[0287] MPLC Medium Pressure Liquid Chromatography

[0288] MS mass spectrometry

[0289] m / z mass-to-charge ratio

[0290] NMR Nuclear Magnetic Resonance Spectroscopy

[0291] PhMe Toluene

[0292] RT or rt Room temperature

[0293] sat. or satd. saturated

[0294] SFC Supercritical Fluid Chromatography

[0295] t-Bu or tBu tert-butyl

[0296] TCFH Chloro(dimethylamino)-N,N-dimethylimine hexafluorophosphate

[0297] TFA Trifluoroacetic acid

[0298] THF Tetrahydrofuran

[0299] General Procedure A

[0300]

[0301] Compounds of formula A.3 can be generated from intermediates A.1 and A.2 by amide coupling (similar to the reactions of those compounds described in Chem. Soc. Rev., 2009, 38, 606-631; Amide bond formation: Beyond the myth of coupling reagents). An exemplary procedure is as follows: Intermediates A.1 (1 eq.) and A.2 (1 eq.) are suspended in acetonitrile (10 V). TCFH (1.2 eq.) is then added, followed by dropwise addition of N-methylimidazole (3 eq.) while maintaining the internal temperature at or below 25° C. After complete consumption of the starting material, the reaction mixture is purified by reverse phase HPLC to provide the title compound of type A.3.

[0302] General Procedure B

[0303]

[0304] The intermediate of type B.1 is protected with a suitable protecting group (e.g., Boc, PMB, DMB, DMFDMA, etc.) to give intermediate B.2. In the subsequent amide coupling step, intermediate B.2 (1 eq.) and intermediate B.3 (1 eq.) are suspended in acetonitrile (10 V). TCFH (1.2 eq.) is then added, followed by dropwise addition of N-methylimidazole (3 eq.) while maintaining the internal temperature at or below 25 °C. After consumption of intermediates B.2 and B.3 and conversion to intermediates of type B.4, removal of the relevant protecting groups is performed in the same pot using suitable conditions (e.g., TFA, hydrazine, etc.). After complete removal of the protecting groups, addition of water (30 V) may result in precipitation of solid material, which is filtered, washed, and dried to provide compounds of type B.5.

[0305] General Program C

[0306]

[0307] Intermediates of type C.1 (1 eq.) and type C.2 (1 eq.) are suspended in acetonitrile (10 V). TCFH (1.2 eq.) is then added, followed by dropwise addition of N-methylimidazole (3 eq.) while maintaining the internal temperature at or below 25 °C. After consumption of intermediates C.1 and C.2, silica gel is added, the solvent is removed under reduced pressure, and the resulting compound is adsorbed onto silica gel and purified by flash column chromatography to provide a compound of type C.3 intermediate. Intermediate C.3 is then dissolved in chloroform (5 V) and chlorosulfonic acid (5 V). The mixture is then stirred at 65 °C until consumption of intermediate C.3 is observed, at which time the mixture is carefully poured onto ice. The resulting precipitated solid of type C.4 intermediate is filtered and dissolved in dichloromethane (5 V), and 6N ammonium hydroxide (25 eq.) is added. After complete consumption of intermediate C.4, the mixture was diluted with dichloromethane (25 V), and the organic phase was washed sequentially with water (10 V) and brine (10 V), and then dried over magnesium sulfate. After filtration and concentration, the crude residue was purified using reverse phase HPLC to give compound type C.5.

[0308] Preparation of intermediate 1: 7-methylindoline-6-sulfonamide

[0309]

[0310] Preparation of Intermediate 1.1: 6-Bromo-7-methylindoline (100 mg, 0.47 mmol) and 4-dimethylaminopyridine (12 mg, 0.2 eq) were dissolved in tetrahydrofuran (5 mL). The solution was cooled to 0 °C and then immediately added di-tert-butyl dicarbonate (134 mg, 1.3 eq). The mixture was warmed to room temperature and stirred overnight, at which time silica gel was added and the solvent was removed under reduced pressure. The resulting crude material was purified by flash column chromatography on silica gel (0 to 20% ethyl acetate in hexanes) to give Intermediate 1.1. LCMS: 312.1 [M+H].

[0311] Preparation of Intermediate 1.2: Intermediate 1.1 (110 mg, 0.35 mmol) was dissolved in tetrahydrofuran (5 mL) and cooled to -78 °C. Then n-butyl lithium (2.4 M in hexanes, 0.22 mL, 1.5 eq) was added dropwise and allowed to stir at the same temperature for 5 minutes. Then 2-methyl-2-(sulfinylamino)oxypropane (95 mg, 2 eq) was added immediately and the mixture was allowed to warm to room temperature and stirred overnight. Silica gel was then added and the solvent was removed under reduced pressure. The resulting crude material was purified by flash column chromatography on silica gel (0 to 10% methanol in dichloromethane) to give Intermediate 1.2. LCMS: 313.1 [M+H].

[0312] Preparation of Intermediate 1: Intermediate 1.2 (45 mg, 0.21 mmol) was dissolved in trifluoroacetic acid (2 mL) and stirred for 1 hour. The solvent was then removed under reduced pressure to give Intermediate 1. LCMS: 213.1 [M+H].

[0313] Preparation of Intermediate 2: 5-(Pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid

[0314]

[0315] Preparation of Intermediate 2.1: To a stirred suspension of 60% NaH (22.72 g, 2 eq.) in THF (1000 mL) was added diethyl carbonate (86 mL, 1.5 eq.) at 0°C. To this solution was added 5-bromo-indan-1-one (100 g, 473.1 mmol) in portions at this temperature. The reaction mixture was stirred at this temperature until the gas evolution subsided. The reaction mixture was slowly heated to 50°C and kept stirring for 2 h. The progress of the reaction was monitored by TLC, and after the consumption of the starting material, the reaction mixture was cooled to room temperature. The reaction was diluted with EtOAc (10 V). To this was added 3N aq HCl dropwise. The two layers were separated. The aqueous layer was extracted with EtOAc (2×5 V). The combined organic layers were washed with brine solution (5 V), dried (Na2SO4) and evaporated to obtain a crude material, which was purified by column chromatography on silica gel to afford Intermediate 2.1. LCMS: 283.0 [M+H].

[0316] Preparation of intermediate 2.2: Triethylsilane (224 mL) was added dropwise to a solution of intermediate 2.1 (56 g, 197.9 mmol) in TFA (280 mL) at 0 ° C and the reaction mixture was stirred at room temperature for 24 h. The reaction progress was monitored by TLC. After the starting material was consumed, the reaction mixture was evaporated to dryness under reduced pressure to obtain a crude product. The crude product was purified on silica gel by column chromatography to obtain intermediate 2.2. LC / MS: 269.0 [M+H].

[0317] Preparation of intermediate 2.3: A stirred solution of intermediate 2.2 (40 g, 148.7 mmol) and 2-tributylstannylpyridine (57.5 g, 1.05 equiv) in 1,4-dioxane (400 mL) was degassed with argon for 10 min, at which time Pd(PPh3)4 (8.6 g, 5 mol%) was added and degassed again for another 10 min. The reaction mixture was heated to 90 °C for 16 h. The reaction mixture was filtered through a pad of celite and the celite pad was washed twice with ethyl acetate. The combined filtrate was evaporated to dryness to obtain the crude. The crude was purified by column chromatography on silica gel to give intermediate 2.3. LC / MS: 268.1 [M+H].

[0318] Preparation of intermediate 2: 2N aq NaOH solution (140 mL, 2.2 eq) was added to a stirred solution of intermediate 2.3 (35 g, 131.1 mmol) in methanol (350 mL) at 0 ° C and the reaction mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction mixture was concentrated to 100 mL under reduced pressure. The residue was diluted with water (10 V) and the aqueous layer was washed with ethyl acetate (2×2 V). The aqueous phase was neutralized with 2N aq HCl solution and extracted with 10% methanol / DCM (3×5 V). The organic layer was dried over sodium sulfate and concentrated to give a crude product. The crude product was then dissolved with 10% isopropanol / toluene (10 V) solution and treated with activated carbon. The solvent was then removed under reduced pressure. The residue was dissolved in 30% toluene / hexane, stirred for 30 min and filtered, and then dried under vacuum. The process was repeated twice more to give intermediate 2. LC / MS: 238.1 [MH].

[0319] Preparation of intermediate 3: 4-methylindoline-6-sulfonamide

[0320]

[0321] Intermediate 3.1 was prepared in a similar manner to Intermediate 1.1 using 6-bromo-4-methylindoline instead of 6-bromo-7-methylindoline as starting material. LCMS: 312.1 [M+H].

[0322] Intermediate 3.2 was prepared in a similar manner to Intermediate 1.2 using Intermediate 3.1 instead of compound Intermediate 1.1 as starting material. LCMS: 313.1 [M+H].

[0323] Intermediate 3 was prepared in a similar manner to Intermediate 1 using Intermediate 3.2 instead of Intermediate 1.2 as starting material. LCMS: 213.1 [M+H].

[0324] The intermediates in Table 1A were prepared in a similar manner to Intermediates 1 and 3:

[0325] Table 1A

[0326]

[0327]

[0328] The intermediates in Table 1B were prepared in a similar manner to Intermediate 2:

[0329] Table 1B

[0330]

[0331]

[0332] Preparation Example

[0333] Preparation Example 1: 4-methyl-3-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)-2,3-dihydro-1H-indene-5-sulfonamide (General Procedure A)

[0334]

[0335] Intermediate 1 (25 mg, 0.12 mmol) and Intermediate 2 (34 mg, 1.2 eq) were dissolved in acetonitrile (2 mL). 1-Methylimidazole (48 mg, 5 eq) and TCFH (chloro(dimethylamino)-N,N-dimethylmethane hexafluorophosphate, 33 mg, 1 eq) were then added sequentially and the reaction mixture was stirred at room temperature overnight before the solvent was removed under reduced pressure. The crude residue was purified by reverse phase HPLC to give Example 1. 1 H NMR (400MHz, DMSO-d6) δ8.69-8.59(m,1H),7.99-7.85(m,4H),7.69(d,J=7.8Hz,1H),7.37(s,2H),7.33(d,J=10.9H z, 2H), 7.29 (d, J = 7.9Hz, 1H), 6.53 (m, 4H), 4.26 (d, J = 8.0Hz, 2H), 3.91 (m, 1H), 3.12 (t, J = 7.4Hz, 2H), 2.28 (s, 3H). LCMS:434.1[M+H].

[0336] Preparation Example 2:

[0337]

[0338] Example 2 was prepared in a similar manner to Example 1 using Intermediate 3 as the starting material instead of Intermediate 1. 1HNMR(400MHz,DMSO-d6)δ8.68(dt,J=5.0,1.4Hz,1H),8.44(d,J=1.7Hz,1H),7 .98(dd,J=15.6,7.9Hz,3H),7.89(dd,J=7.9,1.7Hz,1H),7.46-7.40(m,1H),7. 38(d,J=7.8Hz,1H),7.33(d,J=1.6Hz,1H),7.23(s,2H),4.36(t,J=8.5Hz,2H) ,3.78(q,J=8.1Hz,1H),3.44-3.22(m,4H),3.18(t,J=8.3Hz,2H),2.29(s,3H). LCMS: 434.1 [M+H].

[0339] The following Examples in Table 1C were prepared in a manner similar to Example 1 (General Procedure A).

[0340] Table 1C

[0341]

[0342]

[0343]

[0344] Preparation Examples 14, 15, 16 and 17:

[0345]

[0346]

[0347] Example 14 was obtained from the first eluent of chiral SFC purification of Example 3 using an OJ-H 4.6×100 mm column and 50% ethanol as a co-solvent. 1 H NMR (400MHz, DMSO-d6) δ8.69 (dd, J=4.8, 1.5Hz, 1H), 8.58 (s, 1H), 8.07-7.91 (m, 3H),7.89(dd,J=7.9,1.7Hz,1H),7.57-7.35(m,4H),7.29(s,2H),4.90(t,J=7.5H z,1H),3.90-3.69(m,1H),3.46(tt,J=16.9,8.4Hz,3H),3.28(dd,J=15.8,8.5Hz, 1H), 3.14 (dd, J=16.3, 7.7Hz, 1H), 2.80 (d, J=16.6Hz, 1H), 1.30 (d, J=6.2Hz, 3H). LC / MS:434.1[M+H].

[0348] Example 15 was obtained from the second eluent of chiral SFC purification of Example 3 using an OJ-H 4.6×100 mm column and 50% ethanol as a co-solvent. 1 H NMR(400MHz,DMSO-d6)δ8.75-8.67(m,1H),8.58(s,1H),8.06(d,J=4.1Hz,2H),7.97 (s,1H),7.88(dd,J=7.9,1.7Hz,1H),7.58-7.37(m,4H),7.29(s,2H),4.90(t,J=7.5 Hz,1H),3.78(q,J=8.2Hz,1H),3.47(tt,J=18.5,8.9Hz,3H),3.29(dd,J=15.9,8.5H z, 1H), 3.14 (dd, J = 16.3, 7.7Hz, 1H), 2.81 (d, J = 16.6Hz, 1H), 1.30 (d, J = 6.2Hz, 3H). LC / MS: 434.1[M+H].

[0349] Example 16 was obtained from the third eluent of chiral SFC purification of Example 3 using an OJ-H 4.6×100 mm column and 50% ethanol as a co-solvent. 1 H NMR(400MHz,DMSO-d6)δ8.70(dd,J=5.0,1.4Hz,1H),8.58(s,1H),8.04(d,J=4 .1Hz,2H),7.99-7.84(m,2H),7.61-7.39(m,4H),7.29(s,2H),4.91(q,J=7.0H z,1H),3.78(q,J=8.1Hz,1H),3.60-3.33(m,3H),3.27(dd,J=16.2,8.5Hz,1H) ,3.16(dd,J=16.0,7.6Hz,1H),2.81(d,J=16.6Hz,1H),1.30(d,J=6.2Hz,3H). LC / MS:434.1[M+H].

[0350] Example 17 was obtained from the fourth eluent of chiral SFC purification of Example 3 using an OJ-H 4.6×100 mm column and 50% ethanol as a co-solvent. 1H NMR(400MHz,DMSO-d6)δ8.70(dd,J=5.1,1.4Hz,1H),8.58(s,1H),8.14-8.0 1(m,2H),7.97-7.82(m,2H),7.61-7.37(m,4H),7.29(s,2H),4.90(t,J=7.5H z,1H),3.86-3.73(m,1H),3.62-3.36(m,3H),3.27(dd,J=16.2,8.5Hz,1H), 3.16(dd,J=16.0,7.6Hz,1H), 2.81(d,J=16.6Hz,1H), 1.30(d,J=6.2Hz,3H). LC / MS: 434.1[M+H].

[0351] Alternative Preparation Example 15 Starting from 5-bromo-(R)-2-methylindoline

[0352] Preparation of Intermediate 49: (R)-2-Methylindoline-6-sulfonamide

[0353]

[0354] Intermediate 49.2 was prepared in a manner analogous to Intermediate 42.3 using (R)-5-bromo-2-methylindoline instead of Intermediate 42.1 as the starting material.

[0355] Preparation 49.3: To a suspension of (2R)-1-acetyl-5-bromo-2-methyl-indoline-6-sulfonamide 49.2 (145 mg, 0.44 mmol) in EtOH (10 mL) was added 10% Pd / C (93 mg, 0.2 eq.) and Et3N (0.18 mg, 3 eq.). The reaction mixture was evacuated and purged with H2 from a balloon (4x) and allowed to stir under H2. LCMS showed complete conversion after stirring overnight. The mixture was filtered through a pad of celite, the pad was washed with EtOH, and the filtrate was concentrated to almost dryness. Water was added to the residue, the mixture was sonicated, the white solid was collected by filtration, the solid was washed with water (x3) and the solid was further dried under high vacuum.

[0356] Intermediate 49 was prepared in a similar manner to intermediate 42 using 49.3 instead of 42.3 as starting material. 1HNMR(400MHz,DMSO-d6)δ7.14-7.06(m,3H),6.95(dd,J=7.6,1.7Hz,1H),6.83(d,J=1.6Hz,1H),6.0 4(d,J=1.9Hz,1H),4.01-3.85(m,1H),3.18-3.03(m,1H),2.59-2.51(m,1H),1.18(d,J=6.2Hz,3H). LCMS:213.026[M+H].

[0357] Example 15 was then prepared by Method A using Intermediate 49 and Intermediate 19. The retention time of the product from analytical chiral column chromatography was consistent with that of the material obtained from the preparative chiral SFC purification of Example 3.

[0358] Preparation of Intermediate 18: 1-(5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0359]

[0360] To a solution of intermediate 35 (750 mg, 1.78 mmol) in 1,4-dioxane (10 mL) was added bis(pinacol)diboron (1.2 equiv), potassium acetate (3.0 equiv), and (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (20 mol%). The mixture was sparged with nitrogen for 5 min and then heated to 95 °C. After stirring for 4 h, the reaction was partitioned between water (25 mL) and EtOAc (25 mL). The aqueous phase was extracted twice with EtOAc (25 mL) and the combined organic layers were dried over magnesium sulfate. The solvent was removed under reduced pressure and the crude residue was purified using flash column chromatography (0 to 100% EtOAc in hexanes) to give intermediate 18. LC / MS: 469.2 [M+H].

[0361] Preparation Example 18

[0362]

[0363] To a solution of Intermediate 18 (20 mg, 0.043 mmol) in 9:1 1,4-dioxane:water (1 mL) was added 2-bromo-6-fluoropyrazine (1.2 eq), potassium carbonate (3.0 eq), and (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (20 mol%). The mixture was sparged with nitrogen for 5 min and then heated to 95 °C. After stirring for 4 h, the reaction mixture was concentrated and the crude residue was purified using reverse phase HPLC to give Example 18. 1H NMR (400MHz, DMSO-d6) δ9.25(d,J=5.1Hz,1H),8.69-8.53(m,2H),8.02(s,1H),7.97(d,J=8.0Hz,1H),7.48(dd,J=7. 8,1.7Hz,1H),7.42(dd,J=8.0,3.7Hz,2H),7.28(s,2H),4.35(t,J=8.5Hz,2H),3.83-3.72(m,1H),3.23-3.34(m,6H). LC / MS: 439.1[M+H].

[0364] The following examples in Table ID were prepared in a manner similar to Example 18 using the appropriate aryl bromide coupling partner:

[0365] Table 1D

[0366]

[0367]

[0368]

[0369] Preparation of Intermediate 19: (R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid

[0370]

[0371] Intermediate 19 was obtained as the first eluent of SFC purification of Intermediate 2 using Chiralpak AD-H column with 20% methanol as co-solvent. LC / MS: 238.1 [MH].

[0372] Preparation Example 28:

[0373]

[0374] Example 28 was prepared in a manner analogous to Example 1 using Intermediate 19 and Intermediate 9 (General Procedure A). 1HNMR (400MHz, DMSO-d6) δ8.70(dd,J=5.0,1.4Hz,1H),8.57(d,J=6.7Hz,1H),8.04(d,J=4.1Hz,2H),7.94(s,1H),7.88(dd,J=7.8,1.7Hz ,1H),7.57(s,2H),7.48(q,J=4.6Hz,1H),7.37(dd,J=16.6,8.8Hz,2H),4.34(t,J=8.5Hz,2H),3.76(t,J=8.0Hz,1H),3.41-3.22(m,6H). LC / MS: 438.1[M+H].

[0375] Preparation of Intermediate 20: Imino(indolin-6-yl)(methyl)-λ 6 -Sulfone Ketone

[0376]

[0377] Preparation of Intermediate 20.1: To a solution of 6-bromo-1H-indole (5.0 g, 25.5 mmol, 1.0 eq) in THF (100 mL) was added NaH (2.0 g, 51.0 mmol, 2.0 eq) at 0 °C under N2. The reaction was stirred for 30 min, then it was cooled to -65 °C and t-BuLi (58.8 mL, 1.3 N, 3.0 eq) was added. It was stirred for 30 min and dimethyl disulfide (7.2 g, 76.5 mmol, 3.0 eq) was added, the reaction was stirred for 2 h and warmed to room temperature for 1 h, then it was quenched by water and extracted with EtOAc. The organic extract was concentrated, and the residue was purified by column chromatography to give compound Intermediate 20.1. LC / MS: 160.4 [M+H].

[0378] Preparation of intermediate 20.2: To a solution of intermediate 20.1 (8.2 g, 50.3 mmol, 1.0 eq) in AcOH (80 mL) was added NaBH3CN (9.5 g, 150.9 mmol, 3.0 eq) in small batches at 10°C. The reaction was stirred for 1 h and quenched by water, adjusted to pH 6 with K2CO3, and extracted with EtOAc (150 mL x 2). The combined organic fractions were dried over Na2SO4, concentrated, and the residue was purified by column chromatography to give intermediate 20.2. LC / MS: 166.2 [M+H].

[0379] Preparation of intermediate 20.3: To a solution of intermediate 20.2 (6.2 g, 37.6 mmol, 1.0 eq) in DCM (60 mL) was added Boc2O (16.4 g, 75.2 mmol, 2.0 eq) and DMAP (4.6 g, 37.6 mmol) in portions at room temperature. The reaction was stirred overnight and poured into water, extracted with EtOAc (50 mL x 2), and the combined organic fractions were concentrated and the residue was purified by column chromatography to provide compound intermediate 20.3. LC / MS: 265.9 [M+H].

[0380] Preparation of intermediate 20.4: To a solution of intermediate 20.3 (6.7 g, 25.3 mmol, 1.0 eq) in DCM (60 mL) was added tert-butyl carboazide (9.0 g, 63.2 mmol, 2.5 eq) and FeCl (3.2 g, 25.3 mmol, 1.0 eq) at 0°C under N2. The reaction was warmed to room temperature overnight, then poured into water and extracted with EtOAc. The organic fractions were concentrated and the residue was purified by column chromatography (DCM / MeOH=40:1) to give intermediate 20.4. LC / MS: 381.1 [M+H].

[0381] Preparation of intermediate 20.5: To a solution of intermediate 20.4 (5.8 g, 15.3 mmol, 1.0 eq) in THF / H2O (4 / 1, 75 mL) was added NaIO4 (16.4 g, 76.5 mmol, 5.0 eq) and RuCl3.H2O (172 mg, 0.77 mmol, 0.05 eq) in portions at room temperature. The reaction mixture was stirred for 10 min and poured into water, and extracted with EtOAc (50 mL×2). The combined organic extracts were concentrated and the residue was purified by column chromatography (petroleum ether / EtOAc=2:1) ​​to provide intermediate 20.5. LC / MS: 397.1 [M+H].

[0382] Preparation of intermediate 20: Intermediate 20.5 (4.0 g) was dissolved in HCl / dioxane (40 mL, 4 N) and stirred overnight. The resulting solid was filtered off and dissolved in water. The pH was then adjusted to 7 with sodium bicarbonate, and the residue was purified by reverse phase HPLC to provide intermediate 20. LC / MS: 197.1 [M+H].

[0383] Preparative Example 29 (General Procedure A): Imino(methyl)(1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indolin-6-yl)-λ 6 -Sulfone Ketone

[0384]

[0385] To a solution of Intermediate 2 (30 mg, 0.15 mmol) and Intermediate 20 (91 mg, 3 eq) in acetonitrile (40 V) was added 1-methylimidazole (3 eq) and TCFH (2 eq). After stirring at room temperature for 1 hour, the reaction was diluted with EtOAc and water was added. The resulting aqueous layer was extracted twice with EtOAc, and the combined organic fractions were dried over magnesium sulfate. The solvent was removed under reduced pressure and then reconstituted in THF (2 mL) and 2N NaOH (2 mL). The mixture was then heated at 75 ° C for 6 hours, after which the pH was adjusted to 7 with 1N HCl. The mixture was extracted with EtOAc (3×25 mL), and the combined organic fractions were dried over magnesium sulfate. After removing the solvent under reduced pressure, the crude residue was purified by flash column chromatography (10% methanol in EtOAc) to give Example 29. LC / MS: 418.2 [M+H].

[0386] Preparation Examples 31 and 33:

[0387]

[0388] Example 31 was obtained from the fourth eluent of chiral SFC purification of Example 29 using a CCO-F2 column and 40% methanol as a co-solvent. 1 H NMR(400MHz,DMSO-d6)δ8.65(q,J=2.1Hz,2H),7.98-7.81(m,4H),7.59(dd,J=7.8,1.8Hz,1H),7.46(d,J=7.8Hz,1 H),7.38-7.29(m,2H),4.36(t,J=8.5Hz,2H),4.09(s,1H),3.75(q,J=8.2Hz,1H),3.30-3.19(m,6H),3.00(s,3H). LC / MS: 418.2[M+H].

[0389] Example 33 was obtained from the third eluent of chiral SFC purification of Example 29 using a CCO-F2 column with 40% methanol as a co-solvent. 1 H NMR(400MHz,DMSO-d6)δ8.65(q,J=2.1Hz,2H),8.02-7.77(m,4H),7.59(dd,J=7.8,1.8Hz,1H),7.46(d,J=7.8Hz,1 H),7.40-7.27(m,2H),4.36(t,J=8.6Hz,2H),4.09(s,1H),3.76(p,J=8.0Hz,1H),3.32-3.21(m,6H),3.00(s,3H). LC / MS: 418.2[M+H].

[0390] Preparation of Intermediate 21:

[0391]

[0392] Preparation of Intermediate 21.1: 5-Fluoro-2-methylindoline (40 g, 268 mmol, 1 eq) was dissolved in acetic acid (200 mL, 5 V). NaBH3CN (50 g, 815 mmol, 3 eq) was added in portions while keeping the temperature below 10 °C. The resulting solution was warmed to room temperature and stirred for 3 h, at which time the reaction was diluted with ice-cold water (500 mL). The reaction was then extracted with EtOAc (3×100 mL). The combined organic layers were washed with brine (750 mL), dried over Na2SO4 and concentrated in vacuo. The crude Intermediate 21.1 was isolated as a viscous yellow oil and used in the next step without further purification. LC / MS: 151.2 [M+H].

[0393] Preparation of intermediate 21.2: To a stirred solution of intermediate 21.1 (35 g, 86.6 mmol) in DCM (300 mL) was added triethylamine (35 mL, 1 vol) followed by acetyl chloride (35 mL, 1 vol) at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The residue was quenched with cold water (200 mL) and extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (750 mL), dried over Na2SO4 and concentrated in vacuo. The crude residue was purified by column chromatography (100-200 silica gel, eluted with 8% EtOAc-hexanes) to give intermediate 21.2. LC / MS: 193.2 [M+H].

[0394] Preparation of intermediate 21.3: To a stirred solution of intermediate 21.2 (35 g, 0.011 mol) in chlorosulfonic acid (250 mL, 10 V) at 0 ° C under nitrogen, and the reaction mixture was stirred at 50 ° C for 3 h. After the reaction was complete, the mixture was diluted with ice-cold water. The precipitate was filtered, dissolved in dichloromethane (50 mL), and added to a concentrated ammonium hydroxide solution (20 mL). After vigorous stirring at room temperature for 15 minutes, the solvent was removed under pressure and the resulting solid was filtered out and rinsed with water to give intermediate 21.3. LC / MS: 272.3 [M+H].

[0395] Preparation of Intermediates (R)-21 and (S)-21: A racemic mixture of intermediate 21.3 (30 g, 110 mmol, 1 eq.) in 500 mL of 2N sodium hydroxide was heated at 100 °C for 3 h. The reaction was cooled to room temperature and the pH was adjusted to 7 with acetic acid. The precipitate was filtered, washed with water, and dried under vacuum. The deacetylated racemic mixture was then subjected to chiral SFC purification using a ChiralPak IG 240×4.6 mm column with a mobile phase consisting of 70:20:10 hexanes:methanol:MTBE. Intermediate (R)-21 was collected as the second eluent (retention time 13.1 min). LC / MS: 230.1 [M+H]. Intermediate (S)-21 was collected as the first eluent (retention time 10.5 min). LC / MS: 230.1 [M+H].

[0396] Preparation Example 34:

[0397]

[0398] Example 34 was prepared in a manner similar to Example 1 using Intermediate (S)-21 and Intermediate 19 (General Procedure A). 1 HNMR(400MHz,DMSO-d6)δ8.72-8.62(m,1H),8.54(d,J=6.7Hz,1H),8.02-7.81(m,4H),7.58(s,2H),7.39 (d, J=8.8Hz, 3H), 4.90 (t, J=7.5Hz, 1H), 3.77 (t, J=8.4Hz, 1H), 3.48-3.09 (m, 6H), 1.30 (d, J=6.2Hz, 3H). LC / MS: 452.1[M+H].

[0399] Preparation Example 35 (General Procedure B):

[0400]

[0401] Intermediate (R)-21 was dissolved in THF (10 V) and dimethylformamide dimethyl acetal (1.2 eq.) was added immediately. The solution was stirred at room temperature for 30 min and then the solvent was removed under reduced pressure to give the crude residue Intermediate (R)-21a (LC / MS: 286.1 [M+H]), which was used directly in the next step without further purification.

[0402] Intermediate (R)-21a is dissolved in acetonitrile (10V). Intermediate 19 (1 equivalent) is added, followed by TCFH (2 equivalents). The suspension is placed in a RT water bath and N-methylimidazole (5 equivalents) is added dropwise. The solution is stirred at room temperature for 1 hour, at which point LC / MS analysis indicates complete conversion to intermediate (R)-21b (LC / MS: 507.2 [M+H]). Hydrazine hydrate (50 equivalents) is then added immediately and allowed to stir at room temperature for 30 minutes, at which point water (5V) is added. The resulting precipitate is filtered and dried under reduced pressure to give Example 35. 1 H NMR (400MHz, DMSO-d6) δ8.69(d,J=4.9Hz,1H),8.54(d,J=6.6Hz,1H),8.10-7.84(m,4H),7.58(s,2H),7.51-7.24(m,3H),4.90(t,J=7.5Hz,1H), 3.77(p,J=8.2Hz,1H), 3.46(ddt,J=34.0,17.5,8.7Hz,3H), 3.20(ddd,J=59.1,16.3,8.3Hz,2H), 2.80(d,J=16.9Hz,1H), 1.30(d,J=6.2Hz,3H). LC / MS: 452.1[M+H].

[0403] Preparation of intermediate 22:

[0404]

[0405] Intermediate 22 was prepared in a manner analogous to Example 1 employing indoline-6-sulfonamide instead of Intermediate 1 and using 5-bromo-2,3-dihydrobenzofuran-2-carboxylic acid instead of Intermediate 2 (Method A). LC / MS: 423.0 [M+H].

[0406] Preparation Example 36:

[0407]

[0408] Example 36 was prepared in a manner similar to Example 71 using Intermediate 22 instead of Intermediate 35. 1H NMR (400MHz, DMSO-d6) δ8.63(dd,J=4.8,1.4Hz,1H),8.54(d,J=1.7Hz,1H),8.01(d,J =1.8Hz,1H),7.92(d,J=5.6Hz,2H),7.89(d,J=2.1Hz,1H),7.52(dd,J=7.8,1.7Hz,1H) ,7.45(d,J=7.8Hz,1H),7.34(t,J=5.8Hz,1H),7.31(s,2H),6.98(d,J=8.4Hz,1H),5.7 8(dd,J=9.7,6.5Hz,1H),4.47-4.27(m,2H),3.69-3.60(m,2H),3.30(t,J=8.6Hz,2H). LC / MS: 422.1[M+H].

[0409] Preparation of intermediate 23:

[0410]

[0411] Intermediate 23 was prepared in a similar manner to Intermediate 22 using Intermediate 9 instead of indoline-6-sulfonamide. LC / MS: 441.0 [M+H].

[0412] Preparation Example 37:

[0413]

[0414] Example 37 was prepared in a manner similar to Example 71 using Intermediate 23 instead of Intermediate 22. 1 H NMR (400MHz, DMSO-d6) δ8.65(dt,J=5.1,1.4Hz,1H),8.51(d,J=6.7Hz,1H),7.99(dd,J=7.9,2.8Hz,3H),7.90(dd,J=8.4,2.0Hz,1H),7.60(s ,2H),7.40(t,J=6.7Hz,2H),7.00(d,J=8.4Hz,1H),5.78(dd,J=9.7,6.5Hz,1H),4.47-4.24(m,2H),3.67-3.56(m,2H),3.31(t,J=8.7Hz,2H). LC / MS: 440.1[M+H].

[0415] Preparation Example 38: (R)-5-bromo-2-methyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0416]

[0417] Intermediate 24.1 was prepared in a manner analogous to Intermediate 21.2 using (R)-5-bromo-2-methylindoline instead of Intermediate 21.1 as starting material. LC / MS: 254.0 [M+H].

[0418] Intermediate 24.2 was prepared in a manner analogous to Intermediate 21.3 using Intermediate 24.1 instead of Intermediate 21.2 as starting material. LC / MS: 333.0 [M+H].

[0419] Intermediate 24.3 was prepared in a manner analogous to Intermediate 21.4 using Intermediate 24.2 instead of Intermediate 21.3 as starting material. LC / MS: 291.0 [M+H].

[0420] Example 38 was prepared in a manner similar to Example 35 using Intermediate 24.3 instead of Intermediate (R)-21 as starting material. 1 H NMR (400MHz, DMSO-d6) δ8.80 (s, 1H), 8.69 (d, J = 4.9Hz, 1H), 8.10-7.91 (m, 3H), 7.88 (d,J=7.8Hz,1H),7.73(s,1H),7.50(s,2H),7.45(q,J=6.1,4.3Hz,1H),7.36(d,J=7. 9Hz,1H),4.90(p,J=6.6Hz,1H),3.77(p,J=8.3Hz,1H),3.46-3.38(m,1H),3.47-3.32 (m, 3H), 3.13 (dd, J = 16.2, 7.6Hz, 1H), 2.81 (d, J = 16.8Hz, 1H), 1.30 (d, J = 6.3Hz, 3H). LC / MS: 512.1[M+H].

[0421] Preparation of Intermediate 25: tert-Butyl ((5-fluoroindolin-6-yl)(methyl)(oxo)-16-sulfanylidene)carbamate

[0422]

[0423] Preparation of Intermediate 25.1: To a solution of 5,6-difluoroindoline-2,3-dione (200 g, 1.09 mol) in DMF (5 V) was added sodium thiomethoxide (153 g, 2.0 equiv). The solution was stirred at 80 °C for 16 h, at which time water (15 V) was added, and the mixture was extracted with EtOAc (2 x 600 mL). The combined organic fractions were washed with brine and dried over sodium sulfate, filtered, and concentrated to provide Intermediate 25.1, which was used without further purification. LC / MS: 212.0 [M+H].

[0424] Preparation of Intermediate 25.2: To a solution of Intermediate 25.1 (100 g, 473 mmol) in THF (6 V) was added lithium aluminum hydride (35.9 g, 2.0 equiv) at 0 °C. The mixture was warmed to room temperature and stirred for 16 hours, at which time the reaction was carefully quenched by the addition of water (38 mL), 15% aqueous sodium hydroxide solution (38 mL), and water (114 mL) sequentially. The crude residue was extracted with EtOAc (2 x 300 mL), and the combined organic fractions were washed with brine, dried over sodium sulfate, filtered, and concentrated. The crude residue was purified using flash column chromatography on silica gel to give Intermediate 25.2. LC / MS: 182.0 [M+H].

[0425] Preparation of Intermediate 25.3: To a solution of Intermediate 25.2 (26 g, 143 mmol) in acetic acid (5 V) was added sodium cyanoborohydride (27.1 g, 3.0 equiv). The mixture was stirred at room temperature for 1 hour, at which time water (400 mL) was added, and the mixture was extracted with EtOAc (2 x 150 mL). The combined organic fractions were washed with brine, dried over sodium sulfate, filtered and concentrated. The crude residue was purified by flash column chromatography on silica gel to give Intermediate 25.3. LC / MS: 184.1 [M+H].

[0426]

[0136] Preparation of Intermediate 25.4: To a solution of Intermediate 25.3 (20.0 g, 109 mmol) in THF (6 V) was added 1-[2-(tert-methylsilyl)ethoxycarbonyloxy]pyrrolidine-2,5-dione (56.6 g, 2.0 equiv) and DMAP (13.3 g, 1.0 equiv). The solution was stirred at room temperature for 16 hours, at which time water (100 mL) was added and the residue was extracted with dichloromethane (2 x 50 mL). The combined organic fractions were washed with brine, dried over sodium sulfate, filtered and concentrated. The crude residue was then purified by flash column chromatography on silica gel to give Intermediate 25.4. LC / MS: 328.1 [M+H].

[0427] Preparation of Intermediate 25.5: To a solution of Intermediate 25.4 (20.0 g, 61 mmol) in dichloromethane (6V) at 0°C was added m-chloroperoxybenzoic acid (13.6 g, 1.1 equiv). The solution was warmed to room temperature and stirred for 2 hours, at which time the reaction was filtered and the resulting filtrate was quenched with saturated sodium sulfite solution (100 mL). The resulting residue was extracted with dichloromethane (2×50 mL). The combined organic fractions were washed with brine, dried over sodium sulfate, filtered and concentrated. The crude residue was purified by flash column chromatography on silica gel to give Intermediate 25.5. LC / MS: 344.1 [M+H].

[0428] Preparation of Intermediate 25.6: To a solution of Intermediate 25.5 (14.0 g, 40.7 mmol) in dichloromethane (6 V) was added magnesium oxide (8.21 g, 5.0 equiv), (diacetoxyiodo)benzene (19.7 g, 1.5 equiv), tert-butyl carbamate (9.55 g, 2.0 equiv), and dirhodium tetraacetate (900 mg, 0.05 equiv). The mixture was stirred at 40 C for 16 h, at which time water was added and the mixture was extracted with dichloromethane (2 x 30 mL). The combined organic fractions were washed with brine, dried over sodium sulfate, filtered and concentrated. The crude residue was purified by flash column chromatography on silica gel to give Intermediate 25.6. LC / MS: 459.2 [M+H].

[0429] Preparation of Intermediate 25: To a solution of Intermediate 25.6 (2.0 g, 4.4 mmol) in THF (10 V) was added tetrabutylammonium fluoride (1.0 M solution in THF, 4.8 mL, 1.1 equiv). The solution was stirred at room temperature for 1 hour, and then water (10 mL) was added. The mixture was extracted with EtOAc (2×50 mL). The combined organic fractions were washed with brine, dried over sodium sulfate, filtered, and concentrated. The crude residue was purified using flash column chromatography on silica gel to give Intermediate 25. LC / MS: 315.1 [M+H].

[0430] Preparation Example 39 (General Procedure B): (5-Fluoro-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indolin-6-yl)(imino)(methyl)-λ 6 -Sulfone Ketone

[0431]

[0432] To a suspension of Intermediate 25 (500 mg, 1.6 mmol), Intermediate 19 (381 mg, 1.0 eq.), and TCFH (535 mg, 1.2 eq.) in acetonitrile (10 V) was added N-methylimidazole (0.63 mL, 5.0 eq.). The resulting solution was stirred at room temperature for 15 minutes, concentrated, and purified by flash column chromatography on silica gel to give Intermediate 25.7. LC / MS: 536.2 [M+H].

[0433] A solution of intermediate 25.7 (980 mg, 1.8 mmol) in dichloromethane (10 V) and trifluoroacetic acid (10 V) was stirred at room temperature for 1 hour and then concentrated. The resulting residue was purified by reverse phase HPLC to give Example 39. 1HNMR (400MHz, DMSO-d6) δ8.70(d,J=5.0Hz,1H),8.63(d,J=6.6Hz,1H),8.02(d,J=4.1Hz,2H),7.95(s,1H),7.88(d,J =7.9Hz,1H),7.50-7.42(m,2H),7.39(d,J=7.9Hz,1H),4.36(t,J=8.6Hz,2H),3.83-3.71(m,1H),3.33-3.22(m,9H). LC / MS: 436.1[M+H].

[0434] Preparation Example 40 (R)-(5-fluoro-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indole-2-carbonyl)indolin-6-yl)(imino)(methyl)-16-sulfone ketone and 41 (S)-(5-fluoro-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indole-2-carbonyl)indolin-6-yl)(imino)(methyl)-16-sulfone ketone:

[0435]

[0436] Example 39 was subjected to chiral SFC separation using an OJ-H 4.6 x 100 mm column with 50% EtOH as co-solvent. Example 40 was obtained as the first eluent. 1 H NMR (400 MHz, DMSO-d6) δ 8.64 (dt, J = 9.7, 4.0 Hz, 2H), 8.01-7.86 (m, 4H), 7.44-7.23 (m, 3H), 4.57 (s, 1H), 4.35 (t, J = 8.5 Hz, 2H), 3.75 (p, J = 8.2 Hz, 1H), 3.32-3.22 (m, 5H), 3.13 (s, 3H). LC / MS: 436.1 [M+H]. Example 41 was obtained as the second eluent. 1 H NMR (400MHz, DMSO-d6) δ8.70-8.65(m,1H),8.62(d,J=6.7Hz,1H),8.01-7.93(m,3H),7.93-7.86(m,1H ),7.45-7.27(m,3H),4.35(t,J=8.6Hz,2H),3.75(p,J=8.1Hz,1H),3.30(p,J=7.7Hz,5H),3.22(s,3H). LC / MS: 436.1[M+H].

[0437] Preparation of intermediate 26

[0438]

[0439] Intermediate 26 was prepared in a similar manner to Intermediate 23 using Intermediate (R)-21 as the starting material instead of Intermediate 9. LC / MS: 455.0 [M+H].

[0440] Preparation Example 42: (2R)-5-Fluoro-2-methyl-1-(5-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)indoline-6-sulfonamide

[0441]

[0442] Example 42 was prepared in a similar manner to Example 36 using Intermediate 26 instead of Intermediate 22 as starting material (General Procedure A). 1 H NMR (400MHz, DMSO-d6) δ8.67(d,J=5.0Hz,1H),8.47(d,J=6.5Hz,1H),8.03(t,J=9.0H z,3H),7.98(s,1H),7.88(d,J=8.6Hz,1H),7.60(s,2H),7.50-7.40(m,2H),7.00(t,J= 11.4,8.5Hz,1H),5.87-5.76(m,1H),5.05(p,J=6.8Hz,1H),4.90(p,J=6.7Hz,1H),3. 72-3.45(m,3H),2.84(d,J=16.9Hz,1H),1.36(d,J=6.3Hz,2H),1.32(d,J=6.5Hz,1H). LC / MS: 454.1[M+H].

[0443] Preparation Examples 43 and 44:

[0444]

[0445] Example 42 was subjected to chiral SFC purification using an OD-H 4.6 x 100 mm column with 50% MeOH as co-solvent.

[0446] Example 43 was obtained as the first eluent. 1H NMR (400 MHz, DMSO-d6) δ 8.63 (dd, J = 4.7, 1.5 Hz, 1H), 8.48 (d, J = 6.6 Hz, 1H), 7.99 (s, 1H), 7.96-7.88 (m, 3H), 7.61 (s, 2H), 7.43 (d, J = 9.7 Hz, 1H), 7.38-7.33 (m, 1H), 6.98 (d, J = 8.4 Hz, 1H), 5.79 (dd, J = 9.9, 6.2 Hz, 1H), 4.96-4.86 (m, 1H), 2.84 (d, J = 16.9 Hz, 1H), 1.36 (d, J = 6.3 Hz, 3H), 3H under the water peak. LC / MS: 454.1 [M+H].

[0447] Example 44 was obtained as the second eluent. 1 H NMR (400 MHz, DMSO-d6) δ 8.63 (dd, J = 4.7, 1.6 Hz, 1H), 8.49 (d, J = 6.7 Hz, 1H), 8.03 (s, 1H), 7.95-7.86 (m, 3H), 7.62 (s, 2H), 7.44 (d, J = 9.7 Hz, 1H), 7.34 (ddd, J = 6.7, 4.8, 1.8 Hz, 1H), 6.95 (d, J = 8.3 Hz, 1H), 5.81 (dd, J = 9.5, 6.6 Hz, 1H), 5.05 (t, J = 7.4 Hz, 1H), 2.85 (d, J = 17.0 Hz, 1H), 1.32 (d, J = 6.4 Hz, 3H), 3H under the water peak. LC / MS: 454.1 [M+H].

[0448] Preparation Example 45: (R)-1-(5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0449]

[0450] Example 45 was prepared in a manner similar to Example 71 using Intermediate 37 instead of Intermediate 35 and 2,5-difluorophenylboronic acid instead of phenylboronic acid as starting materials. 1 H NMR (400 MHz, DMSO-d6) δ 8.59 (s, 1H), 7.46 (s, 1H), 7.44-7.38 (m, 2H), 7.35 (s, 4H), 7.27 (s, 2H), 4.33 (t, J = 8.5 Hz, 2H), 3.75 (t, J = 8.0 Hz, 1H), 6H under the water peak. LC / MS: 455.0 [M+H].

[0451] Preparation of intermediate 27:

[0452]

[0453] To a solution of 5-fluoro-2,3-dimethyl-1H-indole (2 g, 12.3 mmol, 1 eq) in AcOH (7 V) was added NaBH3CN (2 eq). The mixture was stirred at 20 °C for 3 h. The reaction mixture was concentrated to dryness and the crude product was purified by flash column chromatography on silica gel to give the trans-racemic intermediate 27. LC / MS: 166.1 [M+H].

[0454] Intermediate 27 was purified by chiral SFC using an OJ-H column and 10% heptane-MTBE as a co-solvent to obtain intermediate (2R,3S)-27 (first eluent, LC / MS: 166.1 [M+H]) and intermediate (2S,3R)-27 (second eluent, LC / MS: 166.1 [M+H]).

[0455] Preparative Example 46 (General Procedure C): (2R,3S)-5-Fluoro-2,3-dimethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0456]

[0457] Intermediate 27.1 was prepared in a manner similar to Example 1 using Intermediate (2R,3S)-27 and Intermediate 19 as starting materials. LC / MS: 387.2 [M+H].

[0458] Example 46 was prepared in a manner analogous to Intermediate 21.3 using Intermediate 27.1 as starting material instead of Intermediate 21.2. 1 H NMR(400MHz,DMSO-d6)δ8.70(d,J=5.0Hz,1H),8.54(d,J=6.6Hz,1H),8.05-7.95(m,3H ),7.89(dd,J=7.9,1.7Hz,1H),7.58(s,2H),7.45(d,J=9.2Hz,2H),7.37(d,J=7.9Hz,1 H),4.44(d,J=6.4Hz,1H),3.74(t,J=8.4Hz,1H),3.47(dd,J=16.0,8.9Hz,2H),3.26(d d,J=16.0,8.5Hz,1H),3.12-3.02(m,2H),1.30(d,J=6.3Hz,3H),1.25(d,J=7.0Hz,3H). LC / MS: 466.2[M+H].

[0459] Preparation Example 47: (2S,3R)-5-fluoro-2,3-dimethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0460]

[0461] Example 47 was synthesized in a similar manner to Example 46 using intermediate (2S,3R)-27 as the starting material instead of intermediate (2R,3S)-27 (General Procedure C). 1 H NMR (400MHz, DMSO-d6) δ8.65(d,J=4.9Hz,1H),8.54(d,J=6.6Hz,1H),7.91(dd,J=19.6,9.4Hz,4H),7.58(s,2H),7.45(d,J=9.8 Hz,1H),7.41-7.30(m,2H),4.44(d,J=6.4Hz,1H),3.73(s,1H),3.27-2.99(m,5H),1.29(d,J=6.4Hz,3H),1.25(d,J=6.7Hz,3H). LC / MS: 466.2[M+H].

[0462] Preparation of intermediate 28:

[0463]

[0464] To a solution of 5-fluoro-2,3-dimethyl-1H-indole (5 g, 30.6 mmol, 1 eq) in AcOH (30 mL) and HClO4 (30.8 g, 306.4 mmol, 18.5 mL, 10 eq) was added Pd / C (20 mol%). The mixture was degassed and purged with H2 for 3 times, and the mixture was stirred at 50 °C under H2 atmosphere (15 psi) for 24 h. After cooling to 0 °C, the mixture was basified by 6N NaOH until pH = 9. The mixture was extracted with DCM (40 mL×2). The organic layer was washed with brine (30 mL), dried over Na2SO4 and concentrated to give the crude product. The crude product was purified by flash column chromatography on silica gel to give cis racemic intermediate 28. LC / MS: 166.1 [M+H].

[0465] Intermediate 28 was purified by chiral SFC using an OJ-H column and 10% heptane-MTBE as a co-solvent to obtain intermediate (2R,3R)-28 (first eluent, LC / MS: 166.1 [M+H]) and intermediate (2S,3S)-28 (second eluent, LC / MS: 166.1 [M+H]).

[0466] Preparation Example 48: (2R,3R)-5-fluoro-2,3-dimethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0467]

[0468] Example 48 was prepared in a manner similar to Example 46 using intermediate (2R,3R)-28 instead of intermediate (2R,3S)-27 as starting material (General Procedure C). 1 H NMR(400MHz, DMSO-d6)δ8.73(d,J=5.1Hz,1H),8.48(dd,J=6.6,4.8Hz,1H),8.21-8.00(m,2H), 7.96(s,1H),7.87(dd,J=7.9,1.7Hz,1H),7.58(s,2H),7.53-7.43(m,1H),7.38(dd,J=9.1,4.1H z,2H),4.89(p,J=6.8Hz,1H),3.76(ddd,J=25.1,15.6,9.2Hz,2H),3.55-3.34(m,2H),3.28(dd, J=16.0,8.6Hz,1H),3.14(dd,J=16.4,7.6Hz,1H),1.33(t,J=7.0Hz,3H),1.14(t,J=6.4Hz,3H). LC / MS: 466.2[M+H].

[0469] Preparation Example 49 (General Procedure C): (2S,3S)-5-Fluoro-2,3-dimethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0470]

[0471] Example 49 was prepared in a manner similar to Example 46 using Intermediate (2S,3S)-28 instead of Intermediate (2R,3S)-27 as the starting material. 1H NMR(400MHz,DMSO-d6)δ8.72(d,J=5.0Hz,1H),8.48(d,J=6.5Hz,1H),8.15-8.03(m,2H ),7.96-7.82(m,2H),7.58(s,2H),7.55-7.50(m,1H),7.40(dd,J=21.6,8.8Hz,2H),4.9 0(t,J=7.2Hz,1H),3.75(dp,J=15.3,7.8,7.4Hz,2H),3.45(ddd,J=31.5,16.2,8.1Hz, 2H), 3.21 (ddd, J=36.4, 16.1, 8.0Hz, 2H), 1.32 (d, J=7.1Hz, 3H), 1.14 (d, J=6.4Hz, 3H). LC / MS: 466.2[M+H].

[0472] Preparation of intermediate 29:

[0473]

[0474] Preparation of Intermediate 29.1: Chiral SFC purification of 5-bromo-2,3-dihydro-1H-indene-2-carboxylic acid using an IB column and 5% MeOH as a co-solvent. The second eluent was collected to provide Intermediate 29.1. LC / MS: 263.0 [M+Na].

[0475] Preparation of Intermediate 29.2: Intermediate 29.2 was prepared in a manner analogous to Intermediate (R)-21b using Intermediate 29.1 as starting material instead of Intermediate 19. LC / MS: 508.1 [M+H].

[0476] Preparation of intermediate 29: To a solution of intermediate 29.2 (1.0 g, 1.98 mmol) in THF (5 V) was added hydrazine hydrate (50 equiv). The solution was stirred at room temperature for 30 min and then concentrated under reduced pressure. The crude residue was purified using flash column chromatography on silica gel to give intermediate 29. LC / MS: 453.0 [M+H].

[0477] Preparation Example 50: (R)-1-((R)-5-(2-chloro-5-fluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-5-fluoro-2-methylindoline-6-sulfonamide

[0478]

[0479] Example 50 was prepared in a manner similar to Example 69 using Intermediate 29 and 2-chloro-5-fluorophenylboronic acid as starting materials. 1H NMR (400MHz, DMSO-d6) δ8.54(d,J=6.5Hz,1H),7.57(s,2H),7.38(d,J=9.8Hz ,1H),7.29(t,3H),7.23(d,J=10.0Hz,2H),4.89(q,J=7.7,7.1Hz,1H),3.76( p,J=8.2Hz,1H),3.51(dd,J=16.9,9.0Hz,1H),3.23(dd,J=15.6,8.4Hz,1H), 3.11(dd,J=16.2,7.7Hz,1H), 2.79(d,J=16.9Hz,1H), 1.28(d,J=6.1Hz,3H). LC / MS: 503.1[M+H].

[0480] Preparation Example 51 (General Procedure B): (1-((R)-5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-5-fluoroindolin-6-yl)(imino)(methyl)-λ 6 -Sulfone Ketone

[0481]

[0482] Intermediate 30.1 was prepared in a manner analogous to Intermediate 25.8 using Intermediate 29.1 as starting material instead of Intermediate 19. LC / MS: 537.1 [M+H].

[0483] Intermediate 30.2 was prepared in a manner analogous to Example 69 using Intermediate 30.1 and 2,5-difluorophenylboronic acid as starting materials. LC / MS: 571.2 [M+H].

[0484] Intermediate 30.2 (106 mg, 0.19 mmol) was dissolved in dichloromethane (5 V) and trifluoroacetic acid (5 V). The solution was stirred at room temperature for 5 minutes and concentrated under reduced pressure. The resulting residue was purified using reverse phase HPLC to give Example 51. 1 HNMR (400MHz, DMSO-d6) δ8.63 (d, J = 6.6 Hz, 1H), 7.48-7.30 (m, 7H), 7.30-7.15 (m, 1H), 4.35 (t, J = 8.6 Hz, 2H), 3.75 (p, J = 7.9 Hz, 1H), 3.44-3.14 (m, 9H). LC / MS: 471.2[M+H].

[0485] Preparation Examples 52 and 53:

[0486]

[0487] Example 51 was subjected to chiral SFC purification using an OJ-H column with 40% EtOH as a co-solvent. Example 52 was obtained as the first eluent. 1 H NMR (400 MHz, DMSO-d6) δ 8.62 (d, J = 6.7 Hz, 1H), 7.47-7.29 (m, 7H), 7.29-7.15 (m, 1H), 4.34 (t, J = 8.5 Hz, 2H), 3.75 (p, J = 8.0 Hz, 1H), 3.28 (q, J = 7.6, 6.5 Hz, 6H), 3.15 (s, 3H). LC / MS: 471.2 [M+H]. Example 53 was obtained as the second eluent. 1 H NMR(400MHz,DMSO-d6)δ8.62(d,J=6.7Hz,1H),7.47-7.28(m,7H),7.28-7.15(m,1 H), 4.34 (t, J = 8.6 Hz, 2H), 3.75 (p, J = 8.0 Hz, 1H), 3.30-3.19 (m, 6H), 3.14 (s, 3H). LC / MS: 471.2[M+H].

[0488] Preparation of intermediate 31:

[0489]

[0490] Intermediate 31.1 was prepared in a manner similar to Intermediate 22 using Intermediate 4 as starting material instead of indoline-6-sulfonamide. LC / MS: 437.0 [M+H].

[0491] Intermediate 31 was prepared in a similar manner to Example 71 using Intermediate 31.1 as starting material instead of Intermediate 35. LC / MS: 436.1 [M+H].

[0492] Preparation Examples 56 and 57:

[0493]

[0494] Intermediate 31 was purified by chiral SFC using an OJ-H 4.6 x 100 mm column with 45% MeOH-DEA as co-solvent.

[0495] Example 56 was obtained as the second eluent. 1H NMR (400MHz, DMSO-d6) δ8.61(ddd,J=4.8,1.8,1.0Hz,1H),8.52(s,1H),8.00(d,J=1.8Hz,1H),7.93-7.88( m,1H),7.87(t,J=1.2Hz,1H),7.83(td,J=7.7,1.8Hz,1H),7.56(dd,J=7.8,1.7Hz,1H),7.49(d,J=7.8Hz,1 H),7.30(s,2H),7.28(ddd,1H),6.96(d,J=8.4Hz,1H),5.79(dd,J=10.0,6.2Hz,1H),4.91(p,J=6.5Hz,1H) ,3.68(dd,J=15.8,9.8Hz,1H), 3.50(dt,J=14.9,6.8Hz,2H), 2.84(d,J=16.6Hz,1H), 1.37(d,J=6.3Hz,3H). LC / MS: 436.1[M+H].

[0496] Example 57 was obtained as the first eluent. 1 H NMR (400MHz, DMSO-d6) δ8.61(ddd,J=4.9,1.8,1.0Hz,1H),8.53(s,1H),8.04(d,J=1.8Hz,1H),7.93-7.88(m,1H),7. 87(t,J=1.2Hz,1H),7.83(td,J=7.6,1.8Hz,1H),7.57(dd,J=7.9,1.7Hz,1H),7.50(d,J=7.8Hz,1H),7.32(s,2H),7.2 8(ddd,J=7.2,4.8,1.3Hz,1H),6.93(d,J=8.6Hz,1H),5.82(dd,J=9.6,6.6Hz,1H),5.06(t,J=7.5Hz,1H),3.67(dd,J= 15.8, 6.5Hz, 1H), 3.59 (dd, J = 17.8, 9.4Hz, 1H), 3.52 (d, J = 8.6Hz, 1H), 2.85 (d, J = 16.4Hz, 1H), 1.33 (d, J = 6.3Hz, 3H). LC / MS: 436.1[M+H].

[0497] Preparation Example 58: (R)-1-(5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-5-fluoroindoline-6-sulfonamide

[0498]

[0499] Intermediate 32 was prepared in a similar manner to Intermediate 29 using Intermediate 9 and Intermediate 29.1 as starting materials. LC / MS: 439.0 [M+H].

[0500] Example 58 was prepared in a manner similar to Example 50 using intermediate 32 and 2,5-difluorophenylboronic acid as starting materials. 1 H NMR (400 MHz, DMSO-d6) δ 8.56 (d, J = 6.7 Hz, 1H), 7.57 (s, 2H), 7.43 (s, 1H), 7.41-7.32 (m, 5H), 7.25 (dq, J = 8.9, 5.1, 4.3 Hz, 1H), 4.33 (t, J = 8.5 Hz, 2H), 3.73 (d, J = 8.0 Hz, 1H), 6H under the water peak. LC / MS: 473.1 [M+H].

[0501] Preparation of intermediate 33:

[0502]

[0503] Intermediate 32 was prepared in a similar manner to Intermediate 21 using 5-chloro-2-methylindole instead of 5-fluoro-2-methylindole as starting material. LC / MS: 247.0 [M+H].

[0504] Chiral SFC separation of intermediate 32 was performed using a ChiralPak IG column with 60% MeOH as co-solvent.

[0505] Intermediate (R)-32 was obtained as the first eluent. LC / MS: 247.0 [M+H].

[0506] Intermediate (S)-32 was obtained as the second eluting agent. LC / MS: 247.0 [M+H].

[0507] Preparative Example 59 (General Procedure B): (S)-5-chloro-2-methyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0508]

[0509] Example 59 was prepared in a manner similar to Example 35 using Intermediate (S)-32 and Intermediate 19 as starting materials. 1H NMR(400MHz,DMSO-d6)δ8.76(s,1H),8.72-8.62(m,1H),8.05-7.85(m,4H),7.59-7.32(m,5 H), 4.91 (t, J = 7.3Hz, 1H), 3.53-3.06 (m, 6H), 2.81 (d, J = 16.9Hz, 1H), 1.30 (d, J = 6.3Hz, 3H). LC / MS: 468.2[M+H].

[0510] Preparative Example 60 (General Procedure B): (R)-5-chloro-2-methyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0511]

[0512] Example 60 was prepared in a manner similar to Example 35 using Intermediate (R)-32 and Intermediate 19 as starting materials. 1 H NMR (400MHz, DMSO-d6) δ8.75 (s, 1H), 8.70 (dt, J = 5.0, 1.4Hz, 1H), 8.11-7. 80(m,4H),7.62-7.26(m,5H),4.90(t,J=7.5Hz,1H),3.78(p,J=8.1Hz,1H), 3.46(dtd,J=22.5,15.3,13.7,8.1Hz,3H),3.28(dd,J=16.1,8.5Hz,1H),3 .13(dd,J=16.3,7.7Hz,1H), 2.81(d,J=16.8Hz,1H), 1.30(d,J=6.3Hz,3H). LC / MS: 468.2[M+H].

[0513] Preparation Example 61: (R)-1-((R)-5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-5-fluoro-2-methylindoline-6-sulfonamide

[0514]

[0515] Example 61 was prepared in a manner similar to Example 50 using 2,5-difluorophenylboronic acid instead of 2-chloro-5-fluorophenylboronic acid as the starting material. 1H NMR (400 MHz, DMSO-d6) δ 8.54 (d, J = 6.7 Hz, 1H), 7.58 (s, 2H), 7.45 (s, 1H), 7.42-7.30 (m, 5H), 7.28-7.21 (m, 1H), 4.88 (q, J = 7.1 Hz, 1H), 3.81-3.71 (m, 1H), 3.51 (dd, J = 17.0, 8.9 Hz, 1H), 3.25 (dd, J = 15.9, 8.5 Hz, 1H), 3.11 (dd, J = 16.1, 7.7 Hz, 1H), 2.80 (d, J = 16.9 Hz, 1H), 1.29 (d, J = 6.3 Hz, 3H), 2H under the water peak. LC / MS: 487.1 [M+H].

[0516] Preparation Example 62: (R)-5-Fluoro-2-methyl-1-((R)-5-(2,3,5-trifluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0517]

[0518] Example 62 was prepared in a manner similar to Example 50 using 2,3,5-trifluorophenylboronic acid instead of 2-chloro-5-fluorophenylboronic acid as the starting material. 1 H NMR (400 MHz, DMSO-d6) δ 8.54 (d, J = 6.7 Hz, 1H), 7.58 (s, 2H), 7.54 (dd, J = 9.7, 5.1 Hz, 1H), 7.40 (s, 1H), 7.36 (d, J = 6.8 Hz, 2H), 7.27 (dd, J = 9.2, 4.0 Hz, 2H), 4.89 (t, J = 7.6 Hz, 1H), 3.77 (q, J = 8.3 Hz, 1H), 3.52 (dd, J = 16.8, 8.8 Hz, 1H), 3.13 (dd, J = 16.1, 7.8 Hz, 1H), 2.80 (d, J = 16.8 Hz, 1H), 1.29 (d, J = 6.3 Hz, 3H), 3H under the water peak. LC / MS: 505.1 [M+H].

[0519] Preparation Example 63: (R)-2,5-dimethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0520]

[0521] To a solution of Example 38 (40 mg, 0.047 mmol) in DMF (10 V) was added tetramethyltin (5 eq). The mixture was sparged with argon for 10 min and then heated to 90° C. After stirring at that temperature for 1 hour, the solution was cooled to room temperature, filtered, and purified by reverse phase HPLC to give Example 63.

[0522] Preparation of intermediate 33:

[0523]

[0524] To a solution of 6-bromoindolin-2-one (10 g, 47.2 mmol, 1 eq) and diisopropylamine (10.5 g, 103.7 mmol, 14.6 mL, 2.2 eq) in THF (100 mL) was added n-BuLi (2.5 M in hexane, 41.5 mL, 2.2 eq) dropwise at -40 °C. The mixture was stirred at -40 °C for 45 min, then 1,2-dibromoethane (26.5 g, 141.4 mmol, 10.6 mL, 3 eq) was added dropwise and stirring was continued for 16 h while the temperature was slowly raised to 20 °C. The reaction mixture was poured into 2N NH4Cl (100 mL), and then the mixture was extracted with ethyl acetate (100 mL×2). The combined organic layers were washed with brine (50 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give a residue. The residue was purified by reverse phase-MPLC (Agela C18 800 g silica, 35-65% ethanol in hexanes, gradient over 30 min) to give Intermediate 33.1. LC / MS: 238.0 [M+H].

[0525] To a solution of intermediate 33.1 (3 g, 12.6 mmol, 1 eq) in THF (60 mL) was added LiAlH4 (1.4 g, 37.8 mmol, 3 eq) at 0 °C. The mixture was stirred at 60 °C for 1 h. After cooling to 0-10 °C, 1.5 mL of water, 1.5 mL of 1 N NaOH and 4.5 mL of water were added to the solution. The mixture was filtered through celite and the filtrate was concentrated in vacuo to give intermediate 33.2 (LC / MS: 224.0 [M+H]), which was used in the next step without further purification.

[0526] To a solution of intermediate 32.2 (1.9 g, 8.4 mmol, 1 eq) in THF (20 mL) was added TEA (1.3 g, 12.7 mmol, 1.7 mL, 1.5 eq) and Boc2O (2.7 g, 12.7 mmol, 2.9 mL, 1.5 eq). The mixture was stirred at 30 °C for 12 h. The reaction mixture was concentrated to dryness to give a crude product. The crude product was purified by flash column chromatography on silica gel to give intermediate 33.3 LC / MS: 324.0 [M+H].

[0527] To a solution of intermediate 33.3 (2.6 g, 8.1 mmol, 1 eq) in dioxane (50 mL) was added BnSH (1.5 g, 12.0 mmol, 1.4 mL, 1.5 eq), DIEA (2.0 g, 16.0 mmol, 2.7 mL, 2 eq), Pd2(dba)3 (367.1 mg, 400.9 umol, 0.05 eq) and Xantphos (464.0 mg, 801.9 umol, 0.1 eq). The mixture was stirred at 120 °C under an argon atmosphere for 12 h. The reaction mixture was concentrated to dryness to give a crude product, which was purified by flash column chromatography on silica gel to give intermediate 33.4. LC / MS: 368.2 [M+H].

[0528] To a solution of intermediate 33.4 (1.5 g, 4.0 mmol, 1 eq) in AcOH (15 mL) and water (5 mL) was added NCS (1.6 g, 12.2 mmol, 3 eq). The mixture was stirred at 20 °C for 5 h. 30 mL of water was added to the reaction and the reaction mixture was extracted with ethyl acetate (40 mL x 2). The combined organic layers were washed with brine (30 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give a crude residue which was purified by flash column chromatography on silica gel to give intermediate 33.5. LC / MS: 344.1 [M+H].

[0529] A solution of intermediate 33.5 (1.0 g, 3.0 mmol, 1 eq) in THF (10 mL) and NH3.H2O (5 mL, 30% purity) was stirred at 20 °C for 12 h. The reaction mixture was concentrated to remove THF. Then, 10 mL of water was added to the reaction mixture to form a precipitate, which was collected by filtration, and the filter cake was washed with water (10 mL x 2) and dried under reduced pressure to give intermediate 33.6. LC / MS: 325.1 [M+H].

[0530] A solution of intermediate 33.6 (880 mg, 2.7 mmol) in 4M HCl / EtOAc (20 mL) was stirred at 20° C. for 1 h. The reaction mixture was filtered, and the filter cake was washed with EtOAc (5 mL×2) and dried under reduced pressure to give intermediate 33. LC / MS: 225.1 [M+H].

[0531] Preparative Example 64 (General Procedure A): (R)-1'-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)spiro[cyclopropane-1,3'-indoline]-6'-sulfonamide

[0532]

[0533] Example 64 was prepared in the manner of Example 60 using Intermediate 19 and Intermediate 33 as starting materials. 1 H NMR(400MHz, DMSO-d6)δ8.65(ddd,J=4.7,1.9,0.9Hz,1H),8.59(d,J=1.8Hz,1H),8.01-7.81(m,4H),7.45(dd,J=7.9,1.7Hz,1H), 7.41-7.30(m,2H),7.26(s,2H),6.99(d,J=7.9Hz,1H),4.37(s,2H),3.68(p,J=8.1Hz,1H),3.42-3.20(m,4H),1.33-1.09(m,4H). LC / MS: 446.2[M+H].

[0534] Preparation of intermediate 34:

[0535]

[0536] Intermediate 34 was prepared in a manner similar to Example 36 using 6-bromo-2,3-dihydrobenzofuran-2-carboxylic acid and Intermediate 9 as starting materials. LC / MS: 440.1 [M+H].

[0537] Preparation Example 65: (S)-5-Fluoro-1-(6-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)indoline-6-sulfonamide

[0538]

[0539] Intermediate 34 was purified by chiral SFC using an OD-H column with 50% MeOH as co-solvent.

[0540] Example 65 was obtained as the first eluent. 1H NMR (400MHz, DMSO-d6) δ8.68 (dt, J=4.9, 1.4Hz, 1H), 8.51 (d, J=6.6Hz, 1H), 8.04-7. 99(m,1H),7.97(dd,J=8.1,1.8Hz,1H),7.63(dd,J=7.8,1.6Hz,1H),7.60(s,2H),7.5 4 (d, J = 1.5 Hz, 1H), 7.44 (ddd, J = 6.8, 4.9, 1.7 Hz, 1H), 7.40 (s, 1H), 7.38 (d, J = 3.1 Hz, 1H), 5.75 (dd, J = 9.7, 6.4 Hz, 1H), 3.66-3.51 (m, 2H), 3.31 (t, J = 8.6 Hz, 2H), 2H under the water peak. LC / MS: 440.1 [M+H].

[0541] Preparation of intermediates (R)-17 and (S)-17:

[0542]

[0543] Intermediate 17 was purified by chiral SFC using a ChiralPak IG column with 45% MeOH as co-solvent.

[0544] The intermediate (R)-17 was collected as the first eluent. LC / MS: 227.1 [M+H].

[0545] Intermediate (S)-17 was collected as the second eluent. LC / MS: 227.1 [M+H].

[0546] Preparative Example 68 (General Procedure A): (R)-2-ethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0547]

[0548] Example 68 was prepared in a manner similar to Example 35 using Intermediate (R)-17. 1H NMR(400MHz, DMSO-d6)δ8.71(dq,J=4.8,1.6Hz,1H),8.60-8.48(m,1H),8.05(td,J=4.6,4.2,1.5Hz,2H ),7.99-7.85(m,2H),7.51(td,J=6.8,5.9,2.9Hz,2H),7.44(d,J=7.9Hz,1H),7.37(d,J=7.9Hz,1H),7. 29(s,2H),4.72(td,J=8.5,3.4Hz,1H),3.78(p,J=8.2Hz,1H),3.55-3.34(m,3H),3.26(dt,J=17.1,8.7 Hz, 1H), 3.13 (dd, J = 16.3, 7.8Hz, 1H), 2.96 (d, J = 16.8Hz, 1H), 1.78-1.46 (m, 2H), 0.89 (t, J = 7.3Hz, 3H). LC / MS: 448.2[M+H].

[0549] Preparation of Intermediate 35: 1-(5-bromo-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0550]

[0551] Intermediate 35 was prepared by general procedure A using 5-bromo-2,3-dihydro-1H-indene-2-carboxylic acid and indoline-6-sulfonamide. 1 H NMR(400MHz, DMSO-d6)δ8.57(d,J=1.7Hz,1H),7.54-7.23(m,6H),7.20(d,J=8.1H z, 1H), 4.30 (t, J = 8.5Hz, 2H), 3.72 (p, J = 8.0Hz, 1H), 3.21 (dt, J = 26.0, 7.5Hz, 6H). LCMS:420.96[M+H].

[0552] Preparation Example 69: 1-(5-phenyl-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0553]

[0554] To a stirred solution of intermediate 35 (30 mg, 0.071 mmol) in DMF (1 ml) and water (0.2 ml) was added phenylboronic acid (10.5 mg, 1.2 equiv), tetrakis(triphenylphosphine)palladium(0) (12.3 mg, 0.15 equiv), potassium carbonate (24.6 mg, 2.5 equiv). The mixture was purged with argon and then heated to 90 ° C. After the reaction was complete (judged by LCMS). The mixture was cooled to room temperature. The mixture was diluted with EtOAc (10 V) and water (10 V). The organic layer was dried (MgSO4) and evaporated in vacuo to obtain the crude product. The crude residue was purified by reverse phase HPLC to give Example 69. 1 HNMR (400MHz, DMSO-d6) δ8.60 (d, J=1.6Hz, 1H), 7.68-7.59 (m, 2H), 7.55-7. 20(m,10H),4.34(t,J=8.5Hz,2H),3.75(p,J=8.0Hz,1H),3.33-3.20(m,6H). LCMS:419.06[M+H].

[0555] Preparation Example 70: 1-(5-(2-fluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0556]

[0557] Example 70 was prepared in a manner similar to Example 69 using (2-fluorophenyl)boronic acid as the starting material instead of phenylboronic acid. 1 H NMR (400MHz, DMSO-d6) δ8.60 (d, J = 1.6 Hz, 1H), 7.59-7.19 (m, 11H), 4.34 (t, J = 8.5 Hz, 2H), 3.75 (q, J = 8.1 Hz, 1H), 3.41-3.12 (m, 6H). LCMS:437.04[M+H].

[0558] Preparation Example 71: 1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0559]

[0560] To a stirred suspension of intermediate 35 (30 mg, 0.071 mmol) in 1,4-dioxane (1 ml) was added tributyl(2-pyridyl)stannane (41.8 mg, 1.6 equiv), bis(tri-tert-butylphosphine)palladium(0) (3.6 mg, 0.1 equiv). The mixture was purged with argon and then heated to 90 °C. After the reaction was complete (judged by LCMS). The mixture was cooled to room temperature. The mixture was diluted with EtOAc (10 V) and water (10 V). The organic layer was dried (MgSO4) and evaporated in vacuo to obtain the crude. The crude residue was purified by reverse phase HPLC to give Example 71. 1 H NMR (400MHz, DMSO-d6) δ8.67 (d, J = 4.9Hz, 1H), 8.60 (s, 1H), 8.02-7.82 (m, 4H), 7.55-7. 33(m,4H),7.28(s,2H),4.35(t,J=8.5Hz,2H),3.76(q,J=8.1Hz,1H),3.35-3.22(m,6H). LCMS:420.19[M+H].

[0561] The following examples in Table IE were prepared in a manner similar to Example 71 using the appropriate arylstannane in place of tributyl(2-pyridyl)stannane as the starting material.

[0562] Table 1E

[0563]

[0564] Preparation Example 78: 1-(5-(1H-pyrazol-1-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0565]

[0566] To a stirred solution of intermediate 35 (50 mg, 0.12 mmol) in DMF (1 ml) was added 1H-pyrazole (16.2 mg, 2 eq.), copper (I) iodide (45.2 mg, 2.0 eq.), trans-N,N'-dimethyl-1,2-cyclohexanediamine (67.5 mg, 2.0 eq.), K2CO3 (29.4 mg, 4.0 eq.). The mixture was purged with argon and then heated at 105 °C overnight. The mixture was then cooled to room temperature, diluted with EtOAc (10 V) and H2O (10 V). The organic layer was dried (MgSO4) and evaporated in vacuo to obtain the crude. The crude residue was purified by reverse phase HPLC to give Example 78. 1HNMR (400MHz, DMSO-d6) δ8.60(d,J=1.6Hz,1H),8.44(d,J=2.5Hz,1H),7.71(t,J=2.7Hz,2H),7.63(dd,J=8.2,2.1Hz,1H),7.48(dd,J=7.9,1.7Hz,1H ),7.42(d,J=7.8Hz,1H),7.34(d,J=8.2Hz,1H),7.28(s,2H),6.52(t,J=2. 1Hz, 1H), 4.34 (t, J = 8.5Hz, 2H), 3.77 (p, J = 8.1Hz, 1H), 3.29-3.13 (m, 6H). LCMS:409.21[M+H].

[0567] Preparation Example 79: 1-(5-(1H-1,2,4-triazol-1-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0568]

[0569] Example 79 was prepared in a manner similar to Example 78 using 1H-1,2,4-triazole as the starting material instead of 1H-pyrazole. 1 H NMR (400MHz, DMSO-d6) δ9.24(s,1H),8.59(s,1H),8.22(s,1H),7.73(d,J=2.0Hz,1H),7.65(dd,J=8.1,2.0Hz,1H),7.48(dd, J=7.9,1.7Hz,1H),7.41(dd,J=8.0,3.2Hz,2H),7.28(s,2H),4.34(t,J=8.5Hz,2H),3.78(p,J=7.9Hz,1H),3.36-3.14(m,6H). LCMS:410.13[M+H].

[0570] Preparation Example 80: (S)-1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 81: (R)-1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0571]

[0572] The two single isomers were separated by SFC using a CCO-F2 column, 50% MeOH with NH3 to separate the racemic mixture Example 71. The first peak was designated as Example 80 and the second peak as Example 81.

[0573] Preparation Example 82: (S)-1-(5-(2-fluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 83: (R)-1-(5-(2-fluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0574]

[0575] The two single isomers were separated by SFC using a CCO-F2 column, 50% MeOH to separate the racemic mixture Example 70. The first peak was designated as Example 82 and the second peak as Example 83.

[0576] Preparation Example 85: (R)-1-(5-(6-fluoropyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0577]

[0578] The two single isomers were separated by SFC using a CCO-F2 column, 50% MeOH to separate the racemic mixture Example 75. The second peak fraction was designated as Example 85.

[0579] Preparation of Intermediate 36: (S)-1-(5-bromo-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Intermediate 37: (R)-1-(5-bromo-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0580]

[0581] The two single isomers were isolated by SFC separation of the racemic mixture intermediate 35 using an IB column, 30% MeOH with DEA. The first peak was assigned as intermediate 36 and the second peak was assigned as intermediate 37. The absolute stereochemistry of intermediate 37 was confirmed by coupling with tributyl(2-pyridyl)stannane using the same procedure as Example 71. The product co-eluted with Example 81 using the chiral separation conditions of Example 71.

[0582] Preparation Example 86: (S)-1-(5-(pyrazin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 87: (R)-1-(5-(pyrazin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0583]

[0584] Examples 86 and 87 were prepared using the same procedure as Example 71 from enantiomerically pure Intermediate 36 and Intermediate 37.

[0585] Preparation Example 88: (S)-1-(5-(3-fluoropyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 89: (R)-1-(5-(3-fluoropyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0586]

[0587] Examples 88 and 89 were prepared using the same procedure as Example 71 from enantiomerically pure intermediates 36 and 37, respectively.

[0588]

[0589] Example 90 was prepared in a manner similar to Example 71 using Intermediate 37 and 2-methyl-6-(tributylstannyl)pyridine as starting materials. 1 H NMR(400MHz,DMSO-d6)δ8.60(d,J=1.7Hz,1H),8.04-7.73(m,3H),7.56-7.19(m,7H ), 4.35 (t, J = 8.5Hz, 2H), 3.76 (q, J = 8.1Hz, 1H), 3.26 (d, J = 8.5Hz, 6H), 2.59 (s, 3H). LCMS:434.280[M+H].

[0590] Preparation Example 91: (R)-1-(5-(1H-pyrazol-1-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0591]

[0592] Example 91 was prepared in a manner similar to Example 78 using Intermediate 37 instead of Intermediate 35.

[0593] Preparation of intermediate 38 and its diastereomers (38.3 and 38.4):

[0594]

[0595] Preparation of Intermediate 38.1: To a stirred suspension of sodium hydride (0.68 g, 60% dispersion in oil, 2 eq.) in Me-THF (15 ml) at 0°C was added diethyl carbonate (3.2 ml, 3 eq.). 6-Bromo-3-methyl-2,3-dihydro-1H-inden-1-one (2.0 g, 8.9 mmol) in Me-THF (5 ml) was added dropwise to the mixture. The resulting mixture was stirred at 0°C until the gas evolution subsided. The reaction mixture was then slowly raised up to 70°C. After the reaction was complete, the reaction mixture was then cooled to room temperature and then diluted with EtOAc (8 V). The resulting mixture was further cooled at 0°C, to which aqueous HCl (3N, 10 ml) was added dropwise. The aqueous layer was extracted with EtOAc (2×5 V). The combined organic layers were washed with brine, dried over MgSO, filtered and concentrated in vacuo. The residue was purified by silica gel chromatography to give intermediate 38.1 (1.7 g, 64% yield).

[0596] Preparation of intermediate 38.2: Triethylsilane (4V) and trifluoroacetic acid (5V) were added to ethyl 5-bromo-1-methyl-3-oxo-2,3-dihydro-1H-indene-2-carboxylate (1.7 g, 5.7 mmol). The reaction mixture was stirred at room temperature for 5 days. The mixture was then concentrated to dryness and the resulting residue was purified by silica gel chromatography to provide intermediate 38.2 (1.1 g. 69%). 1 HNMR (400 MHz, CHLOROFORM-d) δ7.37-7.31 (m, 2H), 7.09-6.95 (m, 1H), 4.22 (qd, J = 7.2, 1.5 Hz, 2H), 3.52-3.31 (m, 1H), 3.26-3.06 (m, 2H), 2.86 (q, J = 9.1 Hz, 1H), 1.40 (d, J = 6.8 Hz, 3H), 1.32 (t, J = 7.1 Hz, 3H).

[0597] Preparation of intermediate 38: Ethyl 5-bromo-1-methyl-2,3-dihydro-1H-indene-2-carboxylate (1.1 g, 3.9 mmol) was dissolved in THF (8 ml) and treated with 2N NaOH (aq, 6 ml). The mixture was stirred at room temperature. After the reaction was complete. 2N HCl (aq) was added to adjust the pH to 5. EtOAc (2×5 V) was added to extract the mixture. The organic layers were combined, dried over MgSO, filtered and concentrated in vacuo to give intermediate 38 as a crude product. LCMS: 253.620 [MH].

[0598] Preparation of Intermediates 38.3 and 38.4: The two single isomers were isolated by SFC separation of the racemic mixture Intermediate 38 using an IG column, 10% MeOH with DEA. The first peak was assigned as Intermediate 38.3 and the second peak was assigned as Intermediate 38.4. The absolute stereochemistry of the two compounds was confirmed by the biochemical activity of the compounds synthesized from these two isomers.

[0599] Preparation Example 92: 1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0600]

[0601] Intermediate 39 was prepared in a manner similar to Example 1 using indoline-6-sulfonamide and Intermediate 38. LCMS: 435.012 [M+H].

[0602] Example 92 was prepared in a manner similar to Example 71 using Intermediate 39 instead of Intermediate 35 as the starting material. 1 HNMR(400MHz,DMSO-d6)δ8.66(dd,J=8.3,3.3Hz,2H),8.06-7.82(m,4H),7.56-7.32(m,4H),7.29(s,2H),4.4 4-4.26(m,2H),3.67(q,J=7.0Hz,1H),332-3.19(m,4H),3.08(dd,J=15.0,8.0Hz,1H),1.37(d,J=6.9Hz,3H). LCMS:434.259[M+H].

[0603] Preparation Example 93: 1-((1S,2R)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 94: 1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0604]

[0605] The two single isomers were isolated by SFC separation of the racemic mixture Example 92 using a CCO-F2 column, 50% EtOH with TFA. The first peak was designated as Example 93 and the second peak as Example 94. The absolute stereochemistry of both compounds was confirmed by biochemical activity.

[0606] Example 93: 1H NMR (400MHz, DMSO-d6) δ8.66(dd,J=8.3,3.2Hz,2H),7.94(t,J=7.2Hz,4H),7.49(dd,J=7.8,1.7Hz,1H),7.46-7.33(m,3H),7 .29(s,2H),4.48-4.26(m,2H),3.67(q,J=7.4Hz,1H),3.33-3.18(m,4H),3.08(dd,J=15.0,8.0Hz,1H),1.38(d,J=6.9Hz,3H). LCMS:434.288[M+H].

[0607] Example 94: 1 H NMR (400MHz, DMSO-d6) δ8.66(dd,J=9.3,3.3Hz,2H),8.02-7.87(m,4H),7.49(dd,J=7.8,1.7Hz,1H),7.46-7.33(m,3H),7.2 9(s,2H),4.49-4.21(m,2H),3.69(q,J=7.1Hz,1H),3.32-3.20(m,4H),3.08(dd,J=15.0,8.0Hz,1H),1.37(d,J=6.9Hz,3H). LCMS:434.278[M+H].

[0608] Preparation of Intermediate 40: 6-Bromo-1-methyl-2,3-dihydro-1H-indene-2-carboxylic acid

[0609]

[0610] Intermediate 40 was prepared in a similar manner to Intermediate 38 using 5-bromo-3-methyl-2,3-dihydro-1H-inden-1-one instead of 6-bromo-3-methyl-2,3-dihydro-1H-inden-1-one. LCMS: 253.620 [MH].

[0611]

[0612] Preparation Example 95: 1-(1-methyl-6-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0613] Example 95 was prepared in a manner similar to Example 92 using Intermediate 40 instead of Intermediate 38 as the starting material. 1HNMR(400MHz,DMSO-d6)δ8.70(d,J=4.9Hz,1H),8.65(s,1H),8.10-7.83(m,4H),7.54-7.33(m,4H),7.29(s,2H),4.35 (td,J=9.0,6.0Hz,2H),3.70(t,J=7.1Hz,1H),3.42-3.22(m,4H),3.06(dd,J=14.5,7.1Hz,1H),1.41(d,J=6.9Hz,3H). LCMS:434.280[M+H].

[0614] Preparation Example 96: 5-Fluoro-1-(1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0615]

[0616] Example 96 was prepared in a manner similar to Example 92 using Intermediate 9 instead of indoline-6-sulfonamide as the starting material. 1 H NMR (400MHz, DMSO-d6) δ8.66(d,J=4.8Hz,1H),8.62(d,J=6.7Hz,1H),8.05-7.84(m,4H),7.58(s,2H),7.36(dd,J=11.5,8. 2Hz, 3H), 4.42-4.26 (m, 2H), 3.65 (q, J = 7.3Hz, 1H), 3.35-3.20 (m, 4H), 3.06 (dd, J = 15.0, 8.0Hz, 1H), 1.36 (d, J = 6.9Hz, 3H). LCMS:452.301[M+1].

[0617] Preparation Example 97: 5-Fluoro-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 98: 5-Fluoro-1-((1S,2R)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0618]

[0619] The two single isomers were isolated by SFC using a CCO-F2 column, 50% MeOH to separate the racemic mixture Example 96. The second peak was designated as Example 97 and the first peak as Example 98. The absolute stereochemistry of both compounds was confirmed by biochemical activity.

[0620] Example 97: 1H NMR (400MHz, DMSO-d6) δ8.71-8.64(m,1H),8.62(d,J=6.7Hz,1H),8.00-7.83(m,4H),7.58(s,2H),7.42-7.27(m,3H),4. 35(td,J=9.2,6.5Hz,2H), 3.65(q,J=7.1Hz,1H), 3.32-3.23(m,4H), 3.06(dd,J=15.0,8.1Hz,1H), 1.36(d,J=6.9Hz,3H). LCMS:452.206[M+H].

[0621] Example 98: 1 H NMR (400MHz, DMSO-d6) δ8.71-8.63(m,1H),8.62(d,J=6.6Hz,1H),8.04-7.85(m,4H),7.58(s,2H),7.36(dt,J=8.2,4.2H z, 3H), 4.44-4.23 (m, 2H), 3.66 (t, J = 7.2Hz, 1H), 3.32-3.21 (m, 4H), 3.06 (dd, J = 14.9, 8.1Hz, 1H), 1.36 (d, J = 6.9Hz, 3H). LCMS:452.212[M+H].

[0622] Preparation Example 99: 5-Fluoro-1-(1-methyl-5-(6-methylpyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0623]

[0624] Example 99 was prepared in a manner similar to Example 71 using Intermediate 41 2-methyl-6-(tributylstannyl)pyridine instead of Intermediate 35 2-(tributylstannyl)pyridine as the starting material. 1 H NMR(400MHz, DMSO-d6)δ8.62(d,J=6.7Hz,1H),8.03-7.74(m,4H),7.58(s,2H),7.42-7.21(m,3H),4.46-4.22(m, 2H), 3.65 (q, J = 7.1Hz, 1H), 3.32-3.15 (m, 4H), 3.07 (dd, J = 15.1, 8.0Hz, 1H), 2.59 (s, 3H), 1.37 (d, J = 6.9Hz, 3H). LCMS:466.196[M+H].

[0625] Preparation Example 100: 5-Fluoro-1-(1-methyl-5-(6-methylpyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0626]

[0627] Example 100 was prepared in a manner similar to Example 78 using Intermediate 41 instead of Intermediate 35 as the starting material. 1 H NMR (400MHz, DMSO-d6) δ8.61(d,J=6.7Hz,1H),8.44(d,J=2.5Hz,1H),7.72(d,J=1.7Hz,1H),7.67(d,J=8.2Hz,2H),7.58(s,2H),7.34(dd,J=12.6,8.8 Hz,2H),6.52(t,J=2.2Hz,1H),4.34(td,J=9.0,4.6Hz,2H),3.88-3.51(m,1 H), 3.44-3.20 (m, 4H), 3.06 (dd, J = 14.8, 7.5Hz, 1H), 1.35 (d, J = 6.9Hz, 3H). LCMS:441.181[M+H].

[0628] Preparation Example 101: 3-Methyl-1-((1S,2R)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0629]

[0630] Example 101 was prepared in a manner analogous to Example 92 using Intermediate 38.4 3-methylindoline-6-sulfonamide instead of Intermediate 38 indoline-6-sulfonamide as the starting material. 1 H NMR (400MHz, DMSO-d6) δ8.70(d,J=5.0Hz,1H),8.63(s,1H),8.04(d,J=4.2Hz,2H),7.92(d,J=6.1Hz,2H),7.61-7.42(m,3H),7.39(d,J=8.3 Hz,1H),7.30(s,2H),4.55(q,J=10.2Hz,1H),3.77-3.52(m,3H),3.49-3.23(m,2H),3.09(ddd,J=14.0,7.7,5.3Hz,1H),1.44-1.31(m,6H). LCMS:448.225[M+H].

[0631] Preparation Example 102: 3-Methyl-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0632]

[0633] Example 102 was prepared in a manner analogous to Example 92 using intermediate 38.3 and 3-methylindoline-6-sulfonamide instead of indoline-6-sulfonamide as starting materials. 1 H NMR (400MHz, DMSO-d6) δ8.70(dt,J=5.0,1.4Hz,1H),8.63(d,J=1.7Hz,1H),8.01(dd,J=4.8,1.9Hz,2H ),7.92(dd,J=5.7,1.9Hz,2H),7.53(dd,J=7.8,1.7Hz,1H),7.46(d,J=7.5Hz,2H),7.38(d,J=8.3Hz,1H ),7.30(s,2H),4.54(t,J=10.2Hz,1H),3.97-3.80(m,1H),3.68(p,J=7.4Hz,1H),3.64-3.55(m,1H),3 .43(dd,J=15.2,8.3Hz,1H),3.37-3.27(m,1H),3.09(ddd,J=14.2,7.9,5.4Hz,1H),1.46-1.31(m,6H). LCMS:448.177[M+H].

[0634] Preparation Example 103: 5-Fluoro-3-methyl-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0635]

[0636] Example 103 was prepared in a similar manner to Example 92, except utilizing Intermediate 38.3 and Intermediate 42 as starting materials. 1H NMR (400MHz, DMSO-d6) δ8.71(d,J=5.0Hz,1H),8.60(d,J=6.6Hz,1H),8.06(d,J=4.3 Hz,2H),7.97-7.86(m,2H),7.58(s,2H),7.50(q,J=4.8Hz,1H),7.40(t,J=9.9Hz,2H ),4.54(q,J=9.8Hz,1H),3.87(td,J=10.4,6.9Hz,1H),3.63(dt,J=27.4,7.3Hz,2H) ,3.48-3.22(m,2H),3.08(ddd,J=15.0,7.9,4.6Hz,1H),1.36(td,J=7.1,1.8Hz,6H). LCMS:466.220[M+H].

[0637] Preparation of Intermediate 42: 5-Fluoro-3-methylindoline-6-sulfonamide

[0638]

[0639] Preparation of Intermediate 42.1: 5-Fluoro-3-methyl-1H-indole (1.5 g, 10 mmol) was dissolved in acetic acid (5 V). NaBH3CN (632 mg, 3 eq) was added to the reaction flask in batches while keeping the temperature below 10 °C. The resulting solution was warmed to room temperature and stirred for 3 h. Thereafter, the solution was diluted with ice-cold water and neutralized with 2N NaOH until the pH of the solution was raised to between 5-6. The reaction mixture was extracted with EtOAc (4×20 V). The combined organic layers were washed with brine and dried over MgSO4. The crude material was used directly in the next step.

[0640] Preparation of Intermediate 42.2: 5-Fluoro-3-methyl-indoline (10 mmol, crude) was dissolved in dichloromethane (10 V) and triethylamine (2.8 ml, 3 eq) and acetyl chloride (0.78 ml, 1 eq) were added at 0°C. The reaction was stirred at 0°C for 15 min, at which time the reaction was quenched with sodium bicarbonate (saturated aqueous solution) and extracted with EtOAc (3 x 10 V). The organic layer was dried (MgSO4) and concentrated in vacuo. The residue was purified by column chromatography on silica gel to give the product as a white solid, 1.72 g, 90% yield over 2 steps. 1H NMR (400MHz, chloroform-d) δ8.17 (dd, J=8.8, 4.9Hz, 1H), 6.96-6.79 (m, 2H), 4.26 (t, J=9. 8Hz, 1H), 3.63 (dd, J = 10.2, 6.8Hz, 1H), 3.57-3.43 (m, 1H), 1.38 (d, J = 6.9Hz, 3H). LCMS:194.014[M+H].

[0641] Preparation of Intermediate 42.3: 1-(5-Fluoro-3-methyl-indolin-1-yl)ethanone (0.5 g, 2.6 mmol) was dissolved in dichloroethane (5 V) and chlorosulfonic acid (10 V). The reaction was sealed and warmed to 65 °C overnight, after which the reaction was carefully poured onto ice. After extraction with EtOAc (2 x 10 V), the combined organic layers were dried (MgSO4) and concentrated in vacuo. The crude was dissolved in 1,4-dioxane (4 V), concentrated ammonium hydroxide solution was added, and the mixture was stirred at room temperature for 1 h. The volatiles were evaporated in vacuo and dilute hydrochloric acid was added. The white solid was collected by filtration. The solid was washed with water and a small amount of dichloromethane and further dried over lyo. 0.57 g, 81% yield over 2 steps. 1 H NMR (400MHz, DMSO-d6) δ8.46(d,J=6.6Hz,1H),7.56(s,2H),7.36(d,J=9.7Hz,1H),4.33(t,J=10.0Hz ,1H),3.70(dd,J=10.3,6.8Hz,1H),3.53(dt,J=9.5,6.9Hz,1H),2.17(s,3H),1.31(d,J=6.9Hz,3H). LCMS:272.956[M+H].

[0642] Preparation of Intermediate 42: 1-Acetyl-5-fluoro-2-methyl-indoline-6-sulfonamide (0.57 g, 2.1 mmol) was dissolved in 2N NaOH (aq, 6 ml, 6 eq). The mixture was heated at 100°C for 3 hours. The reaction was cooled and the pH was adjusted to 7 with acetic acid. The resulting precipitate was collected by filtration. The solid was washed with water and dried over lyo. Off-white solid, 0.42 g, 88% yield. 1H NMR (400MHz, DMSO-d6) δ7.38(s,2H),7.07(d,J=9.9Hz,1H),6.80(d,J=5.9Hz,1H),5.71(s,1H),3 .62(td,J=9.0,1.4Hz,1H),3.33-3.23(m,1H),3.03(td,J=8.6,2.6Hz,1H),1.24(d,J=6.8Hz,3H). LCMS:231.034[M+H].

[0643] Example 103 was prepared in a similar manner to Example 92 using Intermediate 38.3, Intermediate 42 instead of Intermediate 38, indoline-6-sulfonamide as starting materials. 1 H NMR (400MHz, DMSO-d6) δ8.71(d,J=5.0Hz,1H),8.60(d,J=6.6Hz,1H),8.06(d,J=4.3 Hz,2H),7.97-7.86(m,2H),7.58(s,2H),7.50(q,J=4.8Hz,1H),7.40(t,J=9.9Hz,2H ),4.54(q,J=9.8Hz,1H),3.87(td,J=10.4,6.9Hz,1H),3.63(dt,J=27.4,7.3Hz,2H) ,3.48-3.22(m,2H),3.08(ddd,J=15.0,7.9,4.6Hz,1H),1.36(td,J=7.1,1.8Hz,6H). LCMS:466.220[M+H].

[0644] Preparation Example 104: (R)-5-fluoro-3-methyl-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 105: (S)-5-fluoro-3-methyl-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0645]

[0646] The two single isomers were separated by SFC using a CCO-F2 column, 35% MeOH to separate the racemic mixture Example 103. The first peak was designated as Example 104 and the second peak as Example 105.

[0647] Example 104: 1H NMR (400MHz, DMSO-d6) δ8.66(d,J=4.9Hz,1H),8.60(d,J=6.6Hz,1H),7.94(q,J=6.8,5.7Hz,4H),7.58(s,2H),7.45-7.29(m,3H),4.56(t ,J=9.9Hz,1H),3.86(dd,J=10.3,7.0Hz,1H),3.63(dq,J=15.9,7.4Hz,2H),3.34-3.22(m,2H),3.16-2.97(m,1H),1.36(t,J=6.2Hz,6H). LCMS:466.24[M+H].

[0648] Example 105: 1 H NMR (400MHz, DMSO-d6) δ8.66(d,J=4.9Hz,1H),8.60(d,J=6.6Hz,1H),8.03-7.80(m,4H),7.58(s,2H),7.48-7.29(m,3H),4.53(t,J=10.0H z,1H),3.89(dd,J=10.4,6.9Hz,1H),3.64(dp,J=16.2,7.3Hz,2H),3.34-3.22(m,2H),3.07(dd,J=14.9,7.9Hz,1H),1.36(t,J=6.2Hz,6H). LCMS:466.23[M+H].

[0649] Preparation Example 106: 3-Methyl-1-[5-(2-pyridyl)indane-2-carbonyl]indoline-6-sulfonamide

[0650]

[0651] 3-Methylindoline-6-sulfonamide (36 mg, 0.17 mmol), 5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid (41 mg, 0.17 mmol) were suspended in acetonitrile (2 mL), 1-methylimidazole (49 mg, 3.5 eq) was added, followed by chloro-N,N,N',N'-tetramethylformamidine hexafluorophosphate (TCFH, 57 mg, 1.2 eq) in one go. The reaction mixture was stirred at room temperature overnight, after which the solvent was removed under reduced pressure. The crude residue was purified by reverse phase HPLC to obtain the product. 1H NMR (400MHz, DMSO-d6) δ8.71(d,J=5.0Hz,1H),8.58(d,J=1.7Hz,1H),8.06(d,J=3.7Hz,2H),7.94(s,1H),7.88(dd,J=7.9,1.7Hz,1H),7.51(dt,J=8.6, 2.7Hz,2H),7.40(d,J=7.9Hz,1H),7.29(s,2H),4.54(m,1H),3.88(m,1H),3 .77(t,J=8.0Hz,1H),3.66-3.54(m,2H),3.33(m,3H),1.35(d,J=6.9Hz,3H). LCMS:434.43[M+H].

[0652] Preparation Example 107: (R)-3-methyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 108: (S)-3-methyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide:

[0653]

[0654] Example 106 was chirally separated to give 4 fractions. Example 107 was obtained from the 3rd fraction and Example 108 was obtained from the 4th fraction. The NMR of these two compounds was identical to that of Example 106.

[0655] Preparation Example 109: 3-Methyl-1-[5-(2-pyridyl)indane-2-carbonyl]indoline-6-sulfonamide

[0656]

[0657] 3,3-dimethylindoline-6-sulfonamide (66 mg, 0.25 mmol), 5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid (60 mg, 0.25 mmol) were suspended in acetonitrile (2.5 mL), 1-methylimidazole (72 mg, 3.5 eq) was added, followed by a one-time addition of chloro-N,N,N',N'-tetramethylformamidine hexafluorophosphate (TCFH, 84 mg, 1.2 eq). The reaction mixture was stirred at room temperature overnight, after which the solvent was removed under reduced pressure. The crude residue was purified using reverse phase HPLC to give Example 109. 1H NMR (400 MHz, methanol-d4) δ 8.82-8.75 (m, 1H), 8.70 (d, J = 1.7 Hz, 1H), 8.54 (td, J = 8.0, 1.6 Hz, 1H), 8.30 (d, J = 8.2 Hz, 1H), 7.91 (ddd, J = 7.3, 5.8, 1.1 Hz, 1H), 7.84 (d, J = 1.7 Hz, 1H ),7.78(dd,J=7.9,1.8Hz,1H),7.67(dd,J=7.9,1.7Hz,1H),7.55(d,J=7.9Hz,1H),7. 43(d,J=7.9Hz,1H),4.15(s,2H),3.95-3.81(m,1H),3.56-3.39(m,4H),1.46(s,6H). LCMS:448.32[M+H].

[0658] Preparation Example 110: 5-Bromo-1-(5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0659]

[0660] Example 110 was prepared in a manner similar to Example 106 using 5-bromoindoline-6-sulfonamide and 5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid as starting materials. 1 H NMR (400MHz, methanol-d4) δ8.95(s,1H),8.80(dd,J=6.0,1.5Hz,1H),8.67(td,J=8.0,1.6Hz,1H),8.39(dd,J=8.2,1.1Hz,1H),8.02(m,1H) ,7.83(d,J=1.8Hz,1H),7.77(dd,J=7.9,1.8Hz,1H),7.68(s,1H),7.57(d,J=7.9Hz,1H),4.41(m,3H),3.92-3.81(m,1H),3.46(m,5H). 445.31[M+H].

[0661] Preparation Example 111: 5-M-ethoxy-1-[5-(2-pyridyl)indane-2-carbonyl]indoline-6-sulfonamide

[0662]

[0663] To a solution of 5-bromo-1-[5-(2-pyridyl)indane-2-carbonyl]indoline-6-sulfonamide Example 110 (80 mg, 0.16 mmol) in MeOH (1.5 mL) was added copper iodide (31 mg, 1 eq) and 25% sodium methoxide methanol solution (73 uL, 2 eq) and then heated at 70° C. for 12 h. The reaction mixture was filtered and concentrated. The crude residue was purified by reverse phase HPLC to give the product. 1 H NMR (400MHz, methanol-d4) δ8.79(s,1H),8.71-8.59(m,2H),8.38(t,J=6.6Hz,1H),8.01(t,J=6.8Hz,1H),7.82(s,1H),7.75(m ,1H),7.55(t,J=6.9Hz,1H),7.18(s,1H),4.37(m,1H),3.98(s,3H),3.90-3.78(m,2H),3.73(s,2H),3.54-3.38(m,4H). LCMS:450.31[M+H].

[0664] Preparation of Intermediate 43: (2-Ethyl-5-fluoro-indolin-1-yl)-[(2R)-5-(2-pyridyl)indan-2-yl]methanone

[0665]

[0666] Preparation of intermediate 43.1 (2-ethyl-5-fluoro-indoline): Sodium cyanoborohydride (776 mg, 12 mmol) was added in batches to a solution of 2-ethyl-5-fluoro-1H-indole (1 g, 6.2 mmol) in glacial acetic acid (5 mL) at 0 ° C. The reaction mixture was stirred at room temperature for 2 hours. After cooling in an ice bath, the reaction mixture was diluted with water (15 mL). The reaction mixture was basified with 40% NaOH aqueous solution. The reaction mixture was extracted with DCM (2x15 mL). The organic extract was dried, filtered, and concentrated. The residue was purified by flash chromatography to obtain intermediate 43.1. LC / MS: 166.00 [M+H].

[0667] Intermediate 43 was prepared by method A using 2-ethyl-5-fluoro-indoline Intermediate 43.1, (R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid Intermediate 19 as starting materials. LC / MS: 387.32 [M+H].

[0668] Preparation Example 112: 2-Ethyl-5-fluoro-1-[(2R)-5-(2-pyridyl)indane-2-carbonyl]indoline-6-sulfonamide:

[0669]

[0670] Chlorosulfonic acid (0.9 mL) was cooled in an ice bath and (2-ethyl-5-fluoro-indolin-1-yl)-[(2R)-5-(2-pyridyl)indan-2-yl]methanone (Intermediate 43) was added in portions in DCM (1 mL) with stirring. Stirring was continued for 20 min. The ice bath was removed thereafter and the mixture was heated to 70° C. for 1 hour. After cooling to room temperature, the mixture was carefully poured into ice water and extracted twice with DCM. The combined organic layers were dried over Na2SO4 and evaporated to dryness to give the crude intermediate. The crude intermediate was then dissolved in dioxane (1.5 mL) and 28% NH4OH (1.5 mL) and stirred at room temperature for 10 min. The reaction was complete. The mixture was concentrated. Sat.NaHCO3 was added to the residue and extracted twice with EtOAc. The organic phase was dried over Na2SO4 and concentrated. The residue was purified by flash chromatography to give the title compound. 1 H NMR(400MHz,DMSO-d6)δ8.72 -8.61(m,1H),8.51(m,1H),8.06-7.77(m,4H),7.57(s,2H),7.44(d,J=9.6Hz,1H),7.41-7.25(m,2H),4.4 4(q,J=6.3Hz,1H),3.73(p,J=8.3Hz,2H),3.45(m,2H),3.30-3.17(m,1H),3.07(m,2H),1.38-1.19(m,5H). LC / MS: 466.35[M+1].

[0671] Preparation Example 113: (R)-2-ethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide, and Example 114: (S)-2-ethyl-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0672]

[0673] Chiral separation of Example 112 gave 2 fractions. Example 113 was obtained from the first fraction and Example 114 was obtained from the second fraction. Example 113: 1H NMR (400MHz, DMSO-d6) δ8.65(ddd,J=4.9,3.0,2.0Hz,1H),8.54(d,J=6.6Hz,1H),8.48(d ,J=6.5Hz,0H),8.05-7.79(m,4H),7.56(s,2H),7.44(d,J=9.6Hz,1H),7.40-7.27(m,2H), 4.98-4.82 (m, 0H), 4.44 (q, J = 6.4 Hz, 1H), 4.09 (d, J = 5.3 Hz, 0H), 3.74 (q, J = 8.5 Hz, 1H), 3.45 (dd, J = 16.1, 8.5 Hz, 2H), 3.27-2.94 (m, 2H), 1.43-1.19 (m, 5H), 1.14 (d, J = 6.4 Hz, 1H). Example 114: 1 H NMR (400MHz, DMSO-d6) δ8.64(ddd,J=4.8,1.9,1.0Hz,1H),8.51(dd,J=23.5,6.6Hz,1H),7.97-7.79(m,4H),7.55(m,2H),7.44(m ,2H),7.40-7.23(m,1H),4.44(q,J=6.4Hz,1H),3.74(dd,J=16.6,8.5Hz,2H),3.45(m,3H),3.18-2.92(m,2H),1.39-1.15(m,5H). LCMS:466.39[M+H].

[0674] Preparation of Intermediate 45: 1-(6-bromo-2,3-dihydrobenzofuran-2-carbonyl)indoline-6-sulfonamide:

[0675]

[0676] Indoline-6-sulfonamide (63 mg, 0.32 mmol) and 6-bromo-2,3-dihydrobenzofuran-2-carboxylic acid (78 mg, 1 eq) were combined in acetonitrile (3.5 mL). 1-Methylimidazole (89 μL, 3.5 eq) and N-tetramethylformamidine hexafluorophosphate (134 mg, 1.5 eq) were added to the solution and stirred for 30 minutes. Silica gel was added to the crude mixture and the solvent was removed in vacuo. The resulting residue was then purified by flash chromatography (0-50% methanol and dichloromethane on silica gel). Removal of the solvent produced a clear oil, which was then dissolved in acetonitrile and concentrated to obtain intermediate 45. LC / MS: 422.8 [M+H].

[0677] Preparation Example 115: 1-(6-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)indoline-6-sulfonamide

[0678]

[0679] Intermediate 45 (73.3 mg, 0.173 mmol) was dissolved in dioxane (2 mL) and combined with bis(tri-tert-butylphosphine)palladium(0) (8.85 mg, 0.1 eq) and then combined with 2-(tributylstannyl)pyridine (63.8 mg, 1 eq). The mixture was stirred at 95 °C for one hour and the crude was then purified via reverse phase HPLC. The collected fractions were lyophilized to obtain Example 115. 1 H NMR (400 MHz, DMSO-d6) δ 8.67-8.63 (m, 1H), 8.54 (d, J = 1.6 Hz, 1H), 7.96 (d, J = 8.0 Hz, 1H), 7.92-7.87 (m, 1H), 7.66-7.62 (m, 1H), 7.55 (d, J = 1.5 Hz, 1H), 7.54-7.50 (m, 1H), 7.45 (d, J = 8.0 Hz, 1H), 7.37 (d, J = 7.6 Hz, 2H), 7.30 (s, 2H), 5.76 (dd, J = 9.6, 6.5 Hz, 1H), 4.43 (d, J = 9.1 Hz, 1H), 4.32 (q, J = 9.1 Hz, 1H), 6H under the water peak. LC / MS: 422.2 [M+H].

[0680] Preparation of Intermediate 46: 1-(6-bromo-2,3-dihydrobenzofuran-2-carbonyl)-5-fluoroindoline-6-sulfonamide

[0681]

[0682] Preparation of Intermediate 46 involved the same method as Intermediate 45 using 5-fluoroindoline-6-sulfonamide in place of the starting material indoline-6-sulfonamide. LC / MS: 440.6 [M+H].

[0683] Preparation Example 116: 5-Fluoro-1-(6-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)indoline-6-sulfonamide

[0684]

[0685] Example 116 was prepared similarly to Example 115 using Intermediate 46 instead of Intermediate 45 and a reaction time of 48 h. 1H NMR (400MHz, DMSO-d6) δ8.67(d,J=4.9Hz,1H),8.51(d,J=6.6Hz,1H),7.99(d,J=7.9Hz, 1H),7.94(dd,J=8.3,6.6Hz,1H),7.64(dd,J=7.8,1.6Hz,1H),7.60(s,2H),7.55(d,J=1 .5Hz,1H),7.40(d,J=3.7Hz,2H),7.38(s,1H),5.75(dd,J=9.6,6.5Hz,1H),4.42(dd,J= 18.0, 9.1Hz, 1H), 4.32 (dd, J = 9.3Hz, 1H), 3.58 (t, J = 8.8Hz, 2H), 3.31 (t, J = 8.6Hz, 2H). LC / MS: 440.0[M+H].

[0686] Preparation of Intermediate 47: 1-((2R)-5-bromoindane-2-carbonyl)-2-methyl-indoline-6-sulfonamide

[0687]

[0688] Intermediate 47 was prepared using a similar procedure to Intermediate 45 using (2R)-5-bromoindane-2-carboxylic acid and 2-methylindoline-6-sulfonamide as starting materials. The reaction mixture was stirred overnight and then purified via reverse phase HPLC. The desired fractions obtained were combined and lyophilized to give Intermediate 47. LC / MS: 435.0 [M+H].

[0689] Preparation Example 117: 1-((2R)-5-(2,5-difluorophenyl)indane-2-carbonyl)-2-methyl-indoline-6-sulfonamide

[0690]

[0691] Intermediate 47 (42 mg, 0.096 mmol) was dissolved in 9:1 dioxane:water (1 mL) and then combined with (2,5-difluorophenyl)boronic acid (30 mg, 2 eq), (1,1'-bis(diphenylphosphino)ferrocene)-dichloropalladium(II) (27 mg, 0.4 eq), and potassium carbonate (40 mg, 3 eq). The reaction mixture was purged with nitrogen and then stirred at 95 °C for 4 h. The crude was then purified via reverse phase HPLC and lyophilized to give Example 117. 1H NMR (400 MHz, DMSO-d6) δ 8.57 (s, 1H), 7.51 (dd, J = 7.9, 1.6 Hz, 1H), 7.45 (d, J = 6.9 Hz, 1H), 7.41-7.32 (m, 3H), 7.28 (s, 2H), 4.93-4.83 (m, 1H), 3.82-3.70 (m, 1H), 2.79 (d, J = 16.6 Hz, 1H), 2.70-2.30 (m, 1H), 1.29 (d, J = 6.3 Hz, 3H), 4H under the water peak. LC / MS: 440.0 [M+H].

[0692] Preparation Example 118: (R)-1-((R)-5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-2-methylindoline-6-sulfonamide, and Example 119: (S)-1-((R)-5-(2,5-difluorophenyl)-2,3-dihydro-1H-indene-2-carbonyl)-2-methylindoline-6-sulfonamide

[0693]

[0694] Example 118 was obtained from racemic Example 117 via chiral SFC separation (45% isopropanol and ammonia on AD-H 4.6 x 100 mm column) with a retention time of 3.54 minutes. 1 H NMR (400 MHz, DMSO-d6) δ 8.58 (s, 1H), 7.54-7.50 (m, 1H), 7.46 (d, J = 5.7 Hz, 1H), 7.42-7.31 (m, 4H), 7.29 (s, 1H), 7.10 (s, 4H), 4.89 (t, J = 7.4 Hz, 1H), 3.83-3.72 (m, 1H), 2.80 (d, J = 16.6 Hz, 1H), 1.30 (d, J = 6.3 Hz, 3H), 5H under the water peak. LC / MS: 440.0 [M+H].

[0695] Example 119 was obtained from racemic Example 117 via chiral SFC separation (45% isopropanol and ammonia on AD-H 4.6 x 100 mm column) with a retention time of 5.12 minutes. 1H NMR (400 MHz, DMSO-d6) δ 8.58 (s, 1H), 7.52 (dd, J = 7.9, 1.6 Hz, 1H), 7.45 (d, J = 7.7 Hz, 1H), 7.41 (s, 1H), 7.37 (d, J = 6.7 Hz, 4H), 7.29 (s, 2H), 4.89 (t, 1H), 3.83-3.72 (m, 1H), 2.80 (d, J = 16.6 Hz, 1H), 1.30 (d, J = 6.3 Hz, 3H), 5H under the water peak. LC / MS: 440.0 [M+H].

[0696] Preparation of Intermediate 48: 1-(5-bromo-2,3-dihydrobenzofuran-2-carbonyl)-2-methylindoline-6-sulfonamide

[0697]

[0698] Intermediate 48 was obtained using the same method as Intermediate 45 using 5-bromo-2,3-dihydrobenzofuran-2-carboxylic acid and 2-methylindoline-6-sulfonamide as reactants. The crude was purified using reverse phase HPLC and then lyophilized to give Intermediate 48. LC / MS: 437.0 [M+H].

[0699] Preparation Example 120: 1-(5-(2,5-difluorophenyl)-2,3-dihydrobenzofuran-2-carbonyl)-2-methylindoline-6-sulfonamide

[0700]

[0701] Example 120 was prepared using the same procedure as Example 117, using Intermediate 48 instead of Intermediate 47. 1 HNMR(400MHz,DMSO-d6)δ8.52(s,1H),7.56(t,J=6.9Hz,1H),7.50(s,1H), 7.47(s,0H),7.40-7.34(m,1H),7.31(d,J=7.3Hz,1H),7.25-7.17(m,1H), 6.96(t,J=9.5Hz,1H),5.85-5.75(m,1H),5.10-4.84(m,1H),3.74-3.42(m ,3H), 2.84(d,J=16.3Hz,1H), 1.36(d,J=6.3Hz,1H), 1.32(d,J=6.5Hz,2H). LC / MS: 471.0[M+H].

[0702] Preparation Example 123: (R)-1-((R)-5-(2,5-difluorophenyl)-2,3-dihydrobenzofuran-2-carbonyl)-2-methylindoline-6-sulfonamide

[0703]

[0704] Example 123 was obtained from racemic Example 120 via chiral SFC separation (25% ethanol and ammonia on an OJ-H 4.6 x 100 mm column) with a retention time of 13.05 minutes. 1 H NMR (400 MHz, DMSO-d6) δ 8.52 (s, 1H), 7.59-7.54 (m, 1H), 7.50 (d, J = 6.4 Hz, 2H), 7.39-7.34 (m, 3H), 7.32 (s, 2H), 7.22 (td, J = 8.7, 8.2, 4.0 Hz, 1H), 6.94 (d, J = 8.5 Hz, 1H), 5.81 (dd, J = 9.6, 6.6 Hz, 1H), 5.04 (d, J = 7.9 Hz, 1H), 1.32 (d, J = 6.4 Hz, 3H), 3H under the water peak. LC / MS: 471.0 [M+H].

[0705] Preparation of Intermediate 60: 5-Fluoro-2-(fluoromethyl)indoline-6-sulfonamide

[0706]

[0707] Preparation of Intermediate 60.1 (N-allyl-4-fluoroaniline)

[0708] To a solution of 4-fluoroaniline (50 g, 449.9 mmol, 43.10 mL, 1 eq) in DMF (500 mL) was added 3-bromoprop-1-ene (48.9 g, 404.9 mmol, 0.9 eq) and K2CO3 (93.2 g, 674.9 mmol, 1.5 eq). The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was quenched with water (500 mL) and extracted with ethyl acetate (1000 mL*2). The combined organics were washed with brine (1500 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by flash column chromatography on silica gel (eluted with 0 to 20% ethyl acetate in petroleum ether) to give Intermediate 60.1. LC / MS: 152.1 [M+H].

[0709] Preparation of Intermediate 60.2 (2-allyl-4-fluoroaniline)

[0710] To a solution of intermediate 60.1 (20 g, 132.3 mmol, 1 eq) in m-xylene (150 mL) was added BF3.Et2O (56.3 g, 396.8 mmol, 48.9 mL, 3 eq), and the reaction mixture was stirred at 170 °C for 2 h. After cooling to room temperature, the reaction mixture was treated with 2M NaOH until pH = 7, and extracted with EtOAc (1 L x 2). The combined organics were washed with brine (1.5 L), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by flash column chromatography using silica gel (eluted with 0 to 20% ethyl acetate in petroleum ether) to give intermediate 60.2. LC / MS: 152.1 [M+H].

[0711] Preparation of Intermediate 60.3 (N-(2-allyl-4-fluorophenyl)acetamide)

[0712] To a solution of intermediate 60.2 (15 g, 99.2 mmol, 1 eq) in DCM (200 mL) was added Ac2O (30.3 g, 297.6 mmol, 27.8 mL, 3 eq). The mixture was stirred at 20 °C for 12 h. Water (150 mL) was added, and the reaction mixture was extracted with DCM (150 mL*2). The combined organic layers were washed with brine (150 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give intermediate 60.3, which was used directly without purification. LC / MS: 194.1 [M+H].

[0713] Preparation of Intermediate 60.4 ((1-acetyl-5-fluoroindolyl-2-yl)methyl acetate)

[0714] To a solution of intermediate 60.3 (20 g, 103.5 mmol, 1 eq) in AcOH (300 mL) and Ac2O (40 mL) were added Pd(CH3CN)2Cl2 (1.3 g, 5.1 mmol, 0.05 eq) and Cu(NO3)2*3H2O (1.2 g, 5.1 mmol, 0.05 eq). The reaction mixture was degassed and purged with O2 three times, and then stirred at 25°C under an O2 atmosphere (15 psi) for 15 h. The reaction mixture was concentrated to dryness. Dichloromethane (200 mL) was then added, and the resulting mixture was washed with saturated NaHCO3 (200 mL). The aqueous layer was extracted with dichloromethane (2×200 mL), and the combined organic layers were dried over Na2SO4. The solvent was removed under reduced pressure. The crude product was purified by flash column chromatography using silica gel (eluted with 10 to 50% ethyl acetate in petroleum ether) to give intermediate 60.4. LC / MS: 252.1 [M+H].

[0715] Preparation of Intermediate 60.5 (1-(5-fluoro-2-(hydroxymethyl)indolin-1-yl)ethan-1-one)

[0716] To a solution of intermediate 60.4 (7.4 g, 29.4 mmol, 1 eq) in MeOH (70 mL) was added LiOH.H2O (1 M, 35.3 mL, 1.2 eq). The mixture was stirred at 0 °C for 1 h. The mixture was acidified by 2M HCl until pH = 3. The reaction mixture was filtered and the filter cake was washed with water (10 mL*2) and dried under reduced pressure to give intermediate 60.5. LC / MS: 210.1 [M+H].

[0717] Preparation of Intermediate 60.6 (Methanesulfonic acid (1-acetyl-5-fluoroindolyl-2-yl) methyl ester)

[0718] To a solution of intermediate 60.5 (3 g, 14.3 mmol, 1 eq) in DCM (40 mL) was added DIPEA (7.4 g, 57.3 mmol, 9.9 mL, 4 eq) and mesyl mesylate (5.0 g, 28.6 mmol, 2 eq). The mixture was stirred at 20 °C for 2 h. The reaction mixture was concentrated and then purified by flash column chromatography using silica gel (eluted with 10 to 50% ethyl acetate in petroleum ether) to give intermediate 60.6. LC / MS: 288.1 [M+H].

[0719] Preparation of Intermediate 60.7 (1-(5-fluoro-2-(fluoromethyl)indolin-1-yl)ethan-1-one)

[0720] A solution of intermediate 60.6 (2.5 g, 8.7 mmol, 1 eq) in TBAF (1 M, 43.5 mL, 5 eq) (THF solution) was stirred at 70 ° C for 36 h. Water (30 mL) was added to the reaction, and the resulting mixture was extracted with ethyl acetate (30 mL*2). The combined organic layers were washed with brine (20 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give a residue. The crude product was purified by flash column chromatography using silica gel (eluted with 0 to 30% ethyl acetate in petroleum ether) to give intermediate 60.7. LC / MS: 212.1 [M+H].

[0721] Preparation of Intermediate 60.8 (1-acetyl-5-fluoro-2-(fluoromethyl)indoline-6-sulfonyl chloride)

[0722] A solution of HSO3Cl (2 mL) was cooled to 5 ° C. Intermediate 60.7 (600 mg, 2.8 mmol, 1 eq) was then added to the mixture in 3 portions. The reaction mixture was then stirred at 50 ° C for 5 h. After cooling to 20 ° C, the mixture was poured into ice water (20 mL), and then the mixture was extracted with DCM (30 mL*2). The combined organic layers were washed with brine (20 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give intermediate 60.8, which was used in the next step without further purification. LC / MS: 310.0 [M+H].

[0723] Preparation of Intermediate 60.9 (1-acetyl-5-fluoro-2-(fluoromethyl)indoline-6-sulfonamide)

[0724] To a solution of intermediate 60.8 (750 mg, 2.4 mmol, 1 eq) in THF (8 mL) was added NH3.H2O (4 mL, 30% w / v). The mixture was stirred at 20°C for 12 h and then concentrated under reduced pressure to give intermediate 60.9, which was used in the next step without further purification. LC / MS: 291.1 [M+H].

[0725] Preparation of Intermediate 60 (5-Fluoro-2-(fluoromethyl)indoline-6-sulfonamide)

[0726] To a solution of intermediate 60.9 (650 mg, 2.2 mmol, 1 eq) in EtOH (7 mL) was added HCl (12 M, 1.3 mL, 7 eq). The mixture was stirred at 80 ° C for 2 h. The reaction mixture was concentrated to dryness and then dissolved in water (20 mL). The mixture was made alkaline by ammonia (3 mL) and extracted with ethyl acetate (20 mL*2). The combined organic layers were washed with brine (15 mL) and dried over Na2SO4. The combined organic layers were concentrated to dryness to give intermediate 60. LC / MS: 249.0 [M+H].

[0727] Chiral SFC separation of intermediate 60 was performed using the following conditions: DAICEL CHIRALPAK IF (250 mm*30 mm, 10 μm) column; mobile phase: [0.1% NH3 MEOH]; B%: 40%-40%, 5 min). (S)-intermediate 60 was obtained as the first eluent and (R)-intermediate 60 was obtained as the second eluent.

[0728] Preparation Example 125: (S)-5-Fluoro-2-(fluoromethyl)-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide:

[0729]

[0730] Example 125 was prepared in a manner analogous to Example 35 using (S)-Intermediate 60 and Intermediate 19 (General Procedure A). 1 HNMR (400MHz, DMSO-d6) δ8.68(d,J=4.9Hz,1H),8.52(d,J=6.6Hz,1H),8.05-7.94(m,2H),7.94-7.83(m,2H),7.59(s,2H),7.42(dd d,J=20.6,8.9,6.3Hz,3H),5.28-5.07(m,1H),4.75-4.33(m,2H),3.83(p,J=8.0Hz,1H),3.76-3.06(m,5H),2.99(d,J=17.3Hz,1H). LC / MS: 470.2[M+H].

[0731] Preparation Example 126: (R)-5-Fluoro-2-(fluoromethyl)-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide:

[0732]

[0733] Example 126 was prepared in a manner analogous to Example 35 using (R)-Intermediate 60 and Intermediate 19 (General Procedure A). 1 HNMR(400MHz,DMSO-d6)δ8.70(dd,J=5.0,1.5Hz,1H),8.51(d,J=6.6Hz,1H),8.09-7.98(m,2H ),7.96(s,1H),7.88(dd,J=7.9,1.7Hz,1H),7.60(s,2H),7.48(td,J=5.1,3.4Hz,1H),7.37(t, J=9.5Hz,2H),5.17(dt,J=18.9,7.9Hz,1H),4.80-4.35(m,2H),3.83(p,J=8.3Hz,1H),3.53-3. 31(m,3H), 3.24(dd,J=16.1,8.4Hz,1H), 3.09(dd,J=16.2,7.8Hz,1H), 2.99(d,J=17.3Hz,1H). LC / MS: 470.2[M+H].

[0734] Preparation of Intermediate 50 (2-(difluoromethyl)-5-fluoroindoline-6-sulfonamide):

[0735]

[0736] Preparation of Intermediate 50.1 (5-fluoro-1-tosyl-1H-indole):

[0737] To a solution of 5-fluoro-1H-indole (50 g, 369.9 mmol, 1 eq) in THF (600 mL) was added NaH (19.2 g, 480.9 mmol, 60% purity, 1.3 eq) at 0 ° C under N2. The mixture was stirred at 20 ° C for 2 h. The mixture was then cooled to 0 ° C, and 4-methylbenzenesulfonyl chloride (84.6 g, 443.9 mmol, 1.2 eq) was added in batches. The mixture was warmed to 20 ° C and stirred at 20 ° C for 14 h. The residue was then added to water (500 mL), the solid was collected by filtration, washed with water (50 mL * 3), petroleum ether (50 mL * 3) and dried under reduced pressure to give intermediate 50.1. LC / MS: 290.1 ​​[M + H].

[0738] Preparation of Intermediate 50.2 (5-Fluoro-1-toluenesulfonyl-1H-indole-2-carbaldehyde)

[0739] To a solution of intermediate 50.1 (50 g, 172.8 mmol, 1 eq) in THF (500 mL) was added n-BuLi (2.5 M, 96.78 mL, 1.4 eq) at -70 °C under N2 atmosphere. The mixture was stirred at -70 °C for 1 h. DMF (25.90 g, 354.27 mmol, 27.26 mL, 2.05 eq) was then added to the mixture and stirred at -70 °C for 0.5 h. The mixture was quenched by saturated NH4Cl aqueous solution (500 mL) and extracted with ethyl acetate (500 mL*3). The combined organics were washed with brine (200 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The solid was ground by 1000 mL of petroleum ether, and the solid was collected by filtration, rinsed with petroleum ether (50 mL*3) and dried under reduced pressure to give intermediate 50.2. LC / MS: 318.1 [M+H].

[0740] Preparation of Intermediate 50.3 (2-(Difluoromethyl)-5-fluoro-1-tosyl-1H-indole)

[0741] DAST (58.92 g, 365.55 mmol, 48.30 mL, 2 eq) was added dropwise to a solution of intermediate 50.2 (58 g, 182.7 mmol, 1 eq) in DCM (580 mL) at -70 °C under N2 atmosphere. The mixture was then warmed to 20 °C for 16 h. The mixture was cooled to 0 °C and quenched with water (500 mL), extracted with DCM (500 mL*3). The combined organics were washed with brine (300 mL), dried over Na2SO4, filtered and concentrated under reduced pressure, and the resulting residue was purified by flash column chromatography using silica gel (eluted with 5 to 10% EtOAc in petroleum ether) to give intermediate 50.3. LC / MS: 340.1 [M+H].

[0742] Preparation of Intermediate 50.4 (2-(difluoromethyl)-5-fluoro-1-toluenesulfonyl indoline):

[0743] To a suspension of Pd / C (8 g, 10% purity, 1.00 eq) in EtOAc (500 mL) was added intermediate 50.3 (14.5 g, 42.73 mmol, 1 eq). The suspension was degassed and purged with H2 three times. The mixture was stirred at 60 °C under H2 (30 Psi) for 2 h, at which time the mixture was filtered through a celite pad and the celite was rinsed with ethyl acetate (100 mL*3). The filtrate was concentrated under reduced pressure to give intermediate 50.4. LC / MS: 342.1 [M+H].

[0744] Preparation of Intermediate 50.5 (2-(difluoromethyl)-5-fluoroindoline):

[0745] To a solution of intermediate 50.4 (16.3 g, 47.75 mmol, 1 eq) in MeOH (300 mL) was added Mg (11.61 g, 477.52 mmol, 10 eq) in batches. The mixture was then stirred at 20 °C for 4 h. The reaction was quenched with saturated aqueous NH4Cl (100 mL), diluted with water (300 mL) and EtOAc (300 mL). The resulting mixture was filtered, and the filter cake was rinsed with EtOAc (50 mL*3). The combined filtrate was then extracted with ethyl acetate (200 mL*3). The combined organics were washed with brine (150 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give intermediate 50.5, which was used directly in the next step without further purification. LC / MS: 188.0 [M+H].

[0746] Preparation of Intermediate 50.6 (1-(2-(difluoromethyl)-5-fluoroindol-1-yl)ethan-1-one)

[0747] To a solution of intermediate 50.5 (17 g, 90.83 mmol, 1 eq) in DCM (200 mL) was added acetyl chloride (10.69 g, 136.25 mmol, 9.72 mL, 1.5 eq) and TEA (27.57 g, 272.49 mmol, 37.93 mL, 3 eq). The mixture was stirred at 20 °C for 16 h. The reaction was quenched with water (200 mL) and extracted with DCM (200 mL*3). The combined organics were washed with brine (100 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was then purified by flash column chromatography using silica gel (eluted with 10 to 15% EtOAc in petroleum ether) to give intermediate 50.6. LC / MS: 230.0 [M+H].

[0748] Preparation of Intermediate 50.7 (1-acetyl-2-(difluoromethyl)-5-fluoroindoline-6-sulfonyl chloride)

[0749] A solution of intermediate 50.6 (10 g, 43.63 mmol, 1 eq) in HSO3Cl (105.00 g, 901.10 mmol, 60 mL, 20.65 eq) was stirred at 55 °C for 5 h. The reaction mixture was cooled to room temperature and slowly quenched with ice water (300 mL), and extracted with ethyl acetate (100 mL*3). The combined organic phases were washed with saturated aqueous NaHCO3 (200 mL*2) and brine (200 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography on silica gel (eluted with 40 to 50% EtOAc in petroleum ether) to give intermediate 50.7. LC / MS: 328.0 [M+H].

[0750] Preparation of Intermediate 50.8 (1-acetyl-2-(difluoromethyl)-5-fluoroindoline-6-sulfonamide)

[0751] A mixture of intermediate 50.7 (4.5 g, 13.73 mmol, 1 eq) and NH3.H2O (16.04 g, 137.32 mmol, 17.63 mL, 30% purity, 10 eq) in THF (40 mL) was stirred at 20°C for 1 h. The reaction was concentrated under reduced pressure to give intermediate 50.8, which was used directly in the next step without purification. LC / MS: 309.0 [M+H].

[0752] Preparation of Intermediate 50 (2-(Difluoromethyl)-5-fluoroindoline-6-sulfonamide)

[0753] A mixture of intermediate 50.8 (5 g, 16.22 mmol, 1 eq) and HCl (12 M, 9.46 mL, 7 eq) in EtOH (50 mL) was stirred at 80 ° C for 6 h. The mixture was cooled to 20 ° C and concentrated under reduced pressure to obtain a residue. The residue was dissolved in water (30 mL) and pH = 9 was adjusted by slowly adding K2CO3 at 0 ° C. The mixture was extracted with ethyl acetate (20 mL*3). The combined organics were washed with brine (15 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to obtain intermediate 50. LC / MS: 267.1 [M+H].

[0754] Chiral SFC separation of intermediate 50 was performed using the following conditions: DAICEL CHIRALPAK IG (250 mm*50 mm, 10 μm) column; mobile phase: [0.1% NH3 MEOH]; B%: 40%-40%, 5 min). (R)-intermediate 50 was obtained as the first eluent and (S)-intermediate 50 was obtained as the second eluent.

[0755] Preparation Example 127 ((R)-2-(difluoromethyl)-5-fluoro-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide)

[0756]

[0757] Example 127 was prepared in a manner analogous to Example 35 using (R)-Intermediate 50 and Intermediate 19 (General Procedure A). 1 HNMR(400MHz,DMSO-d6)δ8.70(dt,J=5.0,1.4Hz,1H),8.48(d,J=6.5Hz,1H),8.08-8.02(m,2H ),7.92-7.86(m,2H),7.62(s,2H),7.49(td,J=5.2,3.2Hz,1H),7.45-7.40(m,2H),5.33(q,J= 11.8Hz,1H),3.85(p,J=8.2Hz,1H),3.61(dd,J=17.6,9.7Hz,1H),3.49(dd,J=15.9,8.8Hz,1H ), 3.39 (dd, J = 16.2, 7.4Hz, 1H), 3.29-3.16 (m, 2H), 3.10 (dd, J = 15.8, 7.7Hz, 1H), 2.70 (s, 1H). LC / MS: 488.1[M+H].

[0758] Preparation Example 128: (S)-2-(Difluoromethyl)-5-fluoro-1-((R)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0759]

[0760] Example 128 was prepared in a manner analogous to Example 35 using (S)-Intermediate 50 and Intermediate 19 (General Procedure A). 1 HNMR(400MHz,DMSO-d6)δ8.72(dt,J=5.2,1.4Hz,1H),8.47(d,J=6.6Hz,1H),8.12-8.06(m,2H), 7.96(s,1H),7.87(dd,J=7.9,1.7Hz,1H),7.62(s,2H),7.52(td,J=5.5,2.6Hz,1H),7.39(dd,J=1 7.9,8.8Hz,2H),5.33(q,J=11.9Hz,1H),5.14(s,1H),3.85(p,J=8.3Hz,1H),3.60(dd,J=17.6,9 .7Hz,1H),3.45(ddd,J=22.6,16.1,8.1Hz,2H),3.32-3.14(m,2H),3.08(dd,J=16.3,7.7Hz,1H). LC / MS: 488.1[M+H].

[0761] Preparation Example 129: (R)-1-(5-(pyrimidin-4-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0762]

[0763] Example 129 was prepared in a manner analogous to Example 71 using Intermediate 37 and 4-(tributylstannyl)pyrimidine. 1 H NMR (400MHz, DMSO-d6) δ9.22(d,J=1.3Hz,1H),8.84(d,J=5.4Hz,1H),8.59(d,J=1.7Hz,1H),8.16-7.96(m,3H),7 .45(ddd,J=24.9,7.8,2.3Hz,3H),7.28(s,2H),4.35(t,J=8.5Hz,2H),3.78(p,J=8.0Hz,1H),3.37-3.12(m,6H). LC / MS: 421.1[M+H].

[0764] Preparation Example 130: (R)-1-(5-(pyridin-3-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0765]

[0766] Example 130 was prepared in a manner analogous to Example 69 using Intermediate 37 and pyridin-3-ylboronic acid. 1 H NMR (400MHz, DMSO-d6) δ8.99(d,J=2.2Hz,1H),8.66(dd,J=5.1,1.5Hz,1H),8.59(d,J=1.7Hz,1H),8.32(dt,J=8.1,1.9Hz,1H),7.76-7.61(m,2H),7 .61-7.52(m,1H),7.48(dd,J=7.8,1.8Hz,1H),7.41(t,J=7.4Hz,2H),7.2 8(s,2H),4.35(t,J=8.5Hz,2H),3.77(p,J=8.0Hz,1H),3.39-3.20(m,6H). LC / MS: 420.2[M+H].

[0767] Preparation Example 131: (R)-1-(5-(pyridin-4-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0768]

[0769] Example 131 was prepared in a manner analogous to Example 69 using Intermediate 37 and pyridin-4-ylboronic acid. 1 H NMR (400MHz, DMSO-d6) δ8.84-8.70(m,2H),8.59(d,J=1.7Hz,1H),8.04(d,J=5.6Hz,2H),7.81(s,1H),7.73(dd,J= 7.9,1.8Hz,1H),7.53-7.36(m,3H),7.28(s,2H),4.34(t,J=8.5Hz,2H),3.78(p,J=7.9Hz,1H),3.31-3.12(m,6H). LC / MS: 420.2[M+H].

[0770] Preparation Example 132: (R)-1-(5-(Quinolin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0771]

[0772] Example 132 was prepared in a manner analogous to Example 71 using Intermediate 37 and 2-(tributylstannyl)quinoline. 1 H NMR (400MHz, DMSO-d6) δ8.61(d,J=1.7Hz,1H),8.50(d,J=8.7Hz,1H),8.17(dd,J =5.1,3.6Hz,2H),8.10(dd,J=7.8,1.7Hz,2H),8.03(dd,J=8.2,1.4Hz,1H),7.81 (ddd,J=8.5,6.9,1.5Hz,1H),7.62(ddd,J=8.1,6.8,1.2Hz,1H),7.56-7.37(m,3 H), 7.29 (s, 2H), 4.36 (t, J = 8.5Hz, 2H), 3.80 (p, J = 8.1Hz, 1H), 3.43-3.23 (m, 6H). LC / MS:470.3[M+H].

[0773] Preparation Example 133: (R)-1-(5-(pyrimidin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide

[0774]

[0775] Example 133 was prepared in a manner analogous to Example 71 using Intermediate 37 and 2-(tributylstannyl)pyrimidine. 1 H NMR(400MHz,DMSO-d6)δ8.89(d,J=4.8Hz,2H),8.60(d,J=1.7Hz,1H),8.32-8.17(m,2H),7.5 6-7.34(m,4H),7.28(s,2H),4.35(t,J=8.5Hz,2H),3.78(p,J=8.1Hz,1H),3.42-3.18(m,6H). LC / MS: 421.1[M+H].

[0776] Preparation Example 134: (R)-1-(5-(naphthalen-1-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide:

[0777]

[0778] Example 134 was prepared in a manner analogous to Example 69 using intermediate 37 and naphthylboronic acid. 1H NMR (400MHz, DMSO-d6) δ8.63(d,J=1.7Hz,1H),8.00(dd,J=8.0,1.5Hz,1H),7.95(d,J=8.2Hz,1H),7.84 (d,J=8.3Hz,1H),7.65-7.19(m,11H),4.36(t,J=8.5Hz,2H),3.80(p,J=8.1Hz,1H),3.41-3.21(m,6H). LC / MS: 469.1[M+H].

[0779] Preparation Example 135: (R)-1-(5-(naphthalen-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide:

[0780]

[0781] Example 135 was prepared in a manner analogous to Example 69 using intermediate 37 and naphthylboronic acid. 1 H NMR (400MHz, DMSO-d6) δ8.61(d,J=1.7Hz,1H),8.20(d,J=1.8Hz,1H),8.04-7.98(m,2H),7.94(dd,J=7.4,1.9Hz,1H),7.84(dd,J=8.6,1.9Hz,1H),7 .69(d,J=1.7Hz,1H),7.62(dd,J=7.8,1.7Hz,1H),7.59-7.32(m,5H),7.2 9(s,2H),4.36(t,J=8.5Hz,2H),3.78(p,J=8.1Hz,1H),3.39-3.17(m,6H). LC / MS: 469.1[M+H].

[0782] Preparation of Intermediate 51 (5-fluoro-1-(6-fluoro-5-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)-3-methylindoline-6-sulfonamide):

[0783]

[0784] Intermediate 51 was prepared in a manner analogous to Example 101 using 5-fluoro-3-methylindoline-6-sulfonamide and 5-bromo-6-fluoro-2,3-dihydrobenzofuran-2-carboxylic acid (General Procedure B). LC / MS: (General Procedure B) LC / MS: 472.2 [M+H].

[0785] Preparation Example 136 and Example 137 ((S)-5-fluoro-1-((R)-6-fluoro-5-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)-3-methylindoline-6-sulfonamide); (R)-5-fluoro-1-((R)-6-fluoro-5-(pyridin-2-yl)-2,3-dihydrobenzofuran-2-carbonyl)-3-methylindoline-6-sulfonamide

[0786]

[0787] Chiral SFC separation of intermediate 51 was performed using an AD-H column (250 x 21 mm 5 um) with 45% EtOH as co-eluent.

[0788] The third eluent was collected and concentrated to provide Example 136. 1 H NMR (400MHz, DMSO-d6) δ8.68 (dd, J=5.0, 1.9Hz, 1H), 8.49 (d, J=6.6Hz, 1H), 7.88 (td, J=7.7 ,1.9Hz,1H),7.81(d,J=8.0Hz,1H),7.77-7.68(m,1H),7.61(s,2H),7.45(d,J=9.7Hz,1H), 7.36(ddd,J=7.5,4.8,1.1Hz,1H),6.93(d,J=11.8Hz,1H),5.83(dd,J=10.0,6.1Hz,1H),4. 48(t,J=9.9Hz,1H),3.93(dd,J=10.4,6.8Hz,1H),3.70-3.48(m,3H),1.36(d,J=6.9Hz,3H). LC / MS: 472.2[M+H].

[0789] The fourth eluate was collected and concentrated to provide Example 137. 1H NMR (400MHz, DMSO-d6) δ8.74-8.67(m,1H),8.49(d,J=6.6Hz,1H),7.91(td,J=7.7,1.9Hz,1 H),7.81(d,J=8.0Hz,1H),7.74(dd,J=8.0,2.3Hz,1H),7.61(s,2H),7.45(d,J=9.6Hz,1H), 7.38(ddd,J=7.5,4.8,1.2Hz,1H),6.93(d,J=11.8Hz,1H),5.83(dd,J=10.0,6.1Hz,1H),4. 58(t,J=9.9Hz,1H),3.83(dd,J=10.3,7.0Hz,1H),3.74-3.54(m,3H),1.36(d,J=6.9Hz,3H). LC / MS: 472.2[M+H].

[0790] Preparation of Intermediate 52 (5-fluoro-3-(trifluoromethyl)indoline-6-sulfonamide):

[0791]

[0792] Preparation of Intermediate 52.1 (5-bromo-4-fluoro-2-iodoaniline): To a solution of 3-bromo-4-fluoroaniline (25 g, 131.6 mmol, 1 eq) in acetic acid (130 mL) was added NIS (31.1 g, 138.1 mmol, 1.1 eq) in portions. The mixture was stirred at 20 °C for 2 h. The mixture was concentrated under reduced pressure, and the resulting residue was dissolved in EtOAc (200 mL), washed with saturated sodium carbonate (100 mL), brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was purified using flash column chromatography on silica gel (eluted with 10 to 20% EtOAc in petroleum ether) to give Intermediate 52.1. LC / MS: 315.9 [M+H].

[0793] Preparation of intermediate 52.2 (N-(5-bromo-4-fluoro-2-iodophenyl)-4-methylbenzenesulfonamide): To a solution of intermediate 52.1 (25.3 g, 80.1 mmol, 1 eq) and pyridine (15.8 g, 200.4 mmol, 16.18 mL, 2.5 eq) in DCM (300 mL) was added 4-methylbenzenesulfonyl chloride (30.5 g, 160.3 mmol, 2 eq). The mixture was stirred at 20 °C for 16 h. The reaction was quenched with water (300 mL) and extracted with DCM (300 mL*3). The combined organics were washed with brine (150 mL), dried over Na2SO4, filtered and concentrated under reduced pressure, and the resulting residue was purified by flash column chromatography on silica gel (eluted with 5% EtOAc in petroleum ether) to give intermediate 52.2. LC / MS: 469.9 [M+H].

[0794] Preparation of intermediate 52.3 (N-(5-bromo-4-fluoro-2-(3,3,3-trifluoroprop-1-en-2-yl)phenyl)-4-methylbenzenesulfonamide): To a solution of intermediate 52.2 (23.1 g, 49.1 mmol, 1 eq) in H2O (70 mL) and toluene (280 mL) was added 4,4,6-trimethyl-2-[1-(trifluoromethyl)vinyl]-1,3,2-dioxaborolane (12 g, 54.05 mmol, 1.1 eq), Pd(dppf)Cl2.CH2Cl2 (2.0 g, 2.4 mmol, 0.05 eq) and Cs2CO3 (48.0 g, 147.4 mmol, 3 eq). The mixture was degassed and purged with N2 three times. The mixture was heated to 90°C and stirred under N2 atmosphere for 16 h. The reaction was cooled to 20°C and diluted with water (200 mL), filtered, and the filter cake was rinsed with EtOAc (50 mL*3). The combined filtrate was then extracted with EtOAc (200 mL*3). The combined organics were washed with brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure, and the resulting residue was purified by flash column chromatography on silica gel (eluted with 5% EtOAc in petroleum ether) to give Intermediate 52.3. LC / MS: 438.0 [M+H].

[0795] Preparation of intermediate 52.4 (6-bromo-5-fluoro-1-tosyl-3-(trifluoromethyl)indoline): To a solution of intermediate 52.3 (8.3 g, 18.9 mmol, 1 eq) in DMF (80 mL) was added DBU (864.9 mg, 5.6 mmol, 856.4 uL, 0.3 eq), and the mixture was stirred at 120 °C for 1 h. The reaction was cooled to 20 °C and quenched with water (100 mL), and extracted with ethyl acetate (150 mL*3). The combined organics were washed with water (100 mL*3), brine (100 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography on silica gel (eluted with 7% EtOAc in petroleum ether) to give intermediate 52.4. LC / MS: 438.0 [M+H].

[0796] Preparation of intermediate 52.5 (6-(benzylthio)-5-fluoro-1-tosyl-3-(trifluoromethyl)indoline): To a solution of intermediate 52.4 (6.2 g, 14.3 mmol, 1 eq) in dioxane (80 mL) was added Pd2(dba)3 (524.0 mg, 572.3 umol, 0.04 eq), Xantphos (662.2 mg, 1.1 mmol, 0.08 eq), DIEA (3.7 g, 28.6 mmol, 4.9 mL, 2 eq) and BnSH (1.8 g, 15.0 mmol, 1.7 mL, 1.05 eq). The mixture was degassed and purged with N2 three times. The mixture was heated to 100 °C and stirred under N2 atmosphere for 16 h. The reaction mixture was cooled to room temperature and quenched with water (80 mL) and extracted with ethyl acetate (100 mL*3). The combined organics were washed with brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography on silica gel (eluted with 10% EtOAc in petroleum ether) to give Intermediate 52.5. LC / MS: 482.1 [M+H].

[0797] Preparation of intermediate 52.6 (5-fluoro-1-tosyl-3-(trifluoromethyl)indoline-6-sulfonyl chloride): To a solution of intermediate 52.5 (5.5 g, 11.4 mmol, 1 eq) in AcOH (60 mL) and H2O (20 mL) was added NCS (4.6 g, 34.4 mmol, 3 eq) in portions. The mixture was stirred at 20°C for 16 h. The reaction was quenched with water (50 mL) and extracted with ethyl acetate (50 mL*3). The combined organics were washed with brine (30 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography on silica gel (eluted with 15% EtOAc in petroleum ether) to give intermediate 52.6. LC / MS: 458.0 [M+H].

[0798] Preparation of intermediate 52.7 (5-fluoro-1-tosyl-3-(trifluoromethyl)indoline-6-sulfonamide): A solution of intermediate 52.6 (4.5 g, 9.8 mmol, 1 eq) and NH3.H2O (22.9 g, 196.5 mmol, 25.2 mL, 30% purity, 20 eq) in THF (45 mL) was stirred at 20°C for 2 h. The mixture was concentrated under reduced pressure to give intermediate 52.7, which was used in the next step without purification. LC / MS: 439.0 [M+H].

[0799] Preparation of intermediate 52 (5-fluoro-3-(trifluoromethyl)indoline-6-sulfonamide): A mixture of Mg (6.2 g, 256.1 mmol, 31.2 eq) in MeOH (280 mL) was stirred at 20 °C until H2 formation was observed. Then a solution of intermediate 52.7 (3.6 g, 8.2 mmol, 1 eq) in MeOH (35 mL) was added dropwise to the mixture. The mixture was stirred at 20 °C for 3 h. The reaction was quenched with saturated NH4Cl aqueous solution (300 mL) and extracted with DCM (300 mL*5). The combined organics were washed with brine (100 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography on silica gel (eluted with 40% EtOAc in petroleum ether) to give intermediate 52. LC / MS: 285.0 [M+H].

[0800] Chiral SFC separation of intermediate 52 was performed using the following conditions: ChiralPak IH, 250*30 mm, 10 um. Mobile phase was 33% MeOH with 0.1% NH3. The first eluent was collected and concentrated to give (S)-intermediate 52. LC / MS: 285.0 [M+H]. The second eluent was collected and concentrated to give (R)-intermediate 52. LC / MS: 285.0 [M+H].

[0801] Preparation Example 138 (S)-5-fluoro-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)-3-(trifluoromethyl)indoline-6-sulfonamide:

[0802]

[0803] Example 138 was prepared in a manner analogous to Example 92 using (S)-Intermediate 52 and Intermediate 38.3 as starting materials. 1 H NMR (400MHz, DMSO-d6) δ8.70(ddd,J=6.7,4.2,2.8Hz,2H),8.03(d,J=4.2Hz,2H),7.93(d,J=8.3Hz,2H),7.73(s,2H),7.61-7.43(m,2H ),7.38(d,J=7.8Hz,1H),4.86-4.40(m,3H),3.74-3.61(m,1H),3.51-3.34(m,2H),3.07(dd,J=14.7,7.1Hz,1H),1.38(d,J=6.9Hz,3H). LC / MS: 520.2[M+H].

[0804] Preparation Example 139 (R)-5-fluoro-1-((1R,2S)-1-methyl-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)-3-(trifluoromethyl)indoline-6-sulfonamide:

[0805]

[0806] Example 139 was prepared in a manner analogous to Example 92 using (R)-Intermediate 52 and Intermediate 38.3 as starting materials. 1 H NMR (400MHz, DMSO-d6) δ8.75-8.65(m,2H),8.02(d,J=3.8Hz,2H),7.96-7.88(m,2H),7.73(s,2H),7.61-7.32(m,3H), 4.81-4.43(m,3H),3.74-3.61(m,1H)(m,1H),3.50-3.36(m,2H),3.09(tt,J=12.0,5.2Hz,1H),1.38(d,J=6.9Hz,3H). LC / MS: 520.2[M+H].

[0807] Preparation of Intermediate 53: (S)-5-(Pyridin-2-yl)-2,3-dihydro-1H-indene-2-carboxylic acid

[0808]

[0809] Intermediate 53 was obtained as the second eluent of SFC purification of Intermediate 2 using a Chiralpak AD-H column with 20% methanol as co-solvent. LC / MS: 238.1 [MH].

[0810] Preparation Example 140 ((S)-5-Fluoro-2-methyl-1-((S)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide)

[0811]

[0812] Example 140 was prepared in a manner analogous to Example 35 using (S)-Intermediate 21 and Intermediate 53 (General Procedure A). 1 HNMR(400MHz,DMSO-d6)δ8.71(d,J=5.0Hz,1H),8.54(d,J=6.6Hz,1H),8.05(s,1H),7 .92(s,1H),7.88(d,J=8.2Hz,1H),7.58(s,2H),7.50(td,J=5.4,2.6Hz,1H),7.40(dd ,J=12.5,8.8Hz,2H),4.90(p,J=6.6Hz,1H),3.56-3.35(m,3H),3.26(dd,J=16.4,8.5 Hz, 1H), 3.15 (dd, J = 15.9, 7.6Hz, 1H), 2.81 (d, J = 16.9Hz, 1H), 1.30 (d, J = 6.2Hz, 3H). LC / MS: 452.0[M+H].

[0813] Preparation Example 141 ((R)-5-Fluoro-2-methyl-1-((S)-5-(pyridin-2-yl)-2,3-dihydro-1H-indene-2-carbonyl)indoline-6-sulfonamide):

[0814]

[0815] Example 141 was prepared in a manner analogous to Example 35 using (R)-Intermediate 21 and Intermediate 53 (General Procedure B). 1HNMR (400MHz, DMSO-d6) δ8.68 (dd, J=4.8, 1.5Hz, 1H), 8.54 (d, J=6.6Hz, 1H), 7.9 9(dd,J=6.2,1.8Hz,2H),7.95-7.83(m,2H),7.58(s,2H),7.52-7.33(m,3H),4.91 (q,J=7.5,7.0Hz,1H),3.77-3.31(m,5H),3.42(ddd,J=29.3,16.2,8.2Hz,2H),3. 20(ddd,J=40.2,16.0,8.1Hz,2H), 2.81(d,J=16.9Hz,1H), 1.30(d,J=6.3Hz,3H). LC / MS:452.1[M+H].

[0816] Biological Assay

[0817] HSV-2 CELLOMICS test

[0818] The ability of the compound to inhibit HSV-2 replication was tested by monitoring the expression of HSV protein gD using a high-throughput assay based on immunofluorescence. 3-fold serial dilutions of 10 doses of the compound were prepared at an initial concentration of 0.2 or 2 mM in 100% DMSO. Using a Labcyte ECHO acoustic dispenser, 250 nl of the compound was sampled in quadruplicate to a black 384-well microplate (Greiner catalog number 781956) coated with collagen with a transparent bottom. The final starting concentration in the assay was 1 or 10 μM. DMSO (no compound) and priligy were included on each microplate as negative and positive controls.

[0819] ARPE-19 cells (ATCC catalog number CRL-2302) were maintained in DMEM / F-12 Glutamax medium (Thermo Fisher Scientific catalog number 10565018) supplemented with 10% FBS (Corning catalog number 35-011-CV) and 1% penicillin-streptomycin (catalog number 30-002-CI). Prior to confluence, cells were transferred to centrifuge tubes and spun at 1000 rpm for 5 minutes. Cells were resuspended in assay medium (DMEM / F-12 Glutamax, 2% FBS, 1% penicillin-streptomycin) and counted. Cell density was adjusted to 150,000 cells / ml and infected with HSV-2 virus (MS strain, ATCC catalog number VR-540) at an MOI of 0.06 in a 50 ml conical tube for 1 hour with constant shaking. The cells were then spun at 1000 rpm for 5 minutes and the medium was replaced with assay medium (EMD Millipore catalog number S1-100ML) containing 2% FBS or 10% human serum. 50 μl of the infection suspension was added to the microplate wells pre-spotted with the compounds (7,500 cells per well). The plates were incubated at 37° C. for 16 hours.

[0820] Cell culture medium was aspirated using a Biomek Fx, and 50 μl of a solution of paraformaldehyde (Electron Microscopy Sciences catalog number 15712-S) diluted to 4% in DPBS (Corning catalog number 21-031-CM) was added to each well. After incubation at room temperature for 30 minutes, the plate was washed 4 times with 100 μl / well of PBS using a Biotek plate washer. A 1:500 solution of the primary antibody (anti-HSVgD, Virusys catalog number P1103) was prepared in permeabilization buffer (Invitrogen catalog number 00-8333-56) and 50 μl was added to the wells. After incubation at room temperature for 1 hour, 50 μl of a 1:1000 solution of the secondary antibody (Alexa Fluor 488 goat anti-mouse, Thermo Fisher Scientific catalog number A11001) and DAPI (Thermo Fisher Scientific catalog number 62248) in permeabilization buffer was added to the wells and the plate was incubated at room temperature for 1 hour. The plates were washed again 4 times and 50 μl of DPBS was added to all wells before the plates were sealed with a black adhesive seal. Fluorescence was measured on a Cellomics plate reader.

[0821] Thermo Scientific HCS Studio software was used for data analysis. Briefly, DAPI nuclear staining was used to identify cells and thresholds were set to filter cells based on shape and size. A second threshold was set based on green fluorescence intensity (detection of HSV-2gD) to identify cells infected by HSV-2. Data were reported as the mean fluorescence intensity of HSV-2 infected cells. The EC50 value was defined as the compound concentration that caused the mean fluorescence intensity to decrease by 50% and a sigmoidal dose-response model was used to generate curve fitting for calculation. The EC50 of Priligy in this assay was 150 nM. The data of some compounds are reported in Table 1 below.

[0822] Table 1:

[0823]

[0824]

[0825]

[0826] MT-4CC50 Verification

[0827] Compounds were tested in duplicate in 384-well plates: 18 compounds. Compounds were diluted 3-fold with DMSO 7-point by Bravo. 2000 MT-4 cells were seeded at 20uL / well into the assay plate containing 20uL medium with compound to start the assay by Multi-drop. Plates were incubated at 37°C for 5 days. On day 6, CellTiter Glo 40uL was added to each well. Luminescence was read by Victor II. CC 50 The value was defined as the compound concentration that caused a 50% reduction in luminescence signal and was calculated using a sigmoidal dose-response model to generate a curve fit. The data for certain compounds are reported in Table 1 above.

[0828] HSV qPCR Assay

[0829] HSV replication in the presence or absence of compounds was measured by qPCR according to the following procedure: DMSO stock compound solutions (1-10 mM) were serially diluted (2.5-fold) in DMSO in a clear round-bottom 96-well plate. Compounds were then diluted 1:20 in assay medium (DMEM / F12 Glutama×+2% fetal bovine serum+1% penicillin-streptomycin) and 10 μL of these dilutions were added to 96-well tissue culture plates to give a final starting concentration between 0.5 and 5 μM.

[0830] ARPE-19 cells (ATCC catalog number CRL-2302) maintained in growth medium (DMEM / F12 Glutama×+10% FBS+1% penicillin streptomycin) were transferred to a centrifuge tube and spun at 1000 rpm for 5 minutes. The cells were resuspended in assay medium, counted, and the cell density was adjusted to 2.8E+05 cells / ml with assay medium. The cells were then infected with HSV-1 (KOS strain, ATCC catalog number VR-1493) or HSV-2 virus (MS strain, ATCC catalog number VR-540) at an MOI of 0.05 in a 50 ml conical tube for 1 hour under constant shaking. 90 μL of the infection suspension (25,000 cells) was added to the assay plate to which the compound had been added. After incubation overnight at 37°C, the cell culture medium was removed and the cells were lysed using the prepGEM Universal Kit (MicroGEM catalog number PUN1000). Specifically, 100 μL prepGEM master mix (94.75 μL water, 5 μL buffer, 0.25 μL enzyme stock solution) was added to each well and the plate was incubated at room temperature for 15 minutes, followed by incubation on a plate shaker for 5 minutes. The cell lysate was then transferred to a 96-well PCR compatible microplate (Applied Biosystems, catalog number N8010560). The plate was sealed with a heat-resistant plastic seal and heated on a thermal cycler using the following conditions: 75°C for 10 minutes, 95°C for 5 minutes. Finally, the plate was cooled to room temperature under slight vibration before qPCR was set up.

[0831] qPCR reactions were performed using the QuantiNova Multiplex PCR Kit (Qiagen catalog number 208456) in a total reaction volume of 20 μL. 15 μL of reagent mixture (5 μL 4X QuantiNova master mix, 0.1 μL QN Rox reference dye, 1 μL 20X HSV primer / probe mix, and 8.9 μL PCR grade water) and 5 μL of cell lysate were added to the wells of a 96-well fast optical microplate (Applied Biosystems catalog number 4246906). The plate was sealed with a clear seal, rotated, and the qPCR reactions were performed in an Applied Biosystems Quantstudio 7Flex instrument using the following conditions: 95°C for 2 minutes, followed by 40 cycles of alternating between 95°C for 5 minutes and 60°C for 30 seconds.

[0832] The analysis was performed using the dCT method, where dCT = CT (test) - CT (DMSO). -dCTThe fold change was calculated using the equation. This fold change was then converted to a percentage relative to the DMSO control (no drug). EC50 was determined by nonlinear regression analysis using GraphPad Prism software.

[0833] type Target Sequence (5' to 3') Forward Primer HSV-1 and HSV-2 UL30 genes AGAGGGACATCCAGGACTTTGT (SEQ ID NO: 1) Reverse primer HSV-1 and HSV-2 UL30 genes CAGGCGCTTGTTGGTGTAC (SEQ ID NO: 2) Probe HSV-1 and HSV-2 UL30 genes ACCGCCGAACTGAGCA (SEQ ID NO: 3)

[0834] In this assay, the EC50 for both priligy and amonetir was 14 nM. The EC50 for acyclovir was 1250 nM. The data for certain compounds are reported in Table 2 below.

[0835] Table 2:

[0836] Examples EC50-HSV2-qPCR (nM) IC50-hCAII(nM) IC50-hCAI(nM) 3 18.5 5 10.9 ≥25000 15 4.9 47100 ≥50000 35 1.1 2900 35300 44 1.0 5800 ≥50000 65 1.4 12000 ≥50000 70 25.8 ≥25000 73 17.5 ≥25000 74 8.3 ≥25000 75 14.3 ≥25000 76 22.0 ≥25000 81 1.9 ≥25000 94 3.9 ≥50000 97 1.3 ≥50000 ≥50000 106 10.9 125 0.56 26500 ≥50000 126 56.7 2000 ≥50000 127 58.3 2460 4190 128 1.4 7420 ≥50000 138 2.0 1970 41000

[0837] Carbonic anhydrase (esterase) biochemical assay

[0838] The ability of compounds to inhibit human carbonic anhydrase (hCA)-mediated hydrolysis of 4-nitrophenylacetate (4NPA) was tested in a high-throughput 384-well assay format (Verpoorte et al., JBC, 1967). 10 doses, 3-fold serial dilutions of the compound were prepared at a starting concentration of 10 mM in 100% DMSO. 200 nl of compound was then spotted in quadruplicate onto a transparent 384-well microplate (Perkin Elmer catalog number 6007640) using a Labcyte ECHO acoustic dispenser. The final starting concentration in the assay was 50 μM. DMSO (no compound) and acetyl azoamide were included as negative and positive controls on each microplate, respectively.

[0839] A 1.5 μM hCAI solution (R&D systems catalog number 2180-CA) or a 1 μM hCAII solution (Genscript catalog number U3256FL150-4 / P5GA002) was prepared in assay buffer (25 mM Tris (pH 7.5), 100 mM NaCl, 1% DMSO) and 20 μl was added to the compound using a Biotek Micro Flo. After a 15 minute pre-incubation at room temperature, 20 μl of a 4 mM solution of 4NPA substrate (Sigma catalog number N8130) in assay buffer was added to start the reaction. The microplate was incubated at room temperature for 60 minutes after which the absorbance was read at 405 nM on an Envision plate reader. The IC50 value was defined as the compound concentration that caused a 50% reduction in the absorbance signal and was calculated using a sigmoidal dose-response model to generate a curve fit. The IC50 of acetyl azoamide in the hCAII assay was 0.04 uM and in the hCAI assay was 1.1 uM. Data for certain compounds are reported in Table 2 above.

[0840] Plasma stability test

[0841] Test compounds were incubated at 2 μM in rat or human plasma (BioIVT, Westbury, NY) at 37°C for up to 4 hours. At designated time points, aliquots from the incubations were quenched by the addition of 9 volumes of 100% acetonitrile containing an internal standard. After the last collection, samples were centrifuged at 4500 rpm for 10 minutes, and the supernatant was transferred to a new plate containing an equal volume of water for analysis by liquid chromatography coupled to triple quadrupole mass spectrometry (LC-MS / MS). The percentage of test compound remaining in plasma after incubation (analyte to internal standard peak area ratio) was plotted against incubation time, and the plasma half-life (t1 / 2) was calculated from a linear fit of the natural logarithm of the curve.

[0842] Stability assay in cryopreserved hepatocytes

[0843] Test compounds were incubated at 1 μM with cryopreserved rat or human hepatocytes (BioIVT, Westbury, NY) (1×10 6 Cells / mL / well) were cultivated together for up to 6 hours. At the specified time point, the sample was transferred to a 96-well plate and quenched with 2 volumes of solution containing 90% acetonitrile, 10% methanol, 0.1% formic acid and internal standards. The sample plate was centrifuged at 3200rpm for 15 minutes, and the supernatant was transferred to a new plate containing half volume of water. The resulting solution was analyzed by LC-MS / MS. Data (analyte to internal standard peak area ratio) were plotted on a semi-logarithmic scale and fitted using exponential fitting. Assuming first-order kinetics, the half-life (t1 / 2) and metabolic rate were determined. Liver clearance was predicted by half-life calculation using a well-stirred model. The data of some compounds are reported in Table 3 below.

[0844] Table 3:

[0845]

[0846]

[0847] ***

[0848] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0849] Therefore, it should be understood that although the present disclosure has been specifically disclosed through preferred embodiments and optional features, modifications, improvements, and variations of the present disclosure embodied therein disclosed herein may be made by those with ordinary knowledge in the art, and the modifications, improvements, and variations are considered to be within the scope of the present disclosure. The materials, methods, and examples provided herein represent preferred embodiments, which are exemplary and should not be considered to limit the scope of the present disclosure.

[0850] The present disclosure has been broadly and generally described herein. Various narrower species and subgeneric groupings that fall within the scope of the general disclosure also form part of the present disclosure. This includes the general description of the present disclosure with any subject matter of the genus removed by antecedent or negative limitation, regardless of whether the removed material is specifically set forth herein.

[0851] In addition, where features or aspects of the disclosure are described in terms of Markush groupings, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0852] It should be understood that although the present disclosure has been described in conjunction with the above embodiments, the foregoing description and examples are intended to illustrate rather than limit the scope of the present disclosure. Other aspects, advantages, and modifications within the scope of the present disclosure will be apparent to those with ordinary knowledge in the relevant technical field of the present disclosure.

Claims

1. A compound of formula (I) or a pharmaceutically acceptable salt thereof, in R 1 yes R 2a , R 2b , and R 2c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, C 1-6 Haloalkoxy or -SCF3; R 3a and R 3b are independently H, halogen, C 1-6 Alkyl or C 1-6 Haloalkyl; or R 3a and R 3b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 3a and R 3b The cycloalkyl group formed may be optionally substituted by one to three Z 3 replace; X a and X b Each independently is O or CR 7a R 7b ; R 7a and R 7b Each independently is H, C 1-6 Alkyl or C 1-6 Haloalkyl; or R 7a and R 7b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a and R 7b The C 3-6 The cycloalkyl group may optionally be substituted by one to three Z 7 replace; R 4a , R 4b , and R 4c are independently H, halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, -CN, -SCF3 or optionally through Z 4 Substituted C 3-6 Cycloalkyl; R 5 It is C 6-10 Aryl or heteroaryl; wherein R 5 The aryl or heteroaryl group may be optionally substituted by one to three Z groups which may be the same or different. 5 Replacement; R 5 The heteroaryl group is a 5- to 10-membered heteroaryl group having one to three heteroatoms each independently being N, O or S; R 6 It is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-8 Alkoxyalkyl or C 3-6 Cycloalkyl, where R 6 The cycloalkyl group of 6 replace; and Each Z 3 , Z 4 , Z 5 , Z 6 , and Z 7 are independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 Haloalkoxy.

2. The compound or pharmaceutically acceptable salt thereof according to claim 1, wherein the compound of formula (I) is represented by formula (IIa):

3. The compound or pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein the compound of formula (I) is represented by formula (IIb):

4. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound of formula (I) is represented by formula (IIc):

5. The compound or pharmaceutically acceptable salt thereof according to claim 1 or 4, wherein the compound of formula (I) is represented by formula (IId):

6. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound of formula (I) is represented by formula (IIe): Where R 7a1 and R 7b1 Each independently is H, C 1-6 Alkyl or C 1-6 Haloalkyl; or R 7a1 and R 7b1 Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl; wherein R 7a1 and R 7b1 The C 3-6 The cycloalkyl group may optionally be substituted by one to three Z 7 replace.

7. The compound or pharmaceutically acceptable salt thereof according to claim 6, wherein the compound of formula (I) is represented by formula (IIf):

8. The compound according to any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof, wherein 9. A compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, wherein R 1 yes 10. The compound according to any one of claims 1 to 8 or a pharmaceutically acceptable salt thereof, wherein R 1 yes 11. A compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, wherein R 2a It's H.

12. A compound according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, wherein R 2a Is halogen or C 1-6 alkyl.

13. A compound according to any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof, wherein R 2b It's H.

14. A compound according to any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof, wherein R 2b It's a halogen.

15. A compound according to any one of claims 1 to 12 and 14, or a pharmaceutically acceptable salt thereof, wherein R 2b It is F, Cl or Br.

16. A compound according to any one of claims 1 to 12, 14 and 15, or a pharmaceutically acceptable salt thereof, wherein R 2b It's F.

17. A compound according to any one of claims 1 to 16 or a pharmaceutically acceptable salt thereof, wherein R 2c It's H.

18. A compound according to any one of claims 1 to 16 or a pharmaceutically acceptable salt thereof, wherein R 2c Is halogen or C 1-6 alkyl.

19. A compound according to any one of claims 1 to 16 and 18, or a pharmaceutically acceptable salt thereof, wherein R 2c It's F.

20. A compound according to any one of claims 1 to 19 or a pharmaceutically acceptable salt thereof, wherein R 3a It's H.

21. A compound according to any one of claims 1 to 19 or a pharmaceutically acceptable salt thereof, wherein R 3a It is C 1-6 alkyl.

22. A compound according to any one of claims 1 to 21 or a pharmaceutically acceptable salt thereof, wherein R 3b It's H.

23. A compound according to any one of claims 1 to 21 or a pharmaceutically acceptable salt thereof, wherein R 3b It is C 1-6 alkyl.

24. A compound according to any one of claims 1 to 21 or a pharmaceutically acceptable salt thereof, wherein R 3a and R 3b Together with the carbon to which they are attached, they form C 3-6 Cycloalkyl.

25. A compound according to any one of claims 1 to 24 or a pharmaceutically acceptable salt thereof, wherein R 4a It's H.

26. A compound according to any one of claims 1 to 24, or a pharmaceutically acceptable salt thereof, wherein R 4a It's a halogen.

27. A compound according to any one of claims 1 to 26, or a pharmaceutically acceptable salt thereof, wherein R 4b It's H.

28. A compound according to any one of claims 1 to 26, or a pharmaceutically acceptable salt thereof, wherein R 4b It's a halogen.

29. A compound according to any one of claims 1 to 28, or a pharmaceutically acceptable salt thereof, wherein R 4c It's H.

30. A compound according to any one of claims 1 to 28, or a pharmaceutically acceptable salt thereof, wherein R 4c It's a halogen.

31. A compound according to any one of claims 1 to 30, or a pharmaceutically acceptable salt thereof, wherein R 5 is optionally substituted by one to three Z which may be the same or different 5 Substituted C 6-10 Aryl, each Z 5 are independently halogen, -CN, C 1-6 Alkyl or C 1-6 Haloalkyl.

32. A compound according to any one of claims 1 to 31 or a pharmaceutically acceptable salt thereof, wherein R 5 It is phenyl, 33. A compound according to any one of claims 1 to 30, or a pharmaceutically acceptable salt thereof, wherein R 5 is a heteroaryl group; wherein R 5 The heteroaryl group may be optionally substituted by one to three Z 5 replace.

34. A compound according to any one of claims 1 to 30 and 33, or a pharmaceutically acceptable salt thereof, wherein R 5 is a heteroaryl group selected from the group consisting of thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, pyrrolyl, pyrazolyl, triazolyl, pyridinyl, pyrazinyl and pyrimidinyl; R 5 The heteroaryl group may be optionally substituted by one to three Z 5 replace.

35. A compound according to any one of claims 1 to 30, 33 and 34, or a pharmaceutically acceptable salt thereof, wherein R 5 is optionally substituted by one to three Z which may be the same or different 5 Substituted pyridinyl.

36. A compound according to any one of claims 1 to 30 and 33 to 35, or a pharmaceutically acceptable salt thereof, wherein R 5 is optionally halogenated, C 1-3 Alkyl, -CN or -OCH3 substituted pyridyl.

37. A compound according to any one of claims 1 to 30 and 33 to 36, or a pharmaceutically acceptable salt thereof, wherein R 5 Is pyridyl, 38. A compound according to any one of claims 1 to 30 and claims 33 to 37, or a pharmaceutically acceptable salt thereof, wherein R 5 yes 39. A compound according to any one of claims 1 to 30, 33 and 34, or a pharmaceutically acceptable salt thereof, wherein R 5 is optionally halogenated, C 1-3 Alkyl, -CN or -OCH3 substituted diazine group.

40. A compound according to any one of claims 1 to 30, 33, 34 and 39, or a pharmaceutically acceptable salt thereof, wherein R 5 yes 41. A compound according to any one of claims 1 to 30, 33 and 34, or a pharmaceutically acceptable salt thereof, wherein R 5 is triazolyl or pyrazolyl, wherein the triazolyl or pyrazolyl are each optionally substituted by halogen, -CN, C 1-3 Alkyl or -OCH3 substituted.

42. A compound according to any one of claims 1 to 30, 33, 34 and 41, or a pharmaceutically acceptable salt thereof, wherein R 5 yes 43. A compound according to any one of claims 1 to 30, 33 and 34, or a pharmaceutically acceptable salt thereof, wherein R 5 is thiazolyl, isothiazolyl, oxazolyl or isoxazolyl; R 5 The thiazolyl, isothiazolyl, oxazolyl and isoxazolyl groups are each optionally substituted by halogen, C 1-3 Alkyl, -CN or -OCH3 substituted.

44. A compound according to any one of claims 1 to 30, 33, 34 and 43, or a pharmaceutically acceptable salt thereof, wherein R 5 yes 45. A compound according to any one of claims 1 to 44, or a pharmaceutically acceptable salt thereof, wherein R 7a and R 7b Each independently is H or C 1-6 alkyl.

46. ​​A compound according to any one of claims 1 to 45, or a pharmaceutically acceptable salt thereof, wherein R 7a It's H.

47. A compound according to any one of claims 1 to 45, or a pharmaceutically acceptable salt thereof, wherein R 7a It is C 1-3 alkyl.

48. A compound according to any one of claims 1 to 47, or a pharmaceutically acceptable salt thereof, wherein R 7b It's H.

49. A compound according to any one of claims 1 to 47, or a pharmaceutically acceptable salt thereof, wherein R 7b It is C 1-3 alkyl.

50. A compound according to any one of claims 1 to 47, or a pharmaceutically acceptable salt thereof, wherein R 7b It is -CH3.

51. A compound according to any one of claims 1, 6 to 50, or a pharmaceutically acceptable salt thereof, wherein R 7a1 and R 7b1 Each independently is H or C 1-6 alkyl.

52. A compound according to any one of claims 6 to 51 or a pharmaceutically acceptable salt thereof, wherein R 7a1 It's H.

53. A compound according to any one of claims 6 to 51 or a pharmaceutically acceptable salt thereof, wherein R 7a1 It is C 1-3 alkyl.

54. A compound according to any one of claims 6 to 53, or a pharmaceutically acceptable salt thereof, wherein R 7b1 It's H.

55. A compound according to any one of claims 6 to 53, or a pharmaceutically acceptable salt thereof, wherein R 7b1 It is C 1-3 alkyl.

56. A compound according to any one of claims 6 to 53, or a pharmaceutically acceptable salt thereof, wherein R 7b1 It is -CH3.

57. A compound according to any one of claims 1 and 8 to 44, or a pharmaceutically acceptable salt thereof, wherein X a and X b It's O.

58. A compound according to any one of claims 1 to 7 and 9 to 57, or a pharmaceutically acceptable salt thereof, wherein R 6 It's H.

59. A compound according to any one of claims 1 to 57, or a pharmaceutically acceptable salt thereof, wherein R 6 It is C 1-6 Alkyl or C 1-6 Haloalkyl.

60. A compound according to any one of claims 1 to 57 and 59, or a pharmaceutically acceptable salt thereof, wherein R 6 is -CH3 optionally substituted by 1 to 3 halo groups.

61. A compound according to any one of claims 1 to 57, 59 and 60, or a pharmaceutically acceptable salt thereof, wherein R 6 It is -CH3, -CHF2, -CH2F, -CF3, -CHCl2 or -CH2Cl.

62. A compound according to any one of claims 1 to 57 and 59 to 61, or a pharmaceutically acceptable salt thereof, wherein R 6 It is -CH3.

63. A compound selected from or a pharmaceutically acceptable salt thereof.

64. A compound selected from: or a pharmaceutically acceptable salt thereof.

65. A compound selected from Examples 1 to 20, 22 to 29, 31, 33 to 41, 43 to 53, 56 to 65, 68 to 83, 85 to 119, 123, and 125 to 141, or a pharmaceutically acceptable salt thereof.

66. A compound selected from Examples 1 to 20, 22 to 29, 31, 33 to 41, 43 to 53, 56 to 65, 68 to 83, 85 to 119, 123, and 125 to 141.

67. A pharmaceutical composition comprising a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier.

68. The pharmaceutical composition of claim 67, further comprising one, two, three or four additional therapeutic agents.

69. The pharmaceutical composition of claim 68, wherein the additional therapeutic agent is selected from famciclovir, acyclovir and valacyclovir.

70. A method of treating a herpes virus infection comprising administering to a patient suffering from the infection a therapeutically effective amount of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof, or administering to a patient in need thereof a composition according to any one of claims 67 to 69.

71. The method of claim 70, wherein the method comprises administering a composition according to any one of claims 1 to 65 or a pharmaceutically acceptable salt thereof, or any one of claims 66 to 68, in combination with one, two, three or four additional therapeutic agents.

72. The method of claim 70 or 71, wherein the herpes virus is HSV-1 or HSV-2.

73. A method for treating a condition induced, aggravated or accelerated by a herpes virus, comprising administering to a patient a therapeutically effective amount of a compound according to any one of claims 1 to 66, or a pharmaceutically acceptable salt thereof, or administering to a patient in need thereof a composition according to any one of claims 67 to 69.

74. The method of claim 73, wherein the method comprises administering a compound according to any one of claims 1 to 65, or a pharmaceutically acceptable salt thereof, or a composition according to any one of claims 66 to 68 in combination with one, two, three or four additional therapeutic agents.

75. The method of claim 73 or 74, wherein the condition is genital herpes, herpes labialis, HSV keratitis, HSV encephalitis, or disseminated HSV.

76. Use of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof for treating a viral infection.

77. Use of a compound according to any one of claims 1 to 66, or a pharmaceutically acceptable salt thereof, for treating a viral infection caused by a herpes virus.

78. Use of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof for treating a viral infection caused by HSV-1 or HSV-2.

79. Use of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof for preparing a medicament for preventing / treating viral infection.

80. Use of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof for preparing a medicament for preventing / treating viral infection caused by herpes virus.

81. Use of a compound according to any one of claims 1 to 66 or a pharmaceutically acceptable salt thereof for preparing a medicament for preventing / treating viral infection caused by HSV-1 or HSV-2.

82. A compound according to any one of claims 1 to 66, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to any one of claims 67 to 69, for use in a method of treating a viral infection caused by HSV-1 or HSV-2.

83. The compound, pharmaceutically acceptable salt or pharmaceutical composition for use according to claim 82, wherein the viral infection is genital herpes, herpes labialis, HSV keratitis, HSV encephalitis or disseminated HSV.

84. The compound, pharmaceutically acceptable salt thereof or pharmaceutical composition for use according to claim 82 or 83, wherein the compound or pharmaceutically acceptable salt thereof is administered in combination with another therapeutic agent.

85. A compound according to any one of claims 1 to 66, or a pharmaceutically acceptable salt thereof, for use in therapy.

Images