IbGSTL2 protein and application thereof in regulation and control of starch synthesis

Abstract

The invention belongs to the technical field of genetic engineering, and discloses an IbGSTL2 protein and application thereof in regulation and control of starch synthesis. The technical problem to be solved by the invention is how to regulate and control the starch content of plants. The IbGSTL2 protein disclosed by the invention is a protein of which the amino acid sequence is SEQ ID No. 1. Experiments prove that a plant over-expressed with the IbGSTL2 gene has higher starch content and amylopectin proportion, and the activity of a key enzyme synthesized with amylopectin is improved; the plant with interference expression of the IbGSTL2 gene has lower starch content and amylopectin proportion, and the activity of a key enzyme synthesized with amylopectin is reduced. The result shows that the IbGSTL2 protein and the coding gene not only can regulate and control the starch content, but also can regulate and control the ratio of amylopectin to amylose.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to IbGSTL2 protein and application thereof in regulating starch synthesis. Background Art

[0002] Starch is an important product of plant photosynthesis. It is the most abundant and widely distributed carbohydrate in plants. It is not only the main energy source in human daily diet, but also the main source of feed. At the same time, it is an important raw material for industrial production and is widely used in winemaking, textiles, papermaking, and chemical industries. Starch mainly exists in the seeds, roots, tubers, and fruits of plants. The starch content of different crops varies.

[0003] sweet potato( Ipomoea batatas ) The tubers are rich in starch, and their utilization value is very huge. As a marginal land crop, the planting area of ​​sweet potato will tend to shrink further without competing with staple food. Therefore, it is an effective means to use genetic engineering to cultivate high-yield and high-starch sweet potato varieties. However, the transcriptional regulatory mechanism of starch synthesis in sweet potato tubers is still unknown.

[0004] It is of great significance to explore the genes related to starch synthesis in sweet potato tubers, conduct in-depth research on the mechanism of starch synthesis, and regulate plant starch production in combination with plant genetic engineering. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to regulate the starch content of plants and the ratio of amylose to straight-chain starch in starch.

[0006] In order to solve the above technical problems, the present invention first provides any of the following applications of a protein or a substance for regulating the content or activity of the protein: D1) Regulate the starch content of plants; D2) preparing products for regulating plant starch; D3) Regulate the ratio of amylose to amylopectin in plant starch; D4) preparing products for regulating the ratio of amylose to amylopectin in plant starch; D5) Cultivating plants with altered starch content; D6) preparing products from plants with altered starch content; D7) Cultivating plants with altered ratios of amylose to amylopectin in starch; D8) preparing products of plants cultivated with modified ratios of amylose to amylopectin in starch; D9) regulates the activity of enzymes related to starch synthesis in plants; The protein is derived from sweet potato ( Ipomoea batatas), whose name is IbGSTL2, IbGSTL2 is as follows: A1), A2) or A3): A1) a protein whose amino acid sequence is SEQ ID No. 1; A2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 1 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

[0007] The IbGSTL2 protein in A2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.1 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated, and then the identity value (%) can be obtained. The 75% or greater identity refers to 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0008] The IbGSTL2 protein in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0009] The gene encoding the IbGSTL2 protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.2, and / or performing missense mutation of one or several base pairs, and / or attaching a coding sequence of a tag to its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID No.2 encodes the IbGSTL2 protein shown in SEQ ID No.1.

[0010] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0011] In the above application, the substance that regulates the content or activity of IbGSTL2 protein can be any one of the following B1) to B9): B1) Nucleic acid molecule encoding IbGSTL2 protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) a nucleic acid molecule that reduces the content or activity of IbGSTL2 protein; B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

[0012] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0013] A person skilled in the art can easily mutate the nucleotide sequence encoding the IbGSTL2 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the IbGSTL2 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the IbGSTL2 protein and have the function of the IbGSTL2 protein.

[0014] In the above application, the nucleic acid molecule described in B1) may be as follows: b11) or b12): b11) The coding sequence is the DNA molecule of SEQ ID No. 2 in the sequence list; b12) A DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) and encoding the IbGSTL2 protein.

[0015] b11) can specifically be a DNA molecule shown in SEQ ID No.2.

[0016] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.2. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0017] The above 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0018] In the above application, the expression cassette containing the nucleic acid molecule encoding the IbGSTL2 protein (IbGSTL2 gene expression cassette) described in B2) refers to a DNA capable of expressing the IbGSTL2 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the IbGSTL2 gene, but also a terminator for terminating transcription of the IbGSTL2 gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); a tomato proteinase inhibitor II promoter (PIN2) or a LAP promoter (both of which can be induced by methyl jasmonate); a heat shock promoter (U.S. Pat. No. 5,187,267); a tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); a seed-specific promoter, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), a promoter specific for seed storage proteins (e.g., phaseolin, napin, oleosin and soybean beta conglycin promoters (Beachy et al. (1985) EMBO J. 4: 3047-3053). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated in their entirety.Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0019] The recombinant vector containing the IbGSTL2 gene expression cassette can be constructed using existing expression vectors. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301 or pCAMBIA1391-Xb (CAMBIA Company), etc. The plant expression vector may also include the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos), the non-translated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes ( GUS genes, luciferase genes, etc.), antibiotic marker genes (such as those that confer resistance to kanamycin and related antibiotics nptII Gene that confers resistance to the herbicide phosphinothricin bar Gene that confers resistance to the antibiotic hygromycin hph genes, and those conferring resistance to methotrexate dhfr Genes, such as EPSPS genes that confer resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0020] In the above application, the vector may be a plasmid, a cosmid, a phage or a viral vector. The plasmid may be pCAMBIA1300- GFP vector or pFGC5941 vector.

[0021] B3) The recombinant vector may specifically be pCAMBIA1300- IbGSTL2 - GFP The pCAMBIA1300- IbGSTL2 - GFP The vector pCAMBIA1300- GFP of Kpn I and Bam The small fragment between the HI recognition sequences was replaced with the IbGSTL2 gene shown in SEQ ID No. 2 to obtain a recombinant vector. Recombinant vector pCAMBIA1300- IbGSTL2 - GFP It can express the IbGSTL2 protein shown in SEQ ID No.1.

[0022] B9) The recombinant vector may be pFGC5941- IbGSTL2 The pFGC5941- IbGSTL2The restriction endonuclease Xho I and Swa I recognition sequence is replaced with the 10-119th position in SEQ ID No.2, and the restriction endonuclease Bam HI and Xba The small fragment between the I recognition sequences is replaced with the reverse complementary sequence at positions 10-119 in SEQ ID No. 2 to obtain a recombinant vector.

[0023] In the above application, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium, such as Agrobacterium EHA105, Agrobacterium rhizogenes K599 and the like.

[0024] In the above applications, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs do not include propagation materials.

[0025] In the above application, the starch content may be the total starch content, the amylose content and / or the amylopectin content. The total starch is the total content of amylopectin and amylose.

[0026] In the above application, the substance for regulating the content or activity of IbGSTL2 protein is a substance that increases the content or activity of IbGSTL2 protein, the substance for regulating the content of plant starch is to increase the total starch content of the plant, the substance for regulating the ratio of amylose to amylopectin in plant starch is to reduce the ratio of amylose in plant starch or increase the ratio of amylopectin in plant starch, and the change in starch content is to increase the total starch content; The substance that regulates the content or activity of IbGSTL2 protein is a substance that reduces the content or activity of IbGSTL2 protein, the substance that regulates the plant starch content is a substance that reduces the total starch content of the plant, the substance that regulates the ratio of amylose to amylopectin in the plant starch is a substance that increases the ratio of amylose in the plant starch or reduces the ratio of amylopectin in the plant starch, and the starch content is changed to reduce the total starch content.

[0027] The starch synthesis-related enzyme may be a granule-bound starch synthase, a sucrose synthase and / or a starch branching enzyme. The present invention also provides any of the following methods: X1) A method for cultivating a plant with increased starch content, comprising expressing the IbGSTL2 protein in a recipient plant, or increasing the content or activity of the IbGSTL2 protein in the recipient plant, to obtain a target plant with increased starch content compared with the recipient plant; X2) A method for increasing the starch content of a plant, comprising expressing the IbGSTL2 protein in a recipient plant, or increasing the content or activity of the IbGSTL2 protein in the recipient plant, thereby obtaining a target plant having an increased starch content compared with the recipient plant, thereby achieving an increase in the starch content of the plant; X3) A method for cultivating a plant with reduced starch content, comprising reducing the content or activity of IbGSTL2 protein in a recipient plant, or reducing the expression level of a gene encoding the IbGSTL2 protein in a recipient plant, to obtain a target plant with reduced starch content compared with the recipient plant; X4) A method for reducing the starch content of a plant, comprising reducing the content or activity of an IbGSTL2 protein in a recipient plant, or reducing the expression level of a gene encoding the IbGSTL2 protein in a recipient plant, thereby obtaining a target plant having a reduced starch content compared to the recipient plant, thereby achieving a reduction in the starch content of the plant.

[0028] In the above methods, the methods X1) and X2) can be achieved by introducing the gene encoding the IbGSTL2 protein into the recipient plant; The methods described in X3) and X4) are achieved by RNA interference method.

[0029] The RNA interference can be achieved by introducing the DNA molecule represented by formula (I) into the recipient plant; SEQ reverse-X-SEQ forward (I); In the same chain, the reverse sequence of the SEQ is complementary to the sequence of the SEQ forward, and the sequence of the SEQ forward is a part of SEQ ID No. 2 in the sequence list; the X is an interval sequence between the SEQ forward and the SEQ reverse, and the X is not complementary to either the SEQ forward or the SEQ reverse.

[0030] Specifically, the SEQ forward sequence is the 10th to 119th position of SEQ ID No. 2 in the sequence list.

[0031] The recombinant vector can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).).

[0032] The target plant is understood to include not only the first generation plant in which the IbGSTL2 protein or its encoding gene is modified, but also its progeny. For the target plant, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus, complete plants and cells.

[0033] The IbGSTL2 protein or the substance that regulates the content or activity of the IbGSTL2 protein also falls within the protection scope of the present invention.

[0034] In the present invention, the plant may be any one of M1)-M5): M1) dicotyledonous plants; M2) Tubulariaceae; M3) Convolvulaceae; M4) Ipomoea plants; M5) Sweet potato.

[0035] The starch in the present invention may be starch in roots (such as tuberous roots).

[0036] The experiment showed that compared with wild-type plants, overexpression IbGSTL2 Plants with the gene had higher starch content and amylopectin ratio, and the activity of key enzymes involved in amylopectin synthesis was increased; IbGSTL2 Plants with the gene had lower starch content and amylopectin ratio, and the activity of key enzymes involved in amylopectin synthesis was reduced, indicating that the IbGSTL2 protein and its encoding gene can regulate not only starch content but also the ratio of amylopectin to amylose.

[0037] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 For overexpression IbGSTL2 Gene expression in sweet potato plants and interference IbGSTL2 PCR identification results of sweet potato plants with overexpressed genes. IbGSTL2 PCR identification results of sweet potato plants with positive gene, B is interference expression IbGSTL2 PCR identification results of gene-positive sweet potato plants; M is DNA molecule Marker, WT is genomic DNA of wild-type sweet potato plants, W is negative control water, and P is positive control vector (pCAMBIA1300- IbGSTL2 -GFP or pFGC5941- IbGSTL2 ), OE-G1~OE-G11 are overexpressed IbGSTL2 Genomic DNA of sweet potato positive plants, Ri-G1 to Ri-G4 are interference expression IbGSTL2 Genomic DNA from sweet potato positive plants.

[0039] Figure 2 for IbGSTL2 Gene overexpression IbGSTL2 Gene sweet potato positive plants and interference expression IbGSTL2 Analysis of expression levels in gene-positive sweet potato plants. WT is the wild-type sweet potato plant, OE-G1 to OE-G11 are overexpressed IbGSTL2 Gene sweet potato plants, Ri-G1 to Ri-G4 are interference expression IbGSTL2 Genetically modified sweet potato plants.

[0040] Figure 3 The results of the determination of total starch content, amylose ratio and amylopectin ratio of sweet potato tubers are shown in Figure 1. A is the result of the determination of total starch content, B is the result of the determination of amylose ratio, and C is the result of the determination of amylopectin ratio; WT is the wild-type sweet potato plant, OE-G3, OE-G4 and OE-G6 are overexpressed IbGSTL2 Genetic sweet potato plants, Ri-G3 and Ri-G4 are interference expression IbGSTL2 Genetically modified sweet potato plants.

[0041] Figure 4 Paraffin sections of sweet potato root tubers. WT is the wild-type sweet potato plant, OE-G3, OE-G4 and OE-G6 are overexpressed IbGSTL2 Genetic sweet potato plants, Ri-G3 and Ri-G4 are interference expression IbGSTL2 Gene-positive sweet potato plants; the intracellular granules in the image are starch grains, and the scale bar is 100 μm.

[0042] Figure 5 Observation of starch granule morphology in the tuberous roots of sweet potato plants. WT is the wild-type sweet potato plant, OE-G3, OE-G4 and OE-G6 are overexpressed IbGSTL2 Genetic sweet potato plants, Ri-G3 and Ri-G4 are interference expression IbGSTL2 Genetic sweet potato positive plants; the particles in the picture are starch grains, and the scale bar is 20 μm.

[0043] Figure 6 The activity of GBSS, SS and SBE enzymes in the tuberous roots of sweet potato plants. A is the result of GBSS activity determination, B is the result of SS activity determination, and C is the result of SBE activity determination; WT is the wild-type sweet potato plant, OE-G3, OE-G4 and OE-G6 are overexpressedIbGSTL2 Genetic sweet potato plants, Ri-G3 and Ri-G4 are interference expression IbGSTL2 Genetic sweet potato positive plants. DETAILED DESCRIPTION

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0045] The following examples were processed using SPSS 11.5 statistical software, and the experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used. P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference. The quantitative tests in the following examples were all repeated at least three times.

[0046] The sweet potato variety "Li Zi Xiang" is recorded in the following literature: "Xue Luyao. Sweet Potato IbbHLH118 , IbNF-YA1 and IbNF-YA10 Research on the function and molecular regulation mechanism of genes, PhD dissertation, China Agricultural University, 2022. The public can obtain it from the Key Laboratory of Sweet Potato Biology and Biotechnology of China Agricultural University to repeat this experiment, but it cannot be used for other purposes.

[0047] Vector pCAMBIA1300- GFP Recorded in the following literature: Luo, H., Meng, D., Liu, H., Xie,M., Yin, C., Liu, F., Dong, Z.,&Jin, W. (2020). Ectopic Expression of the Transcriptional Regulator silky3 Causes Pleiotropic Meristem and SexDetermination Defects in Maize Inflorescences. The Plant cell, 32(12), 3750-3773. The public can obtain the sample from the Sweetpotato Genetics and Breeding Laboratory of China Agricultural University to replicate this experiment.

[0048] The vector pFGC5941 is described in the following literature: McGinnis, K., Chandler, V., Cone, K., Kaeppler, H., Kaeppler, S., Kerschen, A., Pikaard, C., Richards, E., Sidorenko, L., Smith, T., Springer, N., & Wulan, T. (2005). Transgene-induced RNA interference as a tool for plant functional genomics. Methods inenzymology, 392, 1-24. The public can obtain it from the Sweet Potato Genetics and Breeding Laboratory of China Agricultural University to repeat this experiment.

[0049] The seamless cloning enzyme comes from the Hieff Clone® PlusOne Step Cloning Kit (10911ES) of Yisheng Biotechnology (Shanghai) Co., Ltd.

[0050] Example 1: Application of IbGSTL2 protein in increasing starch content in plants This example provides a method for Ipomoea batatas ) A protein related to starch content in H283 is named IbGSTL2 protein, its amino acid sequence is shown in SEQ ID No.1 in the sequence table, and its encoding gene is shown in SEQ ID No.2.

[0051] 1. Recombinant vector pCAMBIA1300- IbGSTL2 - GFP Construction 1. Artificially synthesize the double-stranded DNA molecule shown in SEQ ID No. 2. Use the double-stranded DNA molecule as a template and use pCAMBIA1300- IbGSTL2 -F and pCAMBIA1300- IbGSTL2 -R is a primer for PCR amplification to obtain a restriction endonuclease Kpn I and Bam HI recognition sequence of double-stranded DNA molecule fragment A.

[0052] pCAMBIA1300- IbGSTL2 -F: 5′-ACGGGGGACGAGCTC GGTACC ATGGCTACTCCAAGCGTTG-3' (underlined is the restriction endonuclease Kpn I recognition sequence); pCAMBIA1300- IbGSTL2 -R: 5′-CATGTCGACTCTAGA GGATCC GGCCATAAAGCGACTC-3' (underlined is restriction endonuclease Bam HI recognition sequence).

[0053] 2. Use restriction endonucleases Kpn I and Bam HI double restriction vector pCAMBIA1300- GFP , a vector backbone of approximately 10444 bp was recovered.

[0054] 3. Fragment A was homologously recombined with the vector backbone obtained in step 2 using seamless cloning enzyme to obtain the recombinant vector pCAMBIA 1300- IbGSTL2 - GFP .

[0055] According to the sequencing results, pCAMBIA1300- IbGSTL2 - GFP To transform the vector pCAMBIA1300- GFP of Kpn I and Bam The recombinant vector obtained by replacing the small fragment between the HI recognition sequences with the IbGSTL2 gene shown in SEQ ID No. 2 is the recombinant vector pCAMBIA1300- IbGSTL2 - GFP It can express the IbGSTL2 protein shown in SEQ ID No.1.

[0056] 2. Recombinant vector pFGC5941- IbGSTL2 Construction 1. Artificially synthesize a double-stranded DNA molecule with a nucleotide sequence as shown in SEQ ID No. 2. Using the double-stranded DNA molecule as a template, select the sequence from positions 10 to 119 in SEQ ID No. 2 as an interference sequence, and use pFGC5941-IbGSTL2-UF and pFGC5941-IbGSTL2-UR as primers for PCR amplification to obtain DNA fragment B. The primer sequences are as follows: pFGC5941- IbGSTL2 -UF: 5'-TTGGAGAGGACACG CTCGAG CCAAGCGTTGAAGAGGTCC -3' (underlined is restriction endonuclease Xho I recognition sequence); pFGC5941- IbGSTL2 -UR: 5'-AAGAAATTCTTACAC ATTTAAATTGGGCAAAGGGGCACT -3' (underlined is restriction endonuclease Swa I recognition sequence).

[0057] 2. Use restriction endonucleases Xho I and Swa I double-digested vector pFGC5941 to recover about 10 kb of vector backbone 1. Fragment B was connected to vector backbone 1 using homologous recombinase to obtain recombinant vector pFGC5941-U.

[0058] 3. Artificially synthesize a double-stranded DNA molecule with a nucleotide sequence as shown in SEQ ID No. 2. Using the double-stranded DNA molecule as a template, select the sequence from positions 10 to 119 of SEQ ID No. 2 as an interference sequence, and use pFGC5941- IbGSTL2 -DF and pFGC5941- IbGSTL2 -DR was used as primer for PCR amplification to obtain DNA fragment C. The primer sequences are as follows: pFGC5941- IbGSTL2 -DF: 5'-AATTTGCAGGTATTT GGATCC TGGGCAAAGGGGCACT -3' (underlined is restriction endonuclease Bam HI recognition sequence); pFGC5941- IbGSTL2 -DR: 5'-GGTCTTAATTAACTC TCTAGA CCAAGCGTTGAAGAGGTCC -3' (underlined is restriction endonuclease Xba I recognition sequence).

[0059] 4. Use restriction endonucleases Bam HI and Xba I double-digested the recombinant vector pFGC5941-U and recovered the approximately 10 kb vector backbone 2. The fragment C was connected to the vector backbone 2 using the homologous recombinase to obtain the recombinant vector pFGC5941- IbGSTL2 .

[0060] According to the sequencing results, pFGC5941- IbGSTL2 The restriction endonuclease Xho I and Swa I recognition sequence is replaced with the 10-119th position in SEQ ID No.2, and the restriction endonuclease Bam HI and Xba The small fragment between the I recognition sequences is replaced with the reverse complementary sequence at positions 10-119 in SEQ ID No. 2 to obtain a recombinant vector.

[0061] 3. Obtaining transgenic sweet potato plants 1. Overexpression IbGSTL2 Obtaining transgenic sweet potato plants: 1) Insert the recombinant vector pCAMBIA1300- IbGSTL2 - GFP Introduce Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which is named EHA105 / pCAMBIA1300- IbGSTL2 - GFP .

[0062] 2) Peel off the stem apex meristem of chestnut fragrance about 0.5 mm long and place it in a solution containing 2 mg L -1 2, 4-D MS solid medium, 27 ± 1 ℃ dark induction culture for 4 to 6 weeks, to obtain embryonic callus. Then the embryonic callus was transferred to a medium containing 2 mg L -1 After 3 to 4 weeks of shaking culture and propagation in 2,4-D MS liquid medium, an embryonic cell suspension culture system with a diameter of 0.7 to 1.3 mm that can be used for transformation is obtained.

[0063] 3) Cultivation of Agrobacterium: Activate Agrobacterium culture on a resistant plate, pick a single colony and inoculate it into 20 mL of LB liquid medium to which the corresponding antibiotic has been added, and culture overnight at 28°C with shaking at 200 rpm until OD 600 The value was in the range of 0.5 to 0.7. Centrifuge at 5000 rpm and remove the supernatant. Wash the cells twice with an equal volume of LB medium and an equal volume of 2 mgL -1 After washing the cells once with MS liquid medium containing 2,4-D, an equal volume of -1 Resuspend the bacteria in 2,4-D MS liquid medium to obtain Agrobacterium resuspension.

[0064] 4) Infection and co-cultivation: Suspend the chestnut fragrant embryonic cell mass in the prepared Agrobacterium resuspension solution, shake it for a while to fully disperse it so that the embryonic cell mass can fully contact the bacterial solution, let it stand for 5 minutes, then use a pipette to suck out the bacterial solution, and move the infected embryonic cell mass to a medium containing 30 mg L -1 AS and 2 mg L -1 Co-cultivation was carried out on MS solid medium containing 2,4-D, and a layer of ordinary filter paper was spread on the solid medium. The culture was carried out in the dark at 27±1℃ for 3 days.

[0065] 5) Selection culture and regeneration of transgenic plants: After 3 days of co-culture, the embryonic cell mass was gently scraped off with a blade and incubated with 500 mg L -1 Cephalosporin and 2 mg L -12,4-D was washed three times with MS liquid medium and then transferred into liquid medium containing 100 mg L -1 Cephalosporin and 2 mg L -1 2,4-D in MS liquid medium, and culture for 1 week. Then, the liquid medium was drained as much as possible and placed on a plate covered with 1 to 2 layers of filter paper and containing 5 mg L -1 Hygromycin, 100 mg L -1 Cephalosporin and 2 mg L -1 The selection culture was carried out on solid MS medium containing 2,4-D at 27±1℃ in the dark. After 2 weeks, the callus tissue with good growth status was transferred to a medium covered with a layer of filter paper and containing 11 mg L -1 Hygromycin, 100 mg L -1 Cephalosporin and 2 mg L -1 The selected culture was carried out on solid MS medium containing 2,4-D. The culture was then subcultured every 2 weeks. -1 Hygromycin, 100 mg L -1 Cephalosporin and 2.0 mg L -1 After 8 weeks of selective culture on solid MS medium containing 2,4-D, the resistant calli formed were transferred to solid MS medium containing 100 mg L -1 Cephalosporin and 1 mg L -1 The culture conditions were 27±1℃, 13h per day, 3000 lux light, and induced somatic embryos. After 2 to 4 weeks of induction, the mature somatic embryos were transferred to MS solid medium and cultured at 27±1℃, 13h per day, 3000 lux light. After 4 to 8 weeks of culture, the complete overexpression cells were regenerated. IbGSTL2 Genetic sweet potato. The regenerated plantlets were cut and subcultured on MS solid medium at 27±1℃, 13 h per day, 3000 lux light, and subcultured once every 6 weeks.

[0066] 2. Interference expression IbGSTL2 Obtaining transgenic sweet potato plants: Using chestnut aroma as receptor plant, interfering with the expression of IbGSTL2 Among them, Lizixiang has the same sequence as H283 IbGSTL2 Gene sequence and IbGSTL2 protein sequence.

[0067] 1) Insert the recombinant vector pFGC5941- IbGSTL2 Introduce Agrobacterium rhizogenes K599 to obtain recombinant Agrobacterium, which is named K599 / pFGC5941- IbGSTL2 .

[0068] 2) Pre-treat the sweet potato variety Li Zixiang stem segments: Create wounds at the nodes of the sweet potato variety Li Zixiang stem segments to create conditions for subsequent Agrobacterium rhizogenes infection. Select sweet potato stem segments that are in good condition, fresh and healthy for treatment. Each stem segment contains the top stem tip and 4 to 10 side branches below it. Use a blade to remove the side branches in the middle and lower parts of the stem segment to form a wound surface, leaving only the top 1 to 2 side branches. Use a needle to pierce holes at the stem nodes to create wounds, and pierce 6 to 8 holes in the stem nodes and the area 1 cm above and below.

[0069] 3) Cultivation of Agrobacterium: Agrobacterium rhizogenes K599 / pFGC5941- IbGSTL2 The culture was expanded in a shaking incubator at 28°C until OD600 was between 0.8 and 1.0 to obtain a culture solution of Agrobacterium rhizogenes.

[0070] 4) Infect the sweet potato stem segments with Agrobacterium rhizogenes solution: Soak the pretreated stem segments in the Agrobacterium rhizogenes solution, ensuring that the wound area is completely immersed in the solution, and place them at 28°C in the dark for 12 h.

[0071] 5) Planting: Ridge the field, take out the infected stem segments from the bacterial solution and plant them in the soil. IbGSTL2 Genetic sweet potato.

[0072] 3. Identification of transgenic plants using PCR and qRT-PCR 1) Detection of DNA level using PCR: Extraction of chestnut aroma from wild-type sweet potato and overexpressed IbGSTL2 Gene sweet potato, interference expression IbGSTL2 The DNA of sweet potato was used for PCR identification. IbGSTL2 - GFP and pFGC5941- IbGSTL2 The recombinant vector was used as a positive control, and water and wild-type WT were used as negative controls. The primers are as follows: Overexpression IbGSTL2 Primers used for identification of genetic sweet potato: IbGSTL2 -OE-JF: 5′-GAAAAAGAAGACGTTCCAACCA-3′; IbGSTL2 -OE-JR: 5′-GGCCATAAAGCGACTCTTGTAG-3′.

[0073] Interference expression IbGSTL2 Primers used for the sweet potato gene determination: IbGSTL2 -Ri-JF: 5′-TGACGTAAGGGATGACGCA-3′; IbGSTL2 -Ri-JR: 5′-TGGGCAAAGGGGCACT-3′.

[0074] The amplified PCR products were separated by electrophoresis in 1% (w / v) agarose gel. PCR-positive plants should have a specific 866 bp (overexpression IbGSTL2 sweet potato) and 204 bp (interference expression IbGSTL2 Genetic sweet potato) electrophoresis bands.

[0075] The results are as follows Figure 1 As shown in A, the positive control pCAMBIA1300- IbGSTL2 - GFP and overexpression IbGSTL2 The sweet potato genes OE-G1 to OE-G11 showed electrophoretic bands around 866 bp. Figure 1 As shown in B, the positive control pFGC5941- IbGSTL2 and interference expression IbGSTL2 The gene sweet potato Ri-G1 to Ri-G4 showed electrophoresis bands around 204 bp, while the wild-type sweet potato and the negative control showed no bands, and it was preliminarily determined that OE-G1 to OE-G11 and Ri-G1 to Ri-G4 of the present invention were the target positive sweet potatoes.

[0076] 2) Detection of RNA levels using qRT-PCR: RNA was extracted from positive sweet potato plants and reverse transcribed to obtain cDNA for qRT-PCR. The wild type sweet potato chestnut fragrance was used as the control and the sweet potato IbActin The gene was used as an internal reference. The primers used are as follows: IbActin Gene: IbActin- F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′; IbActin- R: 5′-GGAAAATTAGAAGCACTTCCTGTGAAC-3′.

[0077] IbGSTL2 Gene: IbGSTL2 -F: 5′-AGGTCCGCGTTCCATCTTTG -3′; IbGSTL2 -R: 5′-CAAAGGGGCACTGGTAATTGA -3′.

[0078] The results are as follows Figure 2 As shown, the results show that IbGSTL2 Overexpression of genes IbGSTL2 The gene was significantly upregulated in sweet potato plants and IbGSTL2Three overexpressing transgenic sweet potato plants (OE-G3, OE-G4 and OE-G6) and two interference-expressing transgenic sweet potato plants (Ri-G3 and Ri-G4) were selected for propagation, and the T1 generation sweet potato lines OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 were obtained for subsequent experiments.

[0079] Four, IbGSTL2 Determination of starch content in transgenic sweet potato roots The tested sweet potatoes included wild-type Lizixiang (WT), T1 transgenic sweet potato lines OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4.

[0080] 1. IbGSTL2 Determination of total starch content in transgenic sweet potato roots The starch content in the tubers of sweet potato plants was measured using a starch content test kit (Suzhou Keming Biotechnology Co., Ltd., DF-2-Y). Fresh sweet potato tubers of T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 and wild-type plants planted in the isolated field for 120 days were selected.

[0081] The results are as follows Figure 3 As shown in A, overexpression IbGSTL2 The starch content of sweet potato tubers increased by 13.00-26.44% compared with the wild type, while the interference expression IbGSTL2 The starch content of genetically modified sweet potato tubers was reduced by 12.72-17.22% compared with the wild type.

[0082] 2. IbGSTL2 Determination of the proportion of amylose and amylopectin in transgenic sweet potato roots The sweet potato tubers of T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 and wild-type plants planted in an isolated field for 120 days were cleaned, dried, ground and crushed, dissolved in deionized water and the mixture was passed through a 100-mesh sieve. The filtered suspension was allowed to settle and the supernatant was removed. The obtained precipitate was placed in an oven at 40°C and dried to constant weight to obtain sweet potato tuber starch.

[0083] The colorimetric assay was performed based on the principle that amylose and iodine reagents can produce a blue color. For specific assay methods, please refer to Ren, Z., He, S., Zhao, N., Zhai, H., & Liu, Q. (2019). A sucrose non-fermenting-1-related protein kinase-1 gene, IbSnRK1, improves starch content, composition, granule size, degree of crystallinity and gelatinization in transgenic sweetpotato. Plant biotechnology journal, 17(1), 21–32. The results are as follows Figure 3 As shown in B, overexpression IbGSTL2 The proportion of amylose in the root starch of the transgenic sweet potato was reduced by 30.97-50.86% compared with the wild-type plants, while the interference expression IbGSTL2 The amylose content in the root starch of genetically modified sweet potatoes increased by 14.11-35.55% compared with that of wild-type plants.

[0084] The amylopectin content test kit (Suzhou Keming Biotechnology Co., Ltd., ZHDF-2-Y) was used to determine the amylopectin ratio of the obtained sweet potato root starch.

[0085] The results are as follows Figure 3 As shown in C, overexpression IbGSTL2 The proportion of amylopectin in the root tubers of the transgenic sweet potato increased by 9.65-11.74% compared with the wild-type plants, while the interference expression IbGSTL2 The proportion of amylopectin in the root tubers of genetically modified sweet potatoes was reduced by 4.37-5.46% compared with that of wild-type plants.

[0086] five, IbGSTL2 Observation of Starch Granules in Transgenic Sweet Potato Plants 1. IbGSTL2 Observation on paraffin sections of transgenic sweet potato roots The T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 and the wild-type plant Li Zixiang sweet potato tubers planted in the isolated field for 120 days were taken, cleaned, and the middle part of the tubers was taken to make paraffin sections. The method is as follows: 1) Immerse the material in FAA fixative for more than 48 hours.

[0087] 2) Dehydrate the fixed material using gradient concentrations of 50%, 70%, 80%, 95%, and 100% ethanol or its aqueous solution, with each concentration treated for 30 minutes.

[0088] 3) Treat the sample twice with a mixture of xylene and 100% ethanol in a ratio of 1:1, each time for 30 minutes, to decolorize the plant cells and make them transparent.

[0089] 4) Place the treated material in paraffin for 30 minutes and perform two treatments, each time in an oven at 40°C overnight.

[0090] 5) Pour the melted paraffin into the embedding container, use hot tweezers to quickly move the material into the embedding container, and position it with the observation side facing downward.

[0091] 6) Then move the embedding device to the water surface and slowly immerse it in the water. After the paraffin is completely solidified, take it out of the water and mark the name and date of the embedded block.

[0092] 7) After trimming, gluing and finishing the embedded material, use a little paraffin to fix the wax block on the wood block, then fix the wood block on the microtome, and adjust the slicer holder or material holder to bring the slicer close to the wax block, adjust the slice thickness to 2 mm, slice, and move the slices with a brush to a plate covered with black paper.

[0093] 8) Place the cut wax strips on the drying table to flatten the slices. Then apply a small drop of glycerin on the slide and use the outside of your little finger to apply it into a thin layer. The area applied should be larger than the area occupied by the wax strips. The thinner and more evenly applied, the better. Dry at 37°C.

[0094] 9) Place the slide in a staining jar containing xylene to remove the paraffin (10 to 20 minutes), and repeat this operation twice.

[0095] 10) Finally, dyeing is carried out. The completely dewaxed materials are dyed through the following procedure: 1 / 2 xylene + 1 / 2 ethanol → 100% ethanol → 95% ethanol aqueous solution → 85% ethanol aqueous solution → 70% ethanol aqueous solution → 50% ethanol aqueous solution → 1% safranin dye (more than 4 hours) → 50% ethanol aqueous solution → 70% ethanol aqueous solution → 85% ethanol aqueous solution → 95% ethanol aqueous solution → 0.5% Fast Green (1 minute) → 95% ethanol aqueous solution → 100% ethanol aqueous solution → 100% ethanol aqueous solution (the reaction time for steps without time specified is 3 minutes).

[0096] 11) Place in xylene for 3 minutes until transparent.

[0097] 12) Add neutral gum to seal the prepared specimen.

[0098] After the slices were prepared, they were observed and photographed using an upright and inverted microscope (Revolve; Echo).

[0099] The results are as follows Figure 4 As shown, overexpression IbGSTL2 The number of starch granules in root cells of sweet potato with gene expression was significantly higher than that of wild-type plants, while the number of starch granules in root cells of sweet potato with gene expression was significantly higher than that of wild-type plants. IbGSTL2 The number of starch granules in the root cells of genetically modified plants was significantly less than that of wild-type plants.

[0100] 2. Under an electron microscope IbGSTL2 Observation of Starch Granules in Root Tubers of Transgenic Sweet Potato Observation using a scanning electron microscope (Hitachi S-3400N) IbGSTL2 Morphological characteristics of starch granules in the tuberous roots of transgenic strains and wild-type plants. Cut a conductive adhesive of appropriate size, tear off the protective paper on its conductive surface, and immerse the adhesive strip in a dry starch sample that has passed a 100-mesh sieve. After taking it out, use a rubber-tipped dust blower to blow away the excess starch sample attached to the conductive surface of the adhesive strip, leaving only a layer of starch particles evenly adhering to the conductive surface. In the process of blowing the starch sample, keep a certain distance from other starch samples on the desktop to avoid flying starch particles from mixing with other samples. After sticking the conductive adhesive strips with samples attached to them on the sample table in order, use an ion sputtering sprayer to spray gold on the surface of the starch sample, and observe by scanning electron microscopy after the treatment.

[0101] The results are as follows Figure 5 As shown, IbGSTL2 The starch granules in the root tubers of transgenic sweet potatoes and those in the root tubers of wild-type sweet potatoes are both normal oval in shape, and also contain a small amount of irregular starch granules. IbGSTL2 There was no significant difference in the size of starch granules in the root tubers of transgenic sweet potatoes and those in the root tubers of wild-type sweet potatoes.

[0102] six, IbGSTL2 Determination of enzyme activities in transgenic sweet potato roots 1. IbGSTL2 Determination of GBSS activity in transgenic sweet potato roots Granule-bound starch synthase (GBSS, EC 2.4.1.21) is a key enzyme that determines the synthesis of amylose. The activity of GBSS in the tubers of sweet potato plants was measured using a GBSS activity assay kit (Suzhou Keming Biotechnology Co., Ltd., GBSS-1-Y). The tubers of sweet potato plants were selected from the T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 and the wild-type plant Li Zixiang, which were planted in the field for 120 days.

[0103] The results are as follows Figure 6 As shown in A, overexpression IbGSTL2 The activity of GBSS in the root tubers of sweet potato plants with gene expression was significantly lower than that in wild-type plants, while the activity of GBSS in the root tubers of sweet potato plants with gene expression was significantly lower than that in wild-type plants. IbGSTL2 The activity of GBSS in the root tubers of sweet potatoes from transgenic plants was significantly higher than that in wild-type plants, indicating that IbGSTL2 Overexpression of the gene leads to a decrease in GBSS activity, which further leads to a decrease in the proportion of amylose. IbGSTL2Interfering with gene expression has the opposite effect.

[0104] 2. IbGSTL2 Determination of SS activity in transgenic sweet potato roots Sucrose synthase (SS) activity assay kit (Suzhou Keming Biotechnology Co., Ltd., SSS-1-Y) was used to measure the activity of SS in the tubers of sweet potato plants. The tubers of sweet potato plants were selected from the T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 and the wild-type plant Li Zixiang, which were planted in the field for 120 days.

[0105] The results are as follows Figure 6 As shown in B, overexpression IbGSTL2 The activity of SS in the root tubers of sweet potato with transgenic plants was significantly higher than that in wild-type plants, while the interference expression IbGSTL2 The activity of SS in sweet potato root tubers of transgenic plants was significantly lower than that of wild-type plants.

[0106] 3. IbGSTL2 Determination of SBE activity in transgenic sweet potato roots Starch branching enzyme (SBE) is a key enzyme directly involved in starch biosynthesis, which catalyzes the formation of branched starch at the α-1,6 glycosidic bond branch point. The activity of SBE in the tuberous roots of sweet potato plants was measured using an SBE activity assay kit (Suzhou Keming Biotechnology Co., Ltd., SBE-2-Y). The tuberous roots of sweet potato plants were selected from the T1 transgenic plants OE-G3, OE-G4, OE-G6, Ri-G3 and Ri-G4 planted in the isolated field for 120 days and the sweet potato tuberous roots of wild-type plants.

[0107] The results are as follows Figure 6 As shown in C, overexpression IbGSTL2 The activity of SBE in the root tubers of sweet potato with transgenic plants was significantly higher than that in wild-type plants, while the interference expression IbGSTL2 The activity of SBE in the root tubers of sweet potatoes of genetically modified plants was significantly lower than that of wild-type plants, indicating that IbGSTL2 Overexpression of the gene leads to an increase in SBE activity, which further leads to an increase in the proportion of amylopectin. IbGSTL2 Interfering with gene expression has the opposite effect.

[0108] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Any of the following uses of a protein or a substance for regulating the content or activity of the protein: D1) Regulate the starch content of plants; D2) preparing products for regulating plant starch; D3) Regulate the ratio of amylose to amylopectin in plant starch; D4) preparing products for regulating the ratio of amylose to amylopectin in plant starch; D5) Cultivating plants with altered starch content; D6) preparing products from plants with altered starch content; D7) Cultivating plants with altered ratios of amylose to amylopectin in starch; D8) preparing products of plants cultivated with modified ratios of amylose to amylopectin in starch; D9) regulates the activity of enzymes related to starch synthesis in plants; The protein is as follows: A1), A2) or A3): A1) a protein whose amino acid sequence is SEQ ID No. 1; A2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 1 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

2. The use according to claim 1, characterized in that: The substance that regulates the protein content or activity is any one of the following B1) to B9): B1) a nucleic acid molecule encoding the protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) a nucleic acid molecule that reduces the content or activity of the protein; B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is as follows (b11) or (b12): b11) The coding sequence is the DNA molecule of SEQ ID No. 2 in the sequence list; b12) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) and encodes the protein.

4. The use according to any one of claims 1 to 3, characterized in that: The starch content is the total starch content, the amylose content and / or the amylopectin content.

5. The use according to any one of claims 1 to 4, characterized in that: The substance for regulating the protein content or activity is a substance for increasing the protein content or activity, the substance for regulating the plant starch content is for increasing the total starch content of the plant, the substance for regulating the ratio of amylose to amylopectin in the plant starch is for reducing the ratio of amylose in the plant starch or increasing the ratio of amylopectin in the plant starch, and the change in starch content is for increasing the total starch content; The substance for regulating the protein content or activity is a substance for reducing the protein content or activity, the substance for regulating the plant starch content is for reducing the total starch content of the plant, the substance for regulating the ratio of amylose to amylopectin in plant starch is for increasing the ratio of amylose in plant starch or reducing the ratio of amylopectin in plant starch, and the change in starch content is for reducing the total starch content.

6. The use according to any one of claims 1 to 5, characterized in that: The plant is any one of M1)-M5): M1) dicotyledonous plants; M2) Tubulariaceae; M3) Convolvulaceae; M4) Ipomoea plants; M5) Sweet potato.

7. Any of the following methods: X1) A method for cultivating a plant with increased starch content, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in a recipient plant, to obtain a target plant with increased starch content compared with the recipient plant; X2) A method for increasing the starch content of a plant, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in a recipient plant, thereby obtaining a target plant having an increased starch content compared with the recipient plant, thereby increasing the starch content of the plant; X3) A method for cultivating plants with reduced starch content, comprising reducing the content or activity of the protein of claim 1 in a recipient plant, or reducing the expression level of the gene encoding the protein of claim 1 in a recipient plant, to obtain a target plant with reduced starch content compared with the recipient plant; X4) A method for reducing the starch content of a plant, comprising reducing the content or activity of the protein described in claim 1 in a recipient plant, or reducing the expression level of the gene encoding the protein described in claim 1 in a recipient plant, thereby obtaining a target plant with a reduced starch content compared to the recipient plant, thereby achieving a reduction in the starch content of the plant.

8. The method according to claim 7, characterized in that: The methods X1) and X2) are achieved by introducing a gene encoding the protein of claim 1 into the recipient plant; The methods described in X3) and X4) are achieved by RNA interference method.

9. The method according to claim 7 or 8, characterized in that: The plant is any one of M1)-M5): M1) dicotyledonous plants; M2) Tubulariaceae; M3) Convolvulaceae; M4) Ipomoea plants; M5) Sweet potato.

10. The protein according to claim 1 or the substance for regulating the content or activity of the protein according to any one of claims 1 to 3.

Images